Molecular marker related to correction day age of 100 kg weight of pig and application of molecular marker
By discovering and utilizing the SNP sites c.4359 (G>A) and c.4335 (G>A) in the CDS region of the porcine GREB1 gene, the problem of age-corrected when pigs reach 100kg weight was solved, enabling accurate identification and breeding optimization of pig growth traits, and improving breeding efficiency and economic benefits.
Patent Information
- Application Number
- CN202511871583.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-12
- Publication Date
- 2026-02-24
AI Technical Summary
The lack of effective molecular markers in existing technologies for assessing the corrected age of pigs at 100kg weight affects the assessment of pig growth traits and breeding management.
Two SNP sites (c.4359 (G>A) and c.4335 (G>A)) were identified in the CDS region of the porcine GREB1 gene. PCR sequencing kits or KASP genotyping kits were designed for detection. The genotype of the pig was determined by PCR amplification and sequencing, enabling the identification of pigs at 100kg body weight corrected age.
By detecting these SNP loci, the growth rate of pigs can be accurately identified, which helps in the selection of fast-growing meat breeds and improves breeding efficiency and economic benefits.
Smart Images

Figure CN121555652A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular genetics, specifically to a molecular marker associated with the corrected age of pigs reaching 100kg weight and its application. Background Technology
[0002] In pig breeding practice, the age at which pigs reach 100kg body weight is an important indicator for evaluating growth traits. Since it's impossible to directly measure the age at which pigs reach 100kg, a correction formula for this age is needed. This formula is developed based on the relationship between weight and age for a specific breed of pig, aiming to provide a fair comparison and evaluation between pigs of different ages and weights measured at different times. The corrected age at 100kg body weight is now widely used in pig growth and management to assess indicators such as feed digestibility and production costs, playing a crucial role in improving pig production efficiency and reducing production costs.
[0003] GREB1 The gene is primarily expressed in the ovaries, with a small amount also expressed in the kidneys; this level of expression likely has a significant impact on reproductive traits. In studies conducted to date, both domestically and internationally, GREB1 Genes primarily influence reproduction and can be regulated by estrogen, thereby controlling cells. For example, estradiol can regulate cell function. GREB1 Regulation of gene expression promotes the progression of bladder cancer. Patent CN 118879877A... GREB1 A SNP molecular marker associated with pig reproductive traits was identified in intron 23 of a gene, laying the foundation for genetic improvement of litter size. However, no further evidence has been found. GREB1 Reports on the relationship between genes and the corrected age of pigs reaching 100kg weight. Summary of the Invention
[0004] In view of the above-mentioned prior art, the purpose of this invention is to provide a molecular marker related to the corrected age of pigs reaching 100kg weight and its application.
[0005] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a molecular marker associated with age-corrected weight of 100 kg in pigs, the nucleotide sequence of which is shown in SEQ ID NO.1 and includes SNP1 and SNP2 sites; the 87th base from the 5′ end of the sequence shown in SEQ ID NO.1 is the SNP1 site, and its base is G or A; the 111th base from the 5′ end of the sequence shown in SEQ ID NO.1 is the SNP2 site, and its base is G or A.
[0006] The specific nucleotides of the molecular marker are as follows: ATGACCTTCAGCTCATGGCTTTAAGAGCCTGTCCCCAAGGACTCTGGAGGCAGGTGGAAGCGAGAGACTGAAAAACTCTGACCTTC[G / A](SNP1)CTCTTTATGCGCTGATGGT GTGA[G / A](SNP2)CAGATGAGACTGGCATCCTGGTACTTGGGGTCATGAATAGTGTAGTCGAAAGGCAACTTCTTGAACAGCTCCAGGTCCGGCCAGGGGTCAGTGAGCTGCA.
[0007] Note: The nucleotides in bold shaded areas in the sequence are SNP sites, represented by "n" in the sequence listing.
[0008] This invention in pigs GREB1 Two SNP loci significantly associated with corrected age at 100 kg body weight were found in the CDS region of the gene (Gene ID: 100511013), namely: SNP1 locus: c.4359 (G>A), located at positions 125, 114, 290 on pig chromosome 3 (based on the Sscrofa11.1 reference genome). SNP2 locus: c.4335 (G>A), located at positions 125, 114, 314 on pig chromosome 3 (based on the Sscrofa11.1 reference genome).
[0009] Both c.4359(G>A) and c.4335(G>A) are synonymous mutations. The mutation at c.4359(G>A) does not alter the serine codon, and the mutation at c.4335(G>A) does not alter the cysteine codon. However, association analysis showed a highly significant association between these two sites and the growth rate trait in pigs. This suggests that these synonymous mutations may indirectly affect the growth rate by altering mRNA splicing efficiency, influencing RNA secondary structure, regulating translation kinetics, or through linkage disequilibrium with functional variations. GREB1 Gene function, thereby regulating growth traits. Meanwhile, these two mutation sites exhibit complete linkage disequilibrium (R²=1.0), forming a conserved haplotype block.
[0010] In a second aspect, the present invention provides a detection reagent for the above-mentioned molecular marker, comprising primers shown in SEQ ID NO.2 and SEQ ID NO.3.
[0011] FP_GREB1_SNP4359_4335: 5'-ATGACCTTCAGCTCATGGCTTT-3'; (SEQ ID NO.2) RP_GREB1_SNP4359_4335: 5'-AGAAGTTGCCTTTTGACTACACT-3'. (SEQ ID NO.3) Preferably, the detection reagent is a PCR sequencing kit or a KASP typing kit.
[0012] A third aspect of the present invention provides the application of the above-described molecular markers or detection reagents in the following (1) or (2): (1) Identify age-corrected traits in pigs that reach a weight of 100kg; (2) Pig genetics and breeding.
[0013] In the above applications, pig genetic breeding refers to the selection and breeding of meat breeds or strains with fast growth rates.
[0014] A fourth aspect of the present invention provides a method for identifying age-corrected traits in pigs at 100kg body weight, comprising the following steps: Using the genomic DNA of the pigs to be tested as a template, PCR amplification was performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products; the amplification products were sequenced, and the age-corrected traits of the pigs at 100kg weight were identified based on the sequencing results.
[0015] Specifically, the sequencing results of the amplified products correspond to the molecular markers shown in SEQ ID NO.1. Individuals with both SNP1 and SNP2 sites being GA genotypes, and individuals whose corrected age at 100kg weight is shorter than that of individuals with both SNP1 and SNP2 sites being GG or AA genotypes.
[0016] Preferably, the PCR amplification system is as follows: 12.5 µL of 2×Phanta Max Buffer, 0.5 µL of dNTP Mix (10 mMeach), 0.5 µL of Phanta Max Super-Fidelity DNA Polymerase, 1 µL of DNA template, 1 µL each of primer FP_GREB1 (10 µM) shown in SEQ ID NO.2 and primer RP_GREB1 (10 µM) shown in SEQ ID NO.3, and 8.5 µL of ddH2O.
[0017] The PCR reaction procedure was as follows: heated to 110℃; pre-denaturation at 95℃ for 3 minutes; denaturation at 95℃ for 15 seconds, annealing at 60℃ for 15 seconds, extension at 72℃ for 15 seconds, for a total of 35 cycles; and final extension at 72℃ for 5 minutes.
[0018] The beneficial effects of this invention are: This invention is the first of its kind in GREB1Two SNP loci significantly associated with the corrected age of 100 kg body weight in pigs were identified in the CDS region of the gene. These two SNP loci showed complete linkage disequilibrium and constituted a conserved haplotype block. Both mutation sites were highly significantly associated with the corrected age of 100 kg body weight in pigs (P < 0.001), with the corrected age of the GA genotype being significantly shorter than that of the GG and AA genotypes. Detecting this molecular marker associated with the corrected age of 100 kg body weight is helpful for breeding fast-growing meat breeds / lines and is of great significance for pig breed selection. Attached Figure Description
[0019] Figure 1 Results of the chain imbalance analysis. Detailed Implementation
[0020] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0021] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.
[0022] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions.
[0023] Example 1: Screening, identification, and association analysis of molecular markers associated with corrected age of 100kg weight in pigs. 1. Test materials: 2061 Large White pigs were raised under the same standard conditions, with no open wounds or other signs of disease or injury, and no abnormal behavior.
[0024] Blood samples were collected via the anterior vena cava method, with sodium citrate (ACD) used as anticoagulant at a ratio of 6:1. After cryopreservation, the samples were brought back to the laboratory for genomic DNA extraction.
[0025] 2. Test methods: (1) Low-coverage whole-genome sequencing (LcWGS) The extracted, high-quality DNA was sent to a sequencing company for low-depth whole-genome sequencing. After obtaining the raw sequencing data, quality control and alignment were performed, and polymorphic sites across the entire genome were initially screened. Subsequently, genotyping was performed on the low-depth sequencing data using statistical models and reference panels to obtain a high-accuracy whole-genome genotype dataset. Using low-depth sequencing technology, genome scanning was conducted on Danish and French Large White pig populations with significant phenotypic differences to obtain SNP genotype datasets. Bioinformatics analysis was used to calculate the Fst value of each SNP site between the Danish and French Large White pig populations, and the genetic diversity (π) within the genomic sliding window was calculated for both populations. By combining the peak values of Fst and π Ratio, several genomic regions with the strongest selection signals were located across the entire genome. Then, genes with known functions and phenotypic associations were searched within these regions. Finally, genes were extracted from this dataset. GREB1 Genotypes of specific polymorphic sites in genes are used for subsequent analysis.
[0026] (2) Pig GREB1 Association analysis between gene polymorphism sites and age corrected to 100kg body weight Extracted pig GREB1 Association analysis was performed between genotype data of specific polymorphic sites of genes and phenotypic data of Large White pigs at the corrected age of 100kg weight. A general linear model analysis was performed using SPSS software, and one-way ANOVA was selected, with French and Danish lines and sex as fixed effects.
[0027] Corrected age (d) for reaching 100kg weight = Measured age (d) - [(Measured weight (kg) - 100kg) / CF].
[0028] CF is the correction factor, CF = (actual weight / actual age) × lean meat percentage adjustment factor × sex adjustment factor.
[0029] Lean meat percentage: The coefficient is obtained by looking up the back fat thickness directly in a table, which is usually measured by ultrasound at the 3rd-4th intercostal space from the bottom. Boars: sex adjustment coefficient = 1.08; Castrated boars: sex adjustment coefficient = 1.03; Sows: sex adjustment coefficient = 1.00.
[0030] 3. Results and Analysis: (1) Results and analysis of low-depth whole-genome resequencing of DNA By comparing the sequencing results and analyzing the sequencing peak diagram, it can be concluded that: GREB1A total of 54 significant SNP sites were identified in the gene (P<0.05). A comparison with the NCBI database revealed that 50 of these significant SNP sites were located in introns, and 4 significant sites were located in exons, specifically within the CDS region of those exons. Further analysis of the 4 exon sites yielded the data shown in Table 1.
[0031] Table 1: Large White Pigs GREB1 Gene SNP sites In Table 1, the g.125114290 locus (c.4359, G>A) and the g.125114314 locus (c.4335, G>A) are the main loci tested in this experiment. Among the 2061 pigs tested, only one individual with the GG genotype was identified at the g.125114434 locus; the data was too limited to be reliable and therefore not analyzed. Similarly, only six individuals with the AA genotype were identified at the g.125152017 locus in the tested pig population; the data was too limited to be reliable and therefore not analyzed. Mass spectrometry analysis revealed... GREB1 The genotypes of gene loci g.125114290 (c.4359, G>A) and g.125114314 (c.4335, G>A) were obtained. Genotype frequencies and gene frequencies were calculated from the genotypes. Then, SPSS was used to perform a Hardy-Weinberg equilibrium test to obtain the degrees of freedom, p-value, and chi-square value. GREB1 The genetic data for the c.4359 (G>A) and c.4335 (G>A) loci are shown in Table 2.
[0032] Table 2: GREB1 Genetic data of gene loci c.4359 (G>A) and c.4335 (G>A) As shown in Table 2, the dominant gene at both loci is G in Large White pigs, with GG and GA being the dominant genotypes.
[0033] Because the two loci exhibit complete genotypic identity (co-segregation) within each individual but show variation among different individuals, PLINK is used to calculate linkage disequilibrium (LD) indices between these two loci, including the coefficient of determination (R²). 2 ) and standardized chain imbalance coefficient (D , If D , and R 2 If all values are equal to 1 (or very close to 1), it indicates that they are fully linked. LD analysis results are as follows: Figure 1 As shown.
[0034] Chain imbalance analysis shows that, GREB1 The two CDS region SNP sites of the gene (c.4359G>A and c.4335G>A) showed complete linkage disequilibrium (R0). 2 =1.0), indicating that they constitute a conservative haplotype block. D , = 1 (displayed as DP in the output) indicates that no recombination events were observed between these two sites, and they have remained in complete linkage disequilibrium throughout evolutionary history. The two SNPs are only 24 bp apart; at such a short distance, the recombination rate is almost zero, so complete linkage is the expected outcome.
[0035] (2) Pig GREB1 Association analysis results of gene polymorphism sites with age corrected to 100kg body weight pig GREB1 The association analysis results between gene polymorphism sites and corrected age at 100kg weight are shown in Table 3.
[0036] Table 3: GREB1 Association analysis between gene SNP loci and corrected age at 100kg body weight As shown in Table 3, GREB1 The c.4359 (G>A) locus of the gene was highly significantly correlated with the corrected age at which Large White pigs reached 100 kg weight. P <0.01), the corrected age of the GA genotype was significantly shorter than that of the GG and AA genotypes, indicating that there is an overdominant genetic effect at this locus, and that heterozygotes have a growth rate advantage. GREB1 The c.4335 (G>A) locus of the gene was significantly correlated with the corrected age at which Large White pigs reached 100 kg weight (P<0.01). The corrected age of the GA genotype was significantly shorter than that of the GG and AA genotypes, indicating that there is an overdominant genetic effect at this locus and that heterozygotes have a growth rate advantage.
[0037] In molecular breeding applications, both loci exhibit significant heterozygous advantage, and the optimal selection strategy is to retain the heterozygous genotype (GA). Compared to GG homozygotes, selecting the GA genotype can shorten the growth cycle by approximately 3.15 days, resulting in significant economic benefits. However, due to the overdominant inheritance characteristics, this desirable trait cannot be fixed through conventional breeding methods. It is necessary to maintain an appropriate heterozygous ratio in the breeding system or to fully utilize heterosis through hybridization breeding strategies.
[0038] Example 2: Molecular markers associated with age-corrected at 100kg weight in pigs and their application validation 1. Design of molecular markers and detection primers related to the corrected age of pigs reaching 100kg weight: For the traits related to backfat thickness in pigs screened in Example 1 GREB1 The gene's CDS region mutation sites c.4359 (G>A) and c.4335 (G>A) were identified. Molecular markers containing these two mutation sites were further designed, and their nucleotide sequences are shown in SEQ ID NO.1. The 87th base in the sequence is SNP1, with a base of either G or A; the 111th base is SNP2, with a base of either G or A.
[0039] Primer pairs were designed using PrimerPremier 5.0 software to detect the aforementioned molecular markers. The primer pair sequences are as follows: FP_GREB1_SNP4359_4335: 5'-ATGACCTTCAGCTCATGGCTTT-3'; (SEQ ID NO.2) RP_GREB1_SNP4359_4335: 5'-AGAAGTTGCCTTTTGACTACACT-3'. (SEQ ID NO.3) 2. Application Validation: Another 100 Large White pigs with corrected age records reaching 100 kg were selected as experimental animals. Genomic DNA was extracted from these animals and PCR amplification was performed using the primer pairs described above. The PCR reaction system consisted of: 12.5 µL of 2×Phanta Max Buffer, 0.5 µL of dNTP Mix (10 mM each), 0.5 µL of Phanta Max Super-Fidelity DNA Polymerase, 1 µL of DNA template (50-100 ng), 1 µL each of primers FP_GREB1 (10 µM) and RP_GREB1 (10 µM), and 8.5 µL of ddH2O.
[0040] The PCR reaction procedure was as follows: heated to 110℃; pre-denaturation at 95℃ for 3 minutes; denaturation at 95℃ for 15 seconds, annealing at 60℃ for 15 seconds, extension at 72℃ for 15 seconds, for a total of 35 cycles; and final extension at 72℃ for 5 minutes.
[0041] The amplified products were sequenced, and the age-corrected traits at 100kg body weight were predicted and identified based on the sequencing results.
[0042] Specifically, the sequencing results of the amplified products correspond to the molecular marker shown in SEQ ID NO.1. Individuals with both SNP1 (c.4359 (G>A) site) and SNP2 (c.4335 (G>A) site) genotypes are GA, and individuals whose corrected age at 100kg weight is shorter than that of individuals with both SNP1 and SNP2 sites being GG or AA genotypes are AA.
[0043] The predicted identification results were compared with the actual recorded age information for reaching 100kg weight. The results showed that the predicted age for reaching 100kg weight based on the genotype of the mutation site was consistent with the actual recorded results, indicating that the molecular marker detection of pigs at the age for reaching 100kg weight in this invention is accurate and reliable and has practical application value.
[0044] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.
Claims
1. A molecular marker associated with age-corrected at 100kg body weight in pigs, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, which includes SNP1 and SNP2 sites; the 87th base from the 5′ end of the sequence shown in SEQ ID NO.1 is the SNP1 site, and its base is G or A; the 111th base from the 5′ end of the sequence shown in SEQ ID NO.1 is the SNP2 site, and its base is G or A.
2. A detection reagent for detecting the molecular marker of claim 1, characterized in that, It contains the primers shown in SEQ ID NO.2 and SEQ ID NO.
3.
3. The detection reagent according to claim 2, characterized in that, The detection reagent is a PCR sequencing kit or a KASP typing kit.
4. The use of the molecular marker of claim 1 or the detection reagent of claim 2 in the following (1) or (2): (1) Identify age-corrected traits in pigs that reach a weight of 100kg; (2) Pig genetics and breeding.
5. The application according to claim 4, characterized in that, The pig genetic breeding refers to the selection and breeding of meat breeds or strains with fast growth rates.
6. A method for identifying age-corrected traits in pigs at 100kg body weight, characterized in that, Includes the following steps: Using the genomic DNA of the pigs to be tested as a template, PCR amplification was performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products; the amplification products were sequenced, and the age-corrected traits of the pigs at 100kg weight were identified based on the sequencing results.
7. The method according to claim 6, characterized in that, The sequencing results of the amplified products correspond to the molecular markers shown in SEQ ID NO.
1. Individuals with both SNP1 and SNP2 sites being GA genotypes, and individuals whose corrected age at 100kg weight is shorter than those with both SNP1 and SNP2 sites being GG or AA genotypes.
8. The method according to claim 6, characterized in that, The PCR amplification system consisted of: 12.5 µL of 2×Phanta Max Buffer, 0.5 µL of dNTP Mix, 0.5 µL of Phanta Max Super-Fidelity DNA Polymerase, 1 µL of DNA template, 1 µL each of the primers shown in SEQ ID NO.2 and SEQ ID NO.3, and 8.5 µL of ddH2O.
9. The method according to claim 6, characterized in that, The PCR reaction procedure was as follows: heated to 110℃; pre-denaturation at 95℃ for 3 minutes; denaturation at 95℃ for 15 seconds, annealing at 60℃ for 15 seconds, extension at 72℃ for 15 seconds, for a total of 35 cycles; and final extension at 72℃ for 5 minutes.
Citation Information
Patent Citations
Application of genetic marker in assisted selection of reproductive traits of large white sows
CN118879877A