Compositions and methods for treating GJB2-associated hearing loss

Abstract

The present disclosure provides polynucleotides and nucleic acid vectors containing a GJB2 regulatory construct operably linked to a polynucleotide encoding a gap junction protein beta2 (Gjb2) protein (e.g., a wild-type human Gjb2 protein). These polynucleotides and vectors can be used to express Gjb2 in cells expressing GJB2, including cochlear supporting cells, and thus can be used to treat subjects suffering from or at risk of developing GJB2-related hearing loss.

Description

[0001] sequence list This application contains a sequence list that has been submitted electronically in XML file format and incorporated herein by reference in its entirety. The XML copy was created on May 8, 2024, named 51471-015WO2_Sequence_Listing_5_8_24.xml, and has a size of 128,752 bytes. Background Technology

[0002] Hearing loss is a major public health problem, estimated to affect nearly 15% of school-aged children and one-third of people aged 65. The most common type of hearing loss is sensorineural hearing loss, which is a type of hearing loss caused by defects in inner ear cells (such as cochlear hair cells and cochlear supporting cells) or in the neural pathways extending from the inner ear to the brain. While sensorineural hearing loss is often acquired, it can also be caused by gene mutations. Mutations in the GJB2 gene, which encodes gap connexin β2 (Gjb2, also known as connexin 26), are the most common cause of sensorineural hearing loss due to gene mutations.

[0003] In recent years, efforts to treat hearing loss have increasingly focused on gene therapy as a potential solution; however, GJB2 is endogenously expressed in various inner ear cell types that have proven difficult to target specifically. This is problematic because gene therapies for hearing loss that induce exogenous gene expression in all cells of the inner ear may have off-target effects or cause toxicity. Therefore, new therapeutic agents are needed for treating GJB2-related hearing loss. Summary of the Invention

[0004] This invention provides compositions and methods for promoting the expression of genes encoding wild-type gap junction protein β2 (Gjb2), such as CpG-depleted GJB2 genes, codon-optimized GJB2 genes, or CpG-depleted and codon-optimized GJB2 genes, in GJB2-expressing cells (e.g., inner ear cells expressing GJB2). The compositions described herein comprise nucleic acid vectors containing regulatory elements that can induce the expression of transgenes encoding wild-type Gjb2 protein in GJB2-expressing cells with minimal off-target expression in cells not expressing GJB2. Therefore, the compositions described herein can be administered to subjects, such as human subjects, to induce the expression of wild-type GJB2 protein in GJB2-expressing cells (e.g., in GJB2-expressing inner ear cells, e.g., in subjects with GJB2 mutations) and / or to treat or prevent hearing loss (e.g., sensorineural hearing loss, such as GJB2-related hearing loss).

[0005] In a first aspect, the present invention provides a nucleic acid vector comprising, in 5' to 3' order: (a) a GJB2 regulatory construct having at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) with a sequence of SEQ ID NO: 1 or SEQ ID NO: 2, operatively ligated to: (b) a human GJB2 coding sequence selected from: SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 28, and SEQ ID NO: 2. NO:3 has at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and contains a sequence that has at least 50% less CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides) and a sequence that has at least 90% sequence identity with SEQ ID NO: 4 or SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), which is operatively linked to: (c) a polyadenylation (polyA) signal sequence.

[0006] In another aspect, the present invention provides a polynucleotide comprising a sequence selected from the human GJB2 coding sequence of: SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 28, a sequence having at least 90% sequence identity with SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and containing at least 50% less CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides), and a sequence having at least 90% sequence identity with SEQ ID NO: 4 or SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity). In some embodiments, a GJB2 promoter is operatively linked to the GJB2 coding sequence. In some embodiments, the GJB2 promoter is located at the 5' of the GJB2 coding sequence. In some embodiments, the GJB2 promoter is included in a GJB2 regulatory construct. In some embodiments, the GJB2 coding sequence is operatively linked to a polyA signal sequence. In some embodiments, the polyA signal sequence is located at the 3' of the GJB2 coding sequence.

[0007] In another aspect, the present invention provides a nucleic acid vector containing polynucleotides as described above.

[0008] In some embodiments of any of the foregoing aspects, the GJB2 regulatory construct has at least 90% sequence identity with the sequence of SEQ ID NO: 1 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity). In some embodiments of any of the foregoing aspects, the GJB2 regulatory construct has the sequence of SEQ ID NO: 1.

[0009] In some embodiments of any of the foregoing aspects, the GJB2 regulatory construct has at least 90% sequence identity with the sequence of SEQ ID NO: 2 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity). In some embodiments of any of the foregoing aspects, the GJB2 regulatory construct has the sequence of SEQ ID NO: 2.

[0010] In some embodiments of any of the foregoing aspects, the human GJB2 coding sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and contains at least 50% less CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides). In some embodiments of any of the foregoing aspects, the human GJB2 coding sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and does not contain CG dinucleotides. In some embodiments of any of the foregoing aspects, the human GJB2 coding sequence has the sequence of SEQ ID NO: 3.

[0011] In some embodiments of any of the foregoing aspects, the human GJB2 coding sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 4 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity). In some embodiments of any of the foregoing aspects, the human GJB2 coding sequence has the sequence of SEQ ID NO: 4.

[0012] In some embodiments of any of the foregoing aspects, the human GJB2 coding sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity). In some embodiments of any of the foregoing aspects, the human GJB2 coding sequence has the sequence of SEQ ID NO: 28.

[0013] In some embodiments of any of the foregoing aspects, the stop codon is located at 3' of the GJB2 coding sequence (e.g., the stop codon is directly attached to the 3' end of the GJB2 coding sequence).

[0014] In some embodiments of any of the foregoing aspects, the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 3. In some embodiments of any of the foregoing aspects, the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 4. In some embodiments of any of the foregoing aspects, the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 28. In some embodiments of any of the foregoing aspects, the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 3. In some embodiments of any of the foregoing aspects, the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 4. In some embodiments of any of the foregoing aspects, the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 28.

[0015] In some embodiments of any of the foregoing aspects, the polyA signal sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity). In some embodiments, the polyA signal sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 6 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity). In some embodiments, the polyA signal sequence has the sequence of SEQ ID NO: 6. In some embodiments, the polyA signal sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 7 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity). In some embodiments, the polyA signal sequence has the sequence of SEQ ID NO: 7.

[0016] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide further comprises a first polynucleotide having at least 90% sequence identity with SEQ ID NO: 8 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and a second polynucleotide having at least 90% sequence identity with SEQ ID NO: 9 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), the first polynucleotide containing a first member of an inverted terminal repeat (ITR) pair and located at the 5' of the GJB2 regulatory construct sequence or the GJB2 promoter sequence, and the second polynucleotide containing a second member of the ITR pair and located at the 3' of the polyA signal sequence. In some embodiments, the first polynucleotide has the sequence of SEQ ID NO: 8, and the second polynucleotide has the sequence of SEQ ID NO: 9.

[0017] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide further comprises a first polynucleotide having at least 90% sequence identity with SEQ ID NO: 10 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and a second polynucleotide having at least 90% sequence identity with SEQ ID NO: 11 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), the first polynucleotide containing a first member of an ITR pair and located at the 5' of the GJB2 regulatory construct sequence or the GJB2 promoter sequence, and the second polynucleotide containing a second member of an ITR pair and located at the 3' of the polyA signal sequence. In some embodiments, the first polynucleotide has the sequence of SEQ ID NO: 8, and the second polynucleotide has the sequence of SEQ ID NO: 9.

[0018] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 157 to 2383 of SEQ ID NO: 12. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 2531 of SEQ ID NO: 12.

[0019] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 157 to 2383 of SEQ ID NO: 13. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 2531 of SEQ ID NO: 13.

[0020] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 157 to 3459 of SEQ ID NO: 14. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 3607 of SEQ ID NO: 14.

[0021] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 157 to 3459 of SEQ ID NO: 15. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 3607 of SEQ ID NO: 15.

[0022] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 157 to 2462 of SEQ ID NO: 16. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 2610 of SEQ ID NO: 16.

[0023] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 157 to 2462 of SEQ ID NO: 17. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 2610 of SEQ ID NO: 17.

[0024] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 157 to 3538 of SEQ ID NO: 18. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 3686 of SEQ ID NO: 18.

[0025] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 157 to 3538 of SEQ ID NO: 19. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 3686 of SEQ ID NO: 19.

[0026] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 212 to 2438 of SEQ ID NO: 20. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 2650 of SEQ ID NO: 20.

[0027] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 212 to 2438 of SEQ ID NO: 21. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 2650 of SEQ ID NO: 21.

[0028] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 212 to 3514 of SEQ ID NO: 22. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 3726 of SEQ ID NO: 22.

[0029] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 212 to 3514 of SEQ ID NO: 23. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 3726 of SEQ ID NO: 23.

[0030] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 212 to 2517 of SEQ ID NO: 24. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 2729 of SEQ ID NO: 24.

[0031] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 212 to 2517 of SEQ ID NO: 25. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 2729 of SEQ ID NO: 25.

[0032] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 212 to 3593 of SEQ ID NO: 26. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 3805 of SEQ ID NO: 26.

[0033] In some embodiments of any of the foregoing aspects, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 212 to 3593 of SEQ ID NO: 27. In some embodiments, the nucleic acid vector or the polynucleotide contains a polynucleotide sequence including nucleotides 1 to 3805 of SEQ ID NO: 27.

[0034] In some embodiments of any of the foregoing aspects, the nucleic acid vector is a viral vector, plasmid, granule, or artificial chromosome. In some embodiments, the nucleic acid vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector, an adenovirus vector, or a lentiviral vector. In some embodiments, the viral vector is an AAV vector. In some embodiments, the AAV vector has a capsid of AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB, or PHP.S. In some embodiments, the AAV vector has an AAV1 capsid. In some embodiments, the AAV vector has an AAV9 capsid. In some embodiments, the AAV vector has a 7m8 capsid. In some embodiments, the AAV carrier has a PHP.S shell. In some embodiments, the AAV carrier has an AAV-DJ shell. In some embodiments, the AAV carrier has an Anc80 shell. In some embodiments, the AAV carrier has an Anc80L65 shell. In some embodiments, the AAV carrier has an AAV2 shell. In some embodiments, the AAV carrier has an AAV2quad(YF) shell. In some embodiments, the AAV carrier has a PHP.eB shell. In some embodiments, the AAV carrier has an AAV3 shell. In some embodiments, the AAV carrier has an AAV4 shell. In some embodiments, the AAV carrier has an AAV5 shell. In some embodiments, the AAV carrier has an AAV6 shell. In some embodiments, the AAV carrier has an AAV7 shell. In some embodiments, the AAV carrier has an AAV8 shell. In some embodiments, the AAV carrier has a PHP.B shell.

[0035] In another aspect, the present invention provides a composition comprising a nucleic acid vector of any of the foregoing aspects and embodiments. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier, diluent, or excipient.

[0036] In another aspect, the present invention provides a cell containing a polynucleotide or carrier of any of the foregoing aspects and embodiments. In some embodiments, the cell is a cell expressing GJB2. In some embodiments, the cell is an inner ear cell expressing GJB2. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the cell is a cochlear support cell.

[0037] In another aspect, the present invention provides a method for expressing human GJB2 in GJB2-expressing cells by contacting GJB2-expressing cells with a nucleic acid vector or composition of any of the foregoing aspects and embodiments. In some embodiments, the GJB2-expressing cells are GJB2-expressing inner ear cells (e.g., cochlear support cells). In some embodiments, the contact is performed in a subject (e.g., in vivo).

[0038] In another aspect, the present invention provides a method for treating a subject by administering a therapeutically effective amount of any of the aforementioned aspects and embodiments of a nucleic acid vector or composition to the inner ear of a subject suffering from GJB2-related hearing loss or at risk of developing GJB2-related hearing loss. In some embodiments, GJB2-related hearing loss is DFNB1, DFNA3, or hearing loss associated with Bart-Pumphrey syndrome, hystrix-like ichthyosis with deafness, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with deafness, or Vohwinkel syndrome. In some embodiments, GJB2-related hearing loss is DFNB1 or DFNA3. In some embodiments, the subject has a mutation in GJB2, a mutation in GJB6, or a mutation in both GJB2 and GJB6.

[0039] In another aspect, the present invention provides a method for improving cochlear support cell function or cochlear support cell survival by contacting cochlear support cells with a nucleic acid carrier or composition of any of the foregoing aspects and embodiments. In some embodiments, the contact is in a subject.

[0040] In another aspect, the present invention provides a method for improving cochlear support cell function or cochlear support cell survival in a subject by administering a therapeutically effective amount of any of the foregoing aspects and embodiments of a nucleic acid carrier or composition to the inner ear of a subject in need.

[0041] In some embodiments of any of the foregoing aspects, the subject has GJB2-related hearing loss or is at risk of developing GJB2-related hearing loss. In some embodiments, GJB2-related hearing loss is DFNB1, DFNA3, or hearing loss associated with Bart-Pomfley syndrome, hystrix-like ichthyosis with deafness, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with deafness, or Warwinkel syndrome. In some embodiments, the hearing loss is DFNB1 or DFNA3.

[0042] In some embodiments of any of the foregoing aspects, the cochlear supporting cells are mammalian cochlear supporting cells. In some embodiments, the mammalian cochlear supporting cells are human cochlear supporting cells.

[0043] In some embodiments of any of the foregoing aspects, the method further includes evaluating the subject's hearing prior to administering the nucleic acid vector or composition.

[0044] In some embodiments of any of the foregoing aspects, the method further includes evaluating the subject's hearing after administration of the nucleic acid vector or composition.

[0045] In some embodiments of any of the foregoing aspects, the nucleic acid carrier or composition is applied topically. In some embodiments, the nucleic acid carrier or composition is applied to the inner ear. In some embodiments, the nucleic acid carrier or composition is applied to the middle ear. In some embodiments, the nucleic acid carrier or composition is applied via or through the tympanic cavity. In some embodiments, the nucleic acid carrier or composition is applied to the perilymph. In some embodiments, the nucleic acid carrier or composition is applied to the endolymph. In some embodiments, the nucleic acid carrier or composition is applied to or through the oval window. In some embodiments, the nucleic acid carrier or composition is applied to or through the round window.

[0046] In some embodiments of any of the foregoing aspects, the nucleic acid vector or composition is applied in an amount sufficient to prevent or reduce hearing loss, delay the development of hearing loss, slow the progression of hearing loss, improve hearing, increase or induce the expression of human GJB2 in GJB2-expressing cells, promote or increase the survival of cochlear support cells, or improve the function of cochlear support cells.

[0047] In some implementations of any of the foregoing aspects, the subjects are human subjects.

[0048] In another aspect, the present invention provides a kit comprising any of the polynucleotides, nucleic acid vectors or compositions described in the foregoing aspects and embodiments.

[0049] definition

[0050] As used in this article, the term “about” refers to a value within 10% above or below the value being described.

[0051] As used herein, “administration” means the delivery or administration of a therapeutic agent (e.g., a nucleic acid vector containing a GJB2 regulatory construct operatively linked to a multinucleotide encoding the wild-type Gjb2 protein) to a subject via any effective route. Exemplary routes of administration are described below.

[0052] As used herein, the phrase “administered to the inner ear” means to provide or administer the therapeutic agent described herein to a subject via any route that allows transduction by inner ear cells. Exemplary routes of administration to the inner ear include administration to the perilymph or endolymph, such as administration to the oval window, round window, or semicircular canal (e.g., a supine canal) or through the oval window, round window, or semicircular canal, or by injection into the tympanic cavity or intratympanic cavity, for example, administration to inner ear cells expressing GJB2.

[0053] As used herein, the term "cell type" refers to a group of cells that share a statistically separable phenotype based on gene expression data. For example, cells of common cell types may share similar structural and / or functional characteristics, such as similar gene activation patterns and antigen presentation profiles. Cells of common cell types may include those isolated from common tissues (e.g., epithelial tissue, nervous tissue, connective tissue, or muscle tissue) and / or those isolated from common organs, tissue systems, blood vessels, or other structures and / or regions of an organism.

[0054] As used herein, the terms “conservative mutation,” “conservative substitution,” and “conservative amino acid substitution” refer to the substitution of one or more amino acids into one or more distinct amino acids that exhibit similar physicochemical properties, such as polarity, electrostatic charge, and steric dimensionality. Table 1 summarizes these properties for each of the twenty naturally occurring amino acids.

[0055] Table 1. Representative physicochemical properties of naturally occurring amino acids

[0056]

[0057] From this table, it should be understood that conserved amino acid families include (i) G, A, V, L, and I; (ii) D and E; (iii) C, S, and T; (iv) H, K, and R; (v) N and Q; and (vi) F, Y, and W. Therefore, a conserved mutation or substitution is a mutation or substitution in which an amino acid is replaced by a member of the same amino acid family (e.g., Ser replaced by Thr or Lys replaced by Arg).

[0058] As used herein, the terms “effective amount,” “therapeutic effective amount,” and “sufficient amount” for the compositions, vector constructs, or viral vectors described herein refer to an amount sufficient to achieve a beneficial or desired outcome (including clinical outcomes) when administered to subjects, including mammals (e.g., humans), and therefore, “effective amount” or its synonyms depend on the context in which it is applied. For example, in the context of treating sensorineural hearing loss, it is the amount of the composition, vector construct, or viral vector sufficient to achieve a therapeutic response compared to the response obtained without the administration of the composition, vector construct, or viral vector. The amount of a given composition described herein that will correspond to such an amount will vary depending on various factors, such as the given agent, pharmaceutical formulation, route of administration, type of disease or condition, subject being treated (e.g., age, sex, weight), or host identity, but can still be routinely determined by those skilled in the art. Similarly, as used herein, the “therapeutic effective amount” of the compositions, vector constructs, or viral vectors of this disclosure is the amount that produces a beneficial or desired outcome in subjects compared to a control. As defined herein, the therapeutically effective amount of the compositions, vector constructs, or viral vectors of this disclosure can be readily determined by a person skilled in the art using conventional methods known in the art. Dosing regimens can be adjusted to provide optimal therapeutic response.

[0059] As used herein, the term "endogenous" refers to molecules (e.g., polypeptides, nucleic acids, or cofactors) that are naturally present in a particular organism (e.g., humans) or in a particular location within an organism (e.g., organs, tissues, or cells, such as human cells, such as human cochlear support cells).

[0060] As used herein, the term “expression” refers to one or more of the following events: (1) the generation of an RNA template from a DNA sequence (e.g., by transcription); (2) the processing of the RNA transcript (e.g., by splicing, editing, 5' cap formation, and / or 3' end processing); (3) the translation of RNA into a polypeptide or protein; and (4) post-translational modifications of the polypeptide or protein. The term “expression product” refers to a protein or RNA molecule resulting from any of these events.

[0061] As used herein, the term "exogenous" describes molecules (e.g., polypeptides, nucleic acids, or cofactors) that are not naturally present in a particular organism (e.g., human) or at a specific location within an organism (e.g., an organ, tissue, or cell, such as human cells, such as cochlear support cells). Exogenous substances include those provided to an organism or to cultured material extracted from that organism from an external source.

[0062] As used herein, the terms “Gjb2” and “GJB2” (also known as connexin 26 and CX26) refer to the protein encoded by the GJB2 gene and the gene encoding that protein, respectively. GJB2 is a member of the connexin gene family. Nearly half of all hearing loss is attributed to mutations in one of the four members of the connexin gene family, and GJB2 mutations are the most common. More than 100 different mutations in GJB2 have been identified that lead to nonsyndromic hearing loss, i.e., hearing loss that is not associated with other signs and symptoms. The term “Gjb2” refers to wild-type Gjb2 protein, such as wild-type human Gjb2 protein (e.g., a protein having the amino acid sequence of SEQ ID NO: 29), while the term “GJB2” also refers to codon-optimized and / or CpG-depleted polynucleotides relative to the sequence of the wild-type GJB2 gene (e.g., SEQ ID NO: 5), such as polynucleotides having at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% or higher sequence identity) with any one of SEQ ID NO: 3, 4, and 28, provided that they encode wild-type Gjb2 protein.

[0063] As used herein, the term "cells expressing GJB2" refers to cell types known to endogenously express GJB2 in vivo (e.g., in subjects expressing a wild-type copy of GJB2). Cells expressing GJB2 include esophageal epithelial cells, cervical cells (external cervix), minor salivary gland cells, skin epithelial cells, vaginal epithelial cells, respiratory tract epithelial cells, liver hepatocytes, kidney epithelial cells, testicular cells, mammary gland luminal epithelial cells, pancreatic acinar cells, bladder urothelial cells, intestinal epithelial cells, and inner ear cells expressing GJB2. The term "cells expressing GJB2" also encompasses the same cell types in subjects with GJB2 mutations.

[0064] As used herein, the term "inner ear cells expressing GJB2" refers to cells in the inner ear that endogenously express GJB2 (e.g., in subjects expressing a wild-type copy of GJB2). GJB2-expressing cells are present in both the cochlea and vestibule. Cochlear cells expressing GJB2 include inner finger cells, inner limbal cells, inner column cells, outer column cells, Deiter cells, Hensen cells, Claudius cells, interdental cells, inner sulcus cells, outer sulcus cells, spiral limb cells, spiral ridge cells, root cells, stria vascularis basal cells, stria vascularis intermediate cells, fibroblasts of the spiral limb and spiral ligament, and mesenchymal cells of the vestibular lining. Vestibular cells expressing GJB2 include supporting cells, dark cells, fibroblasts, and mesenchymal cells. The term "inner ear cells expressing GJB2" encompasses the same cell types in subjects with GJB2 mutations.

[0065] As used herein, the term "GJB2 regulatory construct" refers to a polynucleotide or variant thereof capable of specifically expressing a transgene in cells expressing GJB2, such as a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) with respect to the GJB2 regulatory construct described herein. The GJB2 regulatory construct of this disclosure contains one or more regulatory elements, such as a GJB2 promoter and a GJB2 enhancer, and has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) with respect to SEQ ID NO: 1 or SEQ ID NO: 2.

[0066] As used herein, the term “GJB2-associated hearing loss” refers to diseases and disorders characterized by hearing loss associated with mutations in GJB2, such as DFNB1, characterized by moderate to severe prelingual hearing loss and inherited in an autosomal recessive pattern, and DFNA3, characterized by moderate to severe prelingual or postlingual hearing loss that worsens over time and inherited in an autosomal dominant pattern. GJB2-associated hearing loss also occurs in Bart-Pomfray syndrome, hystrix-like ichthyosis with deafness, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with deafness, and Warwinkel syndrome, all of which are characterized by hearing loss and skin abnormalities and are associated with mutations in GJB2. Both types of GJB2-associated hearing loss, DFNB1 and DFNA3, can also be associated with mutations in GJB6, either alone or in combination with mutations in GJB2. For example, a subject with DFNB1 may have a mutation in GJB2, a mutation in GJB6, or mutations in both genes.

[0067] As used herein, the term "heterogeneous" refers to a combination of elements that are not naturally occurring. For example, a heterologous transgene is a transgene that is not naturally expressed by a promoter to which it is operatively linked.

[0068] As used herein, the terms “increase” and “decrease” refer to a regulation that produces a larger or smaller measure of function, expression, or activity relative to a reference. For example, after administration of the composition in the methods described herein, the amount of a marker of a measure as described herein (e.g., transgenic expression, ABR, or DPOAE) may increase or decrease in subjects by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% or more relative to the amount of marker prior to administration. Typically, this measure is measured after administration, at the time when the effect has been achieved, for example, at least one week, one month, three months, or six months after the start of a treatment regimen.

[0069] As used herein, “local” or “local application” refers to an application intended to produce a local rather than systemic effect at a specific site on the body. Examples of local application include epidermal, inhalation, intra-articular, intrathecal, intravaginal, intravitreal, intrauterine, intralesional, lymph node, intratumoral, intraoral, and mucosal application to a subject, where the application is intended to produce a local rather than systemic effect.

[0070] As used herein, the term "operably linked" refers to a first molecule linked to a second molecule, wherein the arrangement of these molecules such that the first molecule influences the function of the second molecule. The two molecules may or may not be part of a single adjacent molecule and may or may not be adjacent. For example, if a promoter regulates the transcription of a transcribed polynucleotide molecule of interest in a cell, then the promoter is operably linked to the transcribed polynucleotide molecule. Additionally, if two parts of a transcriptional regulatory element are linked to each other such that the transcriptional activation function of one part is not adversely affected by the presence of the other part, then the two parts are operably linked to each other. Two transcriptional regulatory elements may be operably linked to each other via a linker polynucleotide (e.g., an intermediate non-coding polynucleotide) or may be operably linked to each other in the absence of an intervening nucleotide.

[0071] As used herein, the term "plasmid" refers to an extrachromosomal circular double-stranded DNA molecule to which another DNA segment can be linked. A plasmid is a vector, a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. Some plasmids can replicate autonomously in the host cell to which they are introduced (e.g., bacterial plasmids with bacterial origins of replication and attachable mammalian plasmids). Other vectors (e.g., non-attachable mammalian vectors) can integrate into the host cell's genome after introduction into the host cell, thereby replicating along with the host genome. Some plasmids can direct the expression of genes to which they are operatively linked.

[0072] As used herein, the terms “nucleic acid” and “polynucleotide”, used interchangeably, refer to a polymeric form of nucleosides of any length. Typically, polynucleotides consist of nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) naturally present in DNA or RNA, linked by phosphodiester bonds. However, the term encompasses molecules containing nucleosides or nucleoside analogs with chemically or biologically modified bases, modified backbones, etc., whether present in naturally occurring nucleic acids, and such molecules may be preferred for certain applications. When this application relates to polynucleotides, it should be understood that DNA and RNA are provided, and in each case, single-stranded and double-stranded forms (and complements for each single-stranded molecule) are provided. As used herein, “polynucleotide sequence” can refer to the polynucleotide material itself and / or the sequence information (i.e., a series of letters used as a base abbreviation) that biochemically characterizes a particular nucleic acid. Unless otherwise specified, polynucleotide sequences given herein are given in a 5' to 3' orientation.

[0073] As used in this article, the term "promoter" refers to a recognition site on DNA that is bound by RNA polymerase. Polymerase drives the transcription of transgenes.

[0074] The "sequence identity percentage (%)" relative to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to those in the reference polynucleotide or polypeptide sequence after sequence alignment and, where necessary, the introduction of vacancies to achieve the maximum sequence identity percentage. Alignment used to determine the nucleic acid or amino acid sequence identity percentage can be performed in various ways within the capabilities of those skilled in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms required to achieve maximum alignment across the full length of the compared sequences. For example, the sequence identity percentage value can be generated using the sequence comparison computer program BLAST. For example, the sequence identity percentage for a given pair of nucleic acid or amino acid sequences A and / or for a given nucleic acid or amino acid sequence B (which can also be expressed alternatively as a certain sequence identity percentage possessed by a given pair of nucleic acid or amino acid sequences A and / or for a given nucleic acid or amino acid sequence B) is calculated as follows:

[0075] 100 × (fraction X / Y)

[0076] Where X is the number of nucleotides or amino acids that are scored as a consistent match in the A and B alignments by a sequence alignment program (e.g., BLAST), and Y is the total number of nucleic acids in B. It should be understood that when the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, the percentage of sequence identity between A and B will not be equal to the percentage of sequence identity between B and A.

[0077] As used herein, the term "pharmaceutical composition" refers to a mixture containing a therapeutic agent, optionally in combination with one or more pharmaceutically acceptable excipients, diluents and / or carriers, to be administered to a subject (such as a mammal, e.g., a human) to prevent, treat or control a particular disease or ailment that affects or may affect the subject.

[0078] As used herein, the term "pharmaceutical acceptable" means those compounds, materials, compositions, and / or dosage forms that are suitable for contact with the tissues of a subject, such as a mammal (e.g., a human), without excessive toxicity, irritation, allergic reactions, and other problematic complications, in proportion to a reasonable benefit / risk ratio. Preferably, the term "pharmaceutical acceptable" means that which is approved by a federal or state regulatory agency or listed in the United States Pharmacopeia or other generally recognized pharmacopoeia for use in mammals, and more specifically, in humans.

[0079] As used herein, the term “sample” refers to a sample isolated from a subject (e.g., blood, blood components (e.g., serum or plasma), urine, saliva, amniotic fluid, cerebrospinal fluid, tissue (e.g., placental or dermal tissue), pancreatic juice, chorionic villus sample, and cells).

[0080] As used herein, the terms “subject” and “patient” refer to an animal (e.g., a mammal, such as a human). A subject to be treated according to the methods described herein may be a subject already diagnosed with sensorineural hearing loss (e.g., GJB2-related hearing loss) or a subject at risk of developing the condition (e.g., due to a gene mutation). Diagnosis can be made by any method or technique known in the art. Those skilled in the art will understand that a subject to be treated according to this disclosure may have already undergone standard testing or may be identified as a subject at risk without examination due to the presence of one or more risk factors associated with the disease or condition.

[0081] As used herein, the terms “transcriptional regulatory element” and “regulatory sequence” refer to polynucleotides that at least partially control the transcription of the gene of interest. Transcriptional regulatory elements may include promoters, enhancers, and other polynucleotides that control or help control gene transcription (e.g., polyadenylation signals). Examples of transcriptional regulatory elements are described, for example, in Lorence, Recombinant Gene Expression: Reviews and Protocols (Humana Press, New York, NY, 2012).

[0082] As used in this article, the term "transfection" refers to any of a wide variety of techniques commonly used to introduce exogenous DNA into prokaryotic or eukaryotic host cells, such as electroporation, lipid transfection, calcium phosphate precipitation, DEAE-glucan transfection, nuclear transfection, squeeze-poration, acoustic transfection, optical transfection, magnetic transfection, and impalefection.

[0083] As used herein, the terms "transduction" and "transduce" refer to methods of introducing a vector construct or a portion thereof into a cell. The vector construct is contained in a viral vector such as an AAV vector, and transduction refers to viral infection of the cell followed by the transfer and integration of the vector construct or a portion thereof into the cell's genome.

[0084] As used herein, “treatment” and “treating” in relation to a disease or ailment refer to methods used to achieve a beneficial or desired outcome (e.g., clinical results). Beneficial or desired outcomes may include, but are not limited to, reducing or improving one or more symptoms or ailments; reducing the severity of a disease or ailment; stabilizing (i.e., not worsening) the state of a disease, condition, or ailment; preventing the spread of a disease or ailment; delaying or slowing the progression of a disease or ailment; improving or alleviating a disease or ailment; and detectable or undetectable remission (partial or complete). “Improving” or “alleviating” a disease or ailment means reducing the severity and / or duration of undesirable clinical manifestations and / or progression of a disease, condition, or ailment compared to its severity or duration without treatment. “Treatment” may also mean prolonging survival compared to expected survival without treatment. Those requiring treatment include those who already have a disease or ailment, those who are susceptible to a disease or ailment, and those who will prevent a disease or ailment.

[0085] As used herein, the term "vector" refers to a nucleic acid vector, such as a DNA vector, such as a plasmid, viscera, or artificial chromosome, an RNA vector, a virus, or any other suitable replicon (e.g., a viral vector). A variety of vectors have been developed for the delivery of polynucleotides encoding foreign proteins into prokaryotic or eukaryotic cells. Examples of such expression vectors are described, for example, in Gellissen, Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems (John Wiley & Sons, Marblehead, MA, 2006). Expression vectors suitable for use with the compositions and methods described herein contain polynucleotide sequences, and, for example, additional sequence elements for expressing proteins and / or integrating these polynucleotide sequences into the genome of mammalian cells. Certain vectors that can be used to express transgenes as described herein include vectors containing regulatory sequences (such as promoter and enhancer regions) that guide gene transcription. Other available vectors for expressing transgenes contain polynucleotide sequences that enhance the translation rate of the transgene or improve the stability of mRNA transcribed from the gene or nuclear export. These sequence elements include, for example, 5' and 3' untranslated regions and polyadenylation signal sites to guide efficient transcription of the gene carried on the expression vector. Expression vectors suitable for use with the compositions and methods described herein may also contain polynucleotides encoding markers for selecting cells containing such vectors. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or norsinotherapy.

[0086] As used in this article, the term "wild type" refers to the genotype that has the highest frequency for a particular gene in a given organism. Attached Figure Description

[0087] Figure 1 This is the plasmid map of plasmid P1588.

[0088] Figure 2 This is the plasmid map of plasmid P1589.

[0089] Figure 3 This is the plasmid map of plasmid P1590.

[0090] Figure 4 This is the plasmid map of plasmid P1592.

[0091] Figure 5 This is the plasmid map of plasmid P1593.

[0092] Figure 6 This is the plasmid map of plasmid P1595.

[0093] Figure 7 This is the plasmid map of plasmid P1596.

[0094] Figure 8 This is the plasmid map of plasmid P1598.

[0095] Figure 9 This is the plasmid map of plasmid P1599.

[0096] Figure 10 This is the plasmid map of plasmid P1601.

[0097] Figure 11 This is the plasmid map of plasmid P1602.

[0098] Figure 12 This is the plasmid map of plasmid P1604.

[0099] Figure 13 This is the plasmid map of plasmid P1605.

[0100] Figure 14 This is the plasmid map of plasmid P1607.

[0101] Figure 15 This is the plasmid map of plasmid P1608.

[0102] Figure 16 This is the plasmid map of plasmid P1610.

[0103] Figure 17 This is the plasmid map of plasmid P1611.

[0104] Figure 18These are images and graphs depicting Gjb2 expression levels in HeLa cells transfected with different plasmids containing various FLAG-tagged forms of the human GJB2 coding sequence under CMV promoter control. Figure A depicts a Western blot showing the Gjb2 expression levels from each plasmid as detected by anti-FLAG antibody. Normalization was also performed using an anti-actin antibody. Figure B depicts the relative intensity of the anti-FLAG signal detected against each plasmid compared to a plasmid carrying the wild-type GJB2 sequence, which was arbitrarily set to 1. “GJB2-free” and “FLAG-free” are negative control plasmids lacking the FLAG-tagged GJB2 coding sequence. “Wild-type” is a plasmid carrying the wild-type GJB2 sequence (SEQ ID NO: 5). “CpG-depleted” is a plasmid carrying the CpG-depleted GJB2 coding sequence (SEQ ID NO: 3) and the FLAG tag. “CodOpt” is a plasmid carrying a codon-optimized GJB2 coding sequence (SEQ ID NO: 28) and a FLAG tag. “CO-CpGdep” is a plasmid carrying a codon-optimized and CpG-depleted GJB2 coding sequence (SEQ ID NO: 4) and a FLAG tag.

[0105] Figure 19 It describes the existence and non-existence of Ca. 2+ Figure A is a series of graphs illustrating the ability of HeLa cells transfected with different plasmids containing various forms of human GJB2 coding sequences controlled by the CMV promoter to take up propidium iodide (“PI”) under two different conditions. Figure A depicts the ability of HeLa cells to take up propidium iodide (“PI”) in the presence and absence of Ca for each transfection. 2+ The percentage of cells that absorbed PI under both conditions. Figure B depicts the percentage of cells that absorbed PI after transfection with either the wild-type GJB2 coding sequence (SEQ ID NO: 5) or the CpG-depleted GJB2 coding sequence (SEQ ID NO: 3) in Ca 2+ The percentage of cells that absorb PI in the presence of PI.

[0106] Figure 20This is a series of graphs depicting the effects of AAV1 vectors carrying either wild-type (SEQ ID NO: 5) or CpG-depleted GJB2 coding sequences (SEQ ID NO: 3) under the control of a GJB2 regulatory construct (SEQ ID NO: 1) on hearing recovery in a GJB2-deficient mouse model. Each AAV1 vector was injected into the right ear of the mice; the left ear served as a negative control. The top graph depicts the effects on auditory brainstem response (ABR) in mice at different time points (in weeks) following injection at different frequencies. The bottom graph depicts the effects on distortion product otoacoustic emissions (DPOAE) in mice at different time points (in weeks) following injection at different frequencies. The upper line in each of the four graphs depicts the results in the untreated left ear of the mice.

[0107] Figure 21 This is a series of graphs depicting the dose-response effect of AAV1 vectors carrying a CpG-depleted GJB2 coding sequence (SEQ ID NO: 3) under the control of a GJB2 regulatory construct (SEQ ID NO: 1) on hearing recovery in a GJB2-deficient mouse model. Each AAV1 vector was injected into the right ear of the mice, and measurements were taken four weeks after vector administration. "Untreated" mice were GJB2-deficient mice that were not treated with the vector. "Primitive WT" mice were non-GJB2-deficient BL6 mice that were not treated with the vector. Figure A depicts the effect of different concentrations of the CpG-depleted GJB2 coding sequence on the mean auditory brainstem response (ABR) threshold in mice compared to untreated and primitive WT mice. Figure B depicts the effect of different concentrations of the CpG-depleted GJB2 coding sequence on the mean DPOAE threshold in mice compared to untreated and primitive WT mice.

[0108] Figure 22 This is a graph depicting the effect of bovine growth hormone (bGH) polyadenylation signal sequence (SEQ ID NO: 7) on the mean expression level of nuclear-targeted green fluorescent protein driven by the CMV promoter (CMV.H2B-EGFP) in HEK293T cells, compared to the simian virus 40 polyadenylation (SV40) polyadenylation signal sequence (SEQ ID NO: 6).

[0109] Figure 23This is a graph depicting the effect of the pAAVdB backbone (3,038 nucleotides spanning nucleotides 2399-5301 and 1-135 of SEQ ID NO: 12) on the mean expression level of H2B-EGFP driven by the CMV promoter (CMV.H2B-EGFP) and possessing the bGH polyadenylation site (bGH_pA) in HEK293T cells compared to the pAAVKan backbone (3,157 nucleotides spanning nucleotides 2454-5420 and 1-190 of SEQ ID NO: 20). "Box 1" and "Box 2" represent two distinct CMV.H2B-EGFP.bGH_pA gene boxes (sequences not shown) with different restriction enzyme cloning sites in their intragene regions but sharing the same pAAVKan or pAAVdB sequence. Detailed Implementation

[0110] This document describes compositions and methods for specifically inducing polynucleotide expression encoding the Gjb2 protein in cells expressing GJB2 (e.g., inner ear cells expressing GJB2, such as cochlear support cells). The invention is characterized by a GJB2 regulatory construct (a construct containing promoter and enhancer elements) that can induce the expression of a polynucleotide encoding the Gjb2 protein (e.g., wild-type Gjb2 protein, such as wild-type human Gjb2) in GJB2-expressing cells (e.g., cochlear support cells), with minimal or no expression in cochlear hair cells. The polynucleotide encoding the Gjb2 protein may be CpG depleted and / or codon-optimized. The invention is further characterized by a nucleic acid vector containing the GJB2 regulatory construct described herein operatively linked to the polynucleotide encoding the Gjb2 protein. The compositions and methods described herein can be used to specifically express the Gjb2 protein in cells expressing GJB2, and therefore, the compositions described herein can be administered to subjects (such as mammalian subjects, e.g., humans) to treat GJB2-related hearing loss (e.g., DFNB1, DFNA3, or hearing loss associated with Bart-Pomfley syndrome, hystrix-like ichthyosis with deafness, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with deafness, or Warwinkel syndrome).

[0111] Supporting cells

[0112] The sensory epithelium of the inner ear contains two main cell types: hair cells and supporting cells. Hair cells are sensory cells of the auditory and vestibular systems residing in the inner ear. Cochlear hair cells are sensory cells of the auditory system and consist of two main cell types: inner hair cells, which are responsible for sensing sound, and outer hair cells, which are thought to amplify low-volume sounds. Vestibular hair cells are located in the terminal organs of the semicircular canals and otolith organs of the inner ear and are involved in sensing movements that contribute to balance and spatial orientation. The development, function, and maintenance of the sensory epithelium of the inner ear are highly dependent on supporting cells, which are non-sensory cells located between hair cells. Supporting cells in the cochlea include Hensen cells, Deiter cells, inner and outer column cells, Claudius cells, inner finger cells, and boundary cells. Supporting cells are connected to each other and to hair cells through tight junctions and adhesive junctions, and they communicate directly with other supporting cells through gap junctions. Gap junctions are composed of connexins encoded by genes such as CX26 (also known as GJB2) and CX30 (also known as GJB6). These connective protein channels play important roles in the circulation and regulation of intracellular K+ and pH homeostasis mechanisms, and also provide a pathway for the rapid removal of ions from sensory cell regions during sound transmission to maintain sensitivity. Supporting cells have a rigid cytoskeleton that maintains the structural integrity of sensory organs during sound stimulation and head movements, and after trauma or toxicity, can expel damaged hair cells from the epithelium, engulf hair cell debris, and in some cases generate new hair cells.

[0113] Gene therapy has recently emerged as an attractive treatment for hearing loss, particularly that caused by mutations in genes expressed in the inner ear. Mutations in many different genes have been found to lead to hearing loss, including those expressed in the supporting cells of the cochlea. For example, mutations in GJB2 are the most common cause of recessive hearing loss. However, treating hearing loss associated with mutations in genes expressed in the supporting cells of the cochlea using gene therapy requires methods that induce gene expression in the supporting cells rather than in the hair cells, methods that are currently quite limited.

[0114] GJB2

[0115] Gap connective protein β2 (Gjb2, also known as connective protein 26) is a protein encoded by the GJB2 gene and is a member of the connective protein gene family. Connective proteins oligomerize into hexamers called connexins or hemichannels, which typically dock with hemichannels from contacting cells to form gap junctions. Nearly half of all hearing loss is attributed to mutations in one of the four members of the connective protein gene family, with GJB2 mutations being the most common. More than 100 different mutations in GJB2 have been identified that cause nonsyndromic hearing loss, which is hearing loss unrelated to other signs and symptoms. One form of nonsyndromic hearing loss associated with mutations in GJB2 is DFNB1, characterized by moderate to severe prelingual hearing loss and inherited in an autosomal recessive pattern. DFNA3 is another form of nonsyndromic hearing loss associated with mutations in GJB2, and is moderate to severe prelingual or postlingual hearing loss that worsens over time and is inherited in an autosomal dominant pattern. Other health conditions associated with mutations in GJB2 include Bart-Pomfry syndrome, hystrix-like ichthyosis with deafness, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with deafness, and Warwinkel syndrome, all of which are characterized by hearing loss and skin abnormalities.

[0116] This invention is based in part on the discovery of an upstream region of the GJB2 coding sequence that can be used to promote the specific expression of a polynucleotide encoding the Gjb2 protein in GJB2-expressing cells (e.g., cochlear support cells). The inventors have also identified CpG-depleted and / or codon-optimized polynucleotide sequences encoding wild-type human Gjb2 that can be used to reduce immune activation induced by gene therapy and / or regulate GJB2 expression levels. Therefore, the compositions and methods described herein can be used to express polynucleotides encoding the Gjb2 protein (e.g., wild-type human Gjb2 protein) in GJB2-expressing cells (e.g., inner ear cells expressing GJB2, such as cochlear support cells) to treat subjects suffering from sensorineural hearing loss (e.g., GJB2-related hearing loss) or at risk of developing such sensorineural hearing loss. The discovery of a GJB2 regulatory construct that induces expression in GJB2-expressing cells while minimizing or eliminating off-target expression in cells that do not endogenously express GJB2 (e.g., cochlear hair cells) could improve the safety and efficacy of gene therapies by reducing the toxicity associated with off-target expression.

[0117] The polynucleotides of the compositions and methods described herein comprise a nucleic acid sequence or a variant thereof containing a GJB2 regulatory element capable of specifically expressing a transgene in cells expressing GJB2, such as a nucleic acid sequence having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) with respect to a nucleic acid sequence containing a GJB2 regulatory element capable of specifically expressing a transgene in cells expressing GJB2. The nucleic acid sequence containing a GJB2 regulatory element capable of specifically expressing a transgene in cells expressing GJB2 is referred to herein as a GJB2 regulatory construct. In some embodiments, the GJB2 regulatory construct has at least 85% sequence identity with SEQ ID NO: 1 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity). In some embodiments, the GJB2 regulatory construct has the sequence of SEQ ID NO: 1. In some embodiments, the GJB2 regulatory construct has at least 85% sequence identity with SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity). In some embodiments, the GJB2 regulatory construct has the sequence of SEQ ID NO: 2.

[0118] The aforementioned nucleic acid sequences are provided in Table 2 below.

[0119] Table 2. GJB2 regulatory construct sequences

[0120]

[0121]

[0122] The aforementioned GJB2 regulatory construct sequence may be contained in a nucleic acid vector and operatively linked to a polynucleotide encoding the Gjb2 protein. In some embodiments, the polynucleotide operatively linked to the GJB2 regulatory construct described herein (e.g., a polynucleotide having at least 85% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity)) is a transgenic form encoding the wild-type form of the Gjb2 protein (e.g., wild-type human Gjb2 protein). In some embodiments, the polynucleotide operatively linked to the GJB2 regulatory construct described herein is a polynucleotide encoding wild-type human Gjb2 (e.g., a polynucleotide encoding the amino acid sequence of SEQ ID NO: 29). In some embodiments, the polynucleotide sequence encoding wild-type human Gjb2 is modified relative to the wild-type GJB2 sequence (SEQ ID NO: 5). In some embodiments, the polynucleotide sequence encoding wild-type human Gjb2 is CpG depleted. An exemplary CpG-depleted polynucleotide sequence encoding wild-type human Gjb2 is the sequence of SEQ ID NO: 3. In some embodiments, the CpG-depleted polynucleotide encoding wild-type human Gjb2 has at least 90% sequence identity with the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and contains fewer CG dinucleotides than the wild-type GJB2 nucleic acid sequence. In some embodiments, the CpG-depleted polynucleotide has at least 90% sequence identity with the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and contains at least 50% less CG dinucleotides than wild-type GJB2 (i.e., compared to SEQ ID NO: 5) (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides). In some embodiments, the CpG-depleted polynucleotide encoding wild-type human Gjb2 has at least 90% sequence identity with the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and does not contain CG dinucleotides. In some embodiments, the polynucleotide sequence encoding wild-type human Gjb2 is codon-optimized. An exemplary codon-optimized polynucleotide sequence encoding wild-type human Gjb2 is the sequence of SEQ ID NO: 28.In some embodiments, the polynucleotide sequence encoding wild-type human Gjb2 is CpG depleted and codon-optimized. An exemplary CpG-depleted and codon-optimized polynucleotide sequence encoding wild-type human Gjb2 is the sequence of SEQ ID NO: 4. In some embodiments, the polynucleotide encoding wild-type human Gjb2 has at least 90% sequence identity with the sequence of SEQ ID NO: 4 or SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity). In some embodiments, the polynucleotide encoding wild-type human Gjb2, having at least 90% sequence identity with the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), and containing at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides), or having at least 90% sequence identity with the sequence of SEQ ID NO: 4 or SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), encodes the sequence of SEQ ID NO: 29 (e.g., due to redundancy of the genetic code). Exemplary Gjb2 amino acid and polynucleotide sequences are listed in Table 3 below. Nucleic acid vectors (e.g., AAV vectors) containing a GJB2 regulatory construct described herein, operably linked to a polynucleotide encoding wild-type human Gjb2 (e.g., a polynucleotide encoding SEQ ID NO: 29, such as any one of SEQ ID NO: 3, 4, and 28), can be administered to subjects to treat, reduce, or prevent GJB2-related hearing loss, such as hearing loss in subjects with DFNB1, DFNA3, Bart-Pomfley syndrome, hystrix-like ichthyosis with deafness, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with deafness, or Warwinkel syndrome.

[0123] Table 3. Gjb2 sequences

[0124]

[0125]

[0126] This disclosure also provides polynucleotides containing codon-optimized and / or CpG-depleted sequences encoding wild-type human Gjb2 as shown in Table 3 above (e.g., sequences of SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 28) and variants thereof, such as sequences having at least 90% sequence identity with the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) and containing at least 50% less CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or less CG dinucleotides), and sequences with SEQ ID NO: 4 or SEQ ID NO: 28. The sequence 28 has at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity). Codon-optimized and / or CpG-depleted sequences encoding wild-type human Gjb2 or variants thereof can be operatively linked to the GJB2 promoter. GJB2 promoters operatively linked to the codon-optimized and / or CpG-depleted sequences encoding wild-type human Gjb2 or variants thereof described herein include those described in U.S. Publication No. US20210095313A1, International Publications Nos. WO2021231808A2 and WO2022056444A1, and International Application PCT / US2023 / 061953, which are incorporated herein by reference because they involve GJB2 promoter sequences. The polynucleotides described herein containing a GJB2 promoter operatively linked to a codon-optimized and / or CpG-depleted sequence encoding wild-type human Gjb2 (e.g., SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 28) or a variant thereof can be incorporated into a nucleic acid vector (e.g., an AAV vector) and administered to subjects to treat, reduce, or prevent GJB2-related hearing loss, such as hearing loss in subjects with DFNB1, DFNA3, Bart-Pomfley syndrome, hystrix-like ichthyosis with deafness, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with deafness, or Warwinkel syndrome.

[0127] Gjb2 expression in mammalian cells

[0128] Mutations in GJB2 have been linked to sensorineural hearing loss. The compositions and methods described herein can be used to induce or increase the expression of a polynucleotide encoding Gjb2 (e.g., wild-type human Gjb2) in GJB2-expressing cells (e.g., inner ear cells expressing GJB2, such as cochlear support cells) by administration of a nucleic acid vector containing the GJB2 regulatory construct described herein (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) with the sequence of SEQ ID NO: 1 or SEQ ID NO: 2), the GJB2 regulatory construct being operatively linked to a polynucleotide sequence encoding the Gjb2 protein ... sequence having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) with the sequence of SEQ ID NO: 1 or SEQ ID NO: 2), the GJB2 regulatory construct being operatively linked to a polynucleotide sequence encoding the Gjb2 protein (e. The sequence of SEQ ID NO: 3 has at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and contains at least 50% less CG dinucleotides (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides) than wild-type GJB2, or a polynucleotide with at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) with the sequence of SEQ ID NO: 4 or SEQ ID NO: 28. Various methods have been established for protein delivery to mammalian cells and for the stable expression of polynucleotides encoding proteins in mammalian cells.

[0129] The polynucleotide encoding Gjb2

[0130] One platform for achieving therapeutically effective intracellular Gjb2 concentrations in mammalian cells is the stable expression of a gene encoding Gjb2 (e.g., through integration into the nuclear or mitochondrial genome of mammalian cells, or through the formation of an appendage tandem in the nucleus of mammalian cells). This gene is a polynucleotide encoding the primary amino acid sequence of the corresponding protein. To introduce a foreign gene into mammalian cells, the gene can be incorporated into a vector. Vectors can be introduced into cells using various methods, including transformation, transfection, transduction, direct uptake, projectile bombardment, and encapsulation of the vector in liposomes. Examples of suitable methods for transfecting or transforming cells include calcium phosphate precipitation, electroporation, microinjection, infection, lipid transfection, and direct uptake. Such methods are described in more detail in, for example, Green et al., Molecular Cloning: A Laboratory Manual, 4th edition (ColdSpring Harbor University Press, New York 2014); and Ausubel et al., Current Protocols in Molecular Biology (John Wiley & Sons, New York 2015), the contents of which are incorporated herein by reference.

[0131] Gjb2 can also be introduced into mammalian cells by targeting cell membrane phospholipids with a vector containing the gene encoding Gjb2. For example, the vector can be targeted to phospholipids on the extracellular surface of the cell membrane by linking the vector molecule to the VSV-G protein (a viral protein with affinity for all cell membrane phospholipids). Such constructs can be generated using methods well known to those skilled in the art.

[0132] The recognition and binding of a polynucleotide encoding Gjb2 by mammalian RNA polymerase is important for gene expression. Therefore, sequence elements exhibiting high affinity for transcription factors that recruit RNA polymerase and promote the assembly of the transcription complex at the transcription initiation site can be included within the polynucleotide. Such sequence elements include, for example, mammalian promoters whose sequences are recognized and bound by specific transcription initiation factors and ultimately by RNA polymerase. Examples of mammalian promoters have been described in Smith et al., Mol. Sys. Biol., 3:73, published online, the disclosure of which is incorporated herein by reference. The promoters used in the methods and compositions described herein are GJB2 promoters (e.g., polynucleotides having at least 85% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) contained in the GJB2 regulatory construct described herein.

[0133] Once the polynucleotide encoding Gjb2 is incorporated into mammalian cells or stabilized in a free monomer or tandem, transcription of that polynucleotide can be induced by methods known in the art. For example, expression can be induced by exposing mammalian cells to external chemical agents, such as those that regulate the binding of transcription factors and / or RNA polymerases to mammalian promoters and thereby regulate gene expression. Chemical agents can be used to promote the binding of RNA polymerases and / or transcription factors to mammalian promoters, for example, by removing repressor proteins that have already bound the promoter. Alternatively, chemical agents can be used to enhance the affinity of mammalian promoters for RNA polymerases and / or transcription factors, thereby increasing the transcription rate of genes downstream of the promoter in the presence of the chemical agent. Examples of chemical agents that enhance polynucleotide transcription through the above mechanisms include tetracycline and doxycycline. These agents are commercially available and can be administered to mammalian cells according to established protocols to promote gene expression.

[0134] Other DNA sequence elements that may be included in the nucleic acid vector used in the compositions and methods described herein include enhancer sequences. Enhancers represent another class of regulatory elements that induce conformational changes in polynucleotides containing the gene of interest, causing the DNA to adopt a three-dimensional orientation that facilitates the binding of transcription factors and RNA polymerases at the transcription start site. Therefore, the polynucleotides used in the compositions and methods described herein include those encoding the Gjb2 protein, and additionally include mammalian enhancer sequences. Many enhancer sequences from mammalian genes are now known, and examples include enhancers from genes encoding mammalian globin, elastase, albumin, alpha-fetoprotein, and insulin. Enhancers used in the compositions and methods described herein also include those derived from the genetic material of viruses capable of infecting eukaryotic cells. Examples include the SV40 enhancer post-OMI, the cytomegalovirus early promoter enhancer, the polyoma enhancer post-OMI, and the adenovirus enhancer. Other enhancer sequences that induce activation of eukaryotic gene transcription include the CMV enhancer and the RSV enhancer. The GJB2 regulatory construct described herein (e.g., a polynucleotide having at least 85% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity)) comprises one or more GJB2 enhancer sequences. The enhancer can be spliced ​​into a vector containing a polynucleotide encoding the Gjb2 protein, for example, at the 5' or 3' position of the gene. In a preferred orientation, the enhancer is located 5' to the promoter, and subsequently at the 5' position relative to the polynucleotide encoding the Gjb2 protein.

[0135] Nucleic acid vectors containing a GJB2 regulatory construct operatively linked to a polynucleotide encoding the Gjb2 protein described herein can contain a marmot posttranscriptional regulatory element (WPRE). WPREs function at the mRNA level by promoting nuclear export of transcripts and / or by increasing the polyadenylation efficiency of nascent transcripts, thereby increasing the total amount of mRNA in cells. Adding WPREs to vectors leads to significant improvements in transgene expression levels induced by several different promoters in vitro and in vivo.

[0136] The nucleic acid vectors described herein also contain a polyadenylation (polyA) signal sequence. A polyA signal sequence is a sequence that triggers endonuclease cleavage of mRNA and the addition of a series of adenosines to the 3' end of the cleaved mRNA. PolyA signal sequences that may be included in the nucleic acid vectors described herein include polyA signal sequences derived from bovine growth hormone (bGH) mouse β-globin, mouse α-globin, human collagen, polyomavirus, herpes simplex virus thymidine kinase gene, human growth hormone (hGH), SV40, synthetic polyA, HIV-1 upstream polyA enhancer, adenovirus (L3) upstream polyA enhancer, hTHGB upstream polyA enhancer, and hC2 upstream polyA enhancer. In some embodiments, the nucleic acid vector contains a bGH polyA signal sequence having the following sequence:

[0137] CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGA (SEQ ID NO: 6).

[0138] In some implementations, the nucleic acid vector contains a bGH polyA signal sequence that has at least 90% sequence identity with the sequence of SEQ ID NO: 6 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0139] In some implementations, the nucleic acid vector contains an SV40 polyA signal sequence having the following sequence:

[0140] GATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCAAAACTAGAATGCAGTGAAAAAAATGCCTTATTTGTGAAATTTGTGATCTATTGCCTTATTTGTAACCATTATAAGCTGCAATAAACAAGTT (SEQ ID NO: 7).

[0141] In some implementations, the nucleic acid vector contains an SV40 polyA signal sequence that has at least 90% sequence identity with the sequence of SEQ ID NO: 7 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0142] In some embodiments, a nucleic acid vector containing a GJB2 regulatory construct operatively linked to a polynucleotide encoding the Gjb2 protein described herein includes a reporter gene sequence that can be used to verify the expression of a gene operatively linked to the GJB2 regulatory construct, for example, in cells and tissues (e.g., in cells expressing GJB2, such as cochlear support cells). Reporter gene sequences that may be provided in the transgene include DNA sequences encoding β-lactamases, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and other substances well known in the art. When associated with a regulatory element driving its expression, such as the GJB2 regulatory construct, the reporter gene sequence provides a signal detectable by conventional means, including enzymatic, radiographic, colorimetric, fluorescence or other spectroscopic assays, fluorescence-activated cell sorting assays, and immunological assays, including enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and immunohistochemistry. For example, when the marker sequence is the LacZ gene, the presence of the signal-carrying vector can be detected by measuring β-galactosidase activity. When the transgene is green fluorescent protein or luciferase, the signal-carrying vector can be visually identified by color or light generation in a photometer.

[0143] In some embodiments, the nucleic acid vector described herein is an AAV transfer plasmid. Such plasmids contain a 5' end of the promoter (i.e., the 5' end of the GJB2 regulatory construct described herein) and a 3' inverted terminal repeat (ITR) of the polyA signal sequence. The DNA sequence between the ITRs is packaged into the AAV molecule, while the sequence outside the ITR is not. In some embodiments, the sequence located at the 5' end of the GJB2 regulatory construct described herein in the AAV transfer plasmid is the following sequence:

[0144] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTTGTAGTTAATGATTAACCCGCCATGCTACTTATCTACGTAGCCATGCTCTAGGAAGATCGGAATTCTGGTACCTTGCTAGC (SEQ ID NO: 8).

[0145] In other embodiments, the sequence located at the 5' of the GJB2 regulatory construct described herein in the AAV transfer plasmid is the following sequence:

[0146] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGAGCAGAATTCTGGTACCTTGCTAGC (SEQ ID NO: 10).

[0147] In both SEQ ID NO: 8 and SEQ ID NO: 10 shown above, nucleotides 1-130 correspond to 5'ITR.

[0148] In some implementations, the sequence located at the 3' of the polyA signal sequence in the AAV transfer plasmid is the following sequence:

[0149] TCTAGAACTGAATTCCCGATAAGGATCTTCCTAGAGCATGGCTACGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACAAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG (SEQ ID NO: 9).

[0150] In SEQ ID NO: 9 as shown above, nucleotides 83-212 correspond to the 3' ITR. In other embodiments, the sequence at the 3' of the polyA signal sequence in the AAV transfer plasmid is the following sequence:

[0151] TCTAGAACTGAATTCACAAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG (SEQ ID NO: 11)。

[0152] In SEQ ID NO: 11 as shown above, nucleotides 19-148 correspond to the 3' ITR. In some embodiments, the AAV transfer plasmid contains the 5' sequence of SEQ ID NO: 8 and the 3' sequence of SEQ ID NO: 9. In some embodiments, the AAV transfer plasmid contains a 5' sequence having at least 90% sequence identity with the sequence of SEQ ID NO: 8 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and a 3' sequence having at least 90% sequence identity with the sequence of SEQ ID NO: 9 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), provided that the ITR sequence in the 5' sequence has the sequence of nucleotides 1-130 of SEQ ID NO: 8, and the ITR sequence in the 3' sequence has the sequence of nucleotides 83-212 of SEQ ID NO: 9. In some embodiments, the AAV transfer plasmid contains a 5' sequence having at least 90% sequence identity with the sequence of SEQ ID NO: 8 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and a 3' sequence having at least 90% sequence identity with the sequence of SEQ ID NO: 9 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), provided that the ITR sequence in the 3' sequence is the inverse complementary sequence of the ITR sequence in the 5' sequence. In some embodiments, the AAV transfer plasmid contains the 5' sequence of SEQ ID NO: 10 and the 3' sequence of SEQ ID NO: 11. In some embodiments, the AAV transfer plasmid contains a 5' sequence having at least 90% sequence identity with the sequence of SEQ ID NO: 10 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and a 3' sequence having at least 90% sequence identity with the sequence of SEQ ID NO: 11 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), provided that the ITR sequence in the 5' sequence has the sequence of nucleotides 1-130 of SEQ ID NO: 10, and the ITR sequence in the 3' sequence has the sequence of nucleotides 19-148 of SEQ ID NO: 11.In some embodiments, the AAV transfer plasmid contains a 5' sequence having at least 90% sequence identity with the sequence of SEQ ID NO: 10 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and a 3' sequence having at least 90% sequence identity with the sequence of SEQ ID NO: 11 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), provided that the ITR sequence in the 3' is the reverse complementary sequence of the ITR sequence in the 5' sequence.

[0153] In some embodiments, the 5' flanking inverted terminal repeat sequence has a sequence corresponding to nucleotides 1-130 of SEQ ID NO: 8 or SEQ ID NO: 10, or a sequence having at least 90% sequence identity with that sequence (at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity); and the 3' flanking inverted terminal repeat sequence has a sequence corresponding to nucleotides 83-212 of SEQ ID NO: 9 or nucleotides 19-148 of SEQ ID NO: 11, or a sequence having at least 90% sequence identity with that sequence (at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity). Those skilled in the art will understand that for any given pair of inverted terminal repeat sequences in a transfer plasmid used to generate a viral vector (typically by transfecting cells with this plasmid along with other plasmids carrying the essential AAV gene for viral vector formation), the corresponding sequence in the viral vector may change due to the "outward" or "inward" orientation of the ITR during recombination. Therefore, the ITR sequence in the transfer plasmid is not necessarily the same as the sequence found in the viral vector from which it is prepared.

[0154] The GJB2 regulatory construct described herein (e.g., a polynucleotide having at least 85% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity)) may be associated with a polynucleotide sequence encoding the wild-type Gjb2 protein described herein (e.g., having at least 90% sequence identity with the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and containing at least 50% less CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides) or associated with SEQ ID NO: 4 or SEQ ID NO: 2. The sequence 28 has at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) of a polynucleotide, which can be operatively linked to the polyA signal sequence described herein (e.g., a polynucleotide with at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) of SEQ ID NO: 6 or SEQ ID NO: 7) and can be incorporated into a transfer plasmid that can be used to generate a nucleic acid vector (e.g., an AAV vector) for use in the compositions and methods described herein. In the transfer plasmid, the flanking sequences of the GJB2 regulatory sequence and the polyA signal sequence can be the 5' and 3' ITR-containing sequences described herein. Combinations of these elements that can be incorporated into such transfer plasmids are provided in Table 4 below, where each row represents a combination of elements for a single transfer plasmid.

[0155] Table 4. Sequence combinations of transfer plasmids used to generate AAV vectors

[0156]

[0157] Table 5 provides transfer plasmid sequences that can be used to generate nucleic acid vectors (e.g., AAV vectors) for use in the compositions and methods described herein. Transfer plasmids (e.g., plasmids containing DNA sequences to be delivered via nucleic acid vectors (e.g., via AAV vectors) can be co-delivered into production cells with helper plasmids (e.g., plasmids providing proteins required for AAV preparation) and rep / cap plasmids (e.g., plasmids providing AAV capsid proteins and proteins for inserting the transfer plasmid DNA sequence into the capsid shell) to generate nucleic acid vectors (e.g., AAV vectors) for application. The following transfer plasmids are designed to generate nucleic acid vectors (e.g., AAV vectors) containing a GJB2 regulatory construct (e.g., a polynucleotide having the sequence of SEQ ID NO: 1 or SEQ ID NO: 2) operatively linked to a polynucleotide encoding a Gjb2 protein (e.g., a polynucleotide encoding a polynucleotide of SEQ ID NO: 3 or SEQ ID NO: 4). Sequences spanning from 5' ITR to 3' ITR (including the intermediate GJB2 regulatory construct, GJB2 coding sequence, and polyA signal sequence) are packaged into AAV vectors.

[0158] Table 5. Transfer plasmids used to generate AAV vectors

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179]

[0180]

[0181]

[0182]

[0183]

[0184]

[0185]

[0186]

[0187]

[0188]

[0189]

[0190]

[0191]

[0192]

[0193]

[0194]

[0195]

[0196]

[0197]

[0198]

[0199]

[0200]

[0201]

[0202]

[0203]

[0204]

[0205]

[0206] Methods for delivering polynucleotides encoding Gjb2 to target cells

[0207] Techniques for introducing polynucleotides encoding Gjb2 (e.g., wild-type human Gjb2) operatively linked to the GJB2 regulatory construct described herein (e.g., polynucleotides having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) with SEQ ID NO: 1 or SEQ ID NO: 2) into target cells (e.g., mammalian cells) are well known in the art. For example, electroporation can be used to permeate mammalian cells (e.g., human target cells) by applying an electrostatic potential to the cells of interest. Mammalian cells (such as human cells) subjected to an external electric field in this manner are then readily able to take up exogenous polynucleotides. Electroporation of mammalian cells is described in detail, for example, in Chu et al., Nucleic Acids Research 15:1311 (1987), the contents of which are incorporated herein by reference. The similar technique Nucleofection™ utilizes an applied electric field to stimulate the uptake of exogenous polynucleotides into the nucleus of eukaryotic cells. Nucleofection™ and the protocols that can be used to perform this technique are described in detail in, for example, Distler et al., Experimental Dermatology 14:315 (2005) and US 2010 / 0317114, the contents of which are incorporated herein by reference.

[0208] Other techniques that can be used to transfect target cells include squeeze-perforation. This technique induces rapid mechanical deformation of cells to stimulate the uptake of exogenous DNA through membrane pores formed in response to applied stress. An advantage of this technique is that a vector is not required for the delivery of polynucleotides into cells such as human target cells. Squeeze-perforation is described in detail, for example, in Sharei et al., Journal of Visualized Experiments 81:e50980 (2013), the contents of which are incorporated herein by reference.

[0209] Lipid transfection represents another technique that can be used to transfect target cells. This method involves loading polynucleotides into liposomes, which typically have cationic functional groups (e.g., quaternary ammonium or protonated amines) facing outwards. This promotes electrostatic interactions between the liposomes and the cell due to the anionic nature of the cell membrane, ultimately leading to the uptake of exogenous polynucleotides, such as through direct fusion of the liposomes with the cell membrane or through endocytosis of the complex. Lipid transfection is described in detail in, for example, U.S. Patent No. 7,442,386, the disclosure of which is incorporated herein by reference. Similar techniques that utilize ionic interactions with the cell membrane to induce the uptake of exogenous polynucleotides include contacting cells with cationic polymer-polynucleotide complexes. Exemplary cationic molecules that associate with polynucleotides to impart a positive charge that facilitates interaction with the cell membrane include activated dendrimers (described, for example, in Dennig, Topics in Current Chemistry 228:227 (2003), the disclosure of which is incorporated herein by reference), polyethyleneimine, and diethylaminoethyl (DEAE)-glucan, the use of which as transfection agents is described in detail, for example, in Gulick et al., Current Protocols in Molecular Biology 40:I:9.2:9.2.1 (1997), the disclosure of which is incorporated herein by reference. Magnetic beads are another tool that can be used to transfect target cells in a gentle and efficient manner because this method utilizes an applied magnetic field to guide the uptake of polynucleotides. This technique is described in detail, for example, in US 2010 / 0227406, the disclosure of which is incorporated herein by reference.

[0210] Another available tool for inducing the uptake of exogenous polynucleotides by target cells is laser transfection, also known as optical transfection, a technique that involves exposing cells to electromagnetic radiation of a specific wavelength to gently permeate the cells and allow polynucleotides to cross the cell membrane. This technique has similar bioactivity to, and in some cases has been found to be superior to, electroporation.

[0211] Impalefection is another technique that can be used to deliver genetic material to target cells. It relies on the use of nanomaterials such as carbon nanofibers, carbon nanotubes, and nanowires. Needle-like nanostructures are synthesized perpendicular to the substrate surface. DNA containing genes intended for intracellular delivery is attached to the surface of the nanostructure. A chip with an array of these needles is then pressed onto a cell or tissue. Cells pierced by the nanostructure can express one or more delivered genes. An example of this technique is described in Shalek et al., PNAS 107: 1870 (2010), the disclosure of which is incorporated herein by reference.

[0212] Magnetic transfection can also be used to deliver polynucleotides to target cells. The principle of magnetic transfection is to associate polynucleotides with cationic magnetic nanoparticles. These magnetic nanoparticles are made of fully biodegradable iron oxide and coated with specific cationic proprietary molecules, varying depending on the application. Their association with gene vectors (DNA, siRNA, viral vectors, etc.) is achieved through salt-induced colloidal aggregation and electrostatic interactions. The magnetic particles are then focused onto the target cells by an external magnetic field generated by a magnet. This technique is described in detail in Scherer et al., Gene Therapy 9:102 (2002), the contents of which are incorporated herein by reference.

[0213] Another available tool for inducing the uptake of exogenous polynucleotides by target cells is sonoporosis, a technique that involves using sound (typically ultrasound frequencies) to alter the permeability of the cell membrane, thereby permeating the cell and allowing polynucleotides to pass through the cell membrane. This technique is described in detail, for example, in Rhodes et al., Methods in Cell Biology 82:309 (2007), the contents of which are incorporated herein by reference.

[0214] Microvesicles represent another potential medium for modifying the genome of target cells according to the methods described herein. For example, proteins can be efficiently delivered into cells using microvesicles induced by co-overexpression of the glycoprotein VSV-G with, for example, genome-modifying proteins such as nucleases, which subsequently catalyze site-specific cleavage of endogenous polynucleotide sequences to prepare a cellular genome for covalent incorporation of polynucleotides of interest, such as genes or regulatory sequences. The use of such vesicles (also known as nanovesicles) in the genetic modification of eukaryotic cells is described in detail, for example, Quinn et al., Genetic Modification of Target Cells by Direct Delivery of Active Protein [Abstract], Methylation changes in early embryonic genes in cancer [Abstract], Proceedings of the 18th Annual Meeting of the American Society of Gene and Cell Therapy; May 13, 2015, Abstract 122.

[0215] Vectors for expressing GJB2

[0216] In addition to achieving high transcription and translation rates, stable expression of exogenous polynucleotides in mammalian cells can also be achieved by integrating the polynucleotide into the nuclear genome of mammalian cells. Various vectors have been developed for delivering and integrating polynucleotides encoding exogenous proteins into the nuclear DNA of mammalian cells. Examples of expression vectors are described, for example, in Gellissen, Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems (John Wiley & Sons, Marblehead, MA, 2006). The expression vector used in the compositions and methods described herein contains the GJB2 regulatory construct described herein (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) with the sequence of SEQ ID NO: 1 or SEQ ID NO: 2), the GJB2 regulatory construct being operatively linked to a polynucleotide encoding a Gjb2 protein (e.g., wild-type human Gjb2, such as that with SEQ ID NO: 2). The sequence of SEQ ID NO: 3 has at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and contains at least 50% less CG dinucleotides (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides) than wild-type GJB2, or polynucleotides with at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) with the sequence of SEQ ID NO: 4 or SEQ ID NO: 28, and the expression vector also contains additional sequence elements, for example, for expressing these agents and / or integrating these polynucleotide sequences into the genome of mammalian cells. Vectors containing GJB2 regulatory constructs operatively linked to polynucleotides encoding Gjb2 include plasmids (e.g., circular DNA molecules capable of autonomous intracellular replication), viscera (e.g., pWE or sCos vectors), artificial chromosomes (e.g., human artificial chromosomes (HAC), yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC)), and viral vectors. Certain vectors that can be used to express polynucleotides encoding the Gjb2 protein include plasmids containing regulatory sequences (such as enhancer regions) that direct gene transcription.Other available vectors for expressing polynucleotides encoding the Gjb2 protein contain polynucleotide sequences that enhance the translation rate of these genes or improve the stability of mRNA transcribed from the genes or nuclear export. These sequence elements include, for example, 5' and 3' untranslated regions and polyadenylation signal sites to guide efficient transcription of the gene carried on the expression vector. Expression vectors suitable for use with the compositions and methods described herein may also contain polynucleotides encoding markers for selecting cells containing such vectors. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or norsinotherapy.

[0217] Viral vectors for polynucleotide delivery

[0218] Viral genomes provide a rich source of vectors for the efficient delivery of genes of interest into the genomes of target cells, such as mammalian cells, like human cells. Viral genomes are particularly useful for gene delivery because the polynucleotides contained within such genomes are typically incorporated into the nuclear genome of mammalian cells via generalized or specialized transduction. These processes occur as part of the natural viral replication cycle and do not require the addition of proteins or reagents to induce gene integration. Examples of viral vectors include retroviruses (e.g., retroviridae viral vectors), adenoviruses (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48), parvoviruses (e.g., adeno-associated virus), coronaviruses, negative-strand RNA viruses such as orthomyxoviruses (e.g., influenza virus), rod-shaped viruses (e.g., rabies virus and vesicular stomatitis virus), paramyxoviruses (e.g., measles virus and Sendai virus), positive-strand RNA viruses (e.g., parvovirus and alphavirus), and double-stranded DNA viruses, including adenoviruses, herpesviruses (e.g., herpes simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxviruses (e.g., cowpox, modified vaccinia Ankara (MVA), fowlpox, and canarypox). Other viruses include, for example, Norwalk virus, enveloped virus, flavivirus, reovirus, multivaccinia virus, hepatotropic DNA virus, human papillomavirus, human foamy virus, and hepatitis virus. Examples of retroviruses include avian leukosis-sarcoma, avian type C virus, mammalian type C, type B, and type D viruses, oncogenic retroviruses, HTLV-BLV group, lentiviruses, alpha retroviruses, gamma retroviruses, and foam viruses (Coffin, JM, Retroviridae: The viruses and their replication, Virology, 3rd edition (Lippincott-Raven, Philadelphia, 1996)). Other examples include murine leukosis virus, murine sarcoma virus, mouse mammary tumor virus, bovine leukosis virus, feline leukosis virus, feline sarcoma virus, avian leukosis virus, human T-cell leukosis virus, baboon endogenous virus, gibbon leukosis virus, Mason-Pfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus, and lentiviruses. Other examples of vectors are described, for example, in U.S. Patent No. 5,801,030, the disclosure of which relates to viral vectors for use in gene therapy is incorporated herein by reference.

[0219] AAV vector for polynucleotide delivery

[0220] In some embodiments, the polynucleotides of the compositions and methods described herein are incorporated into the rAAV vector and / or virion to facilitate their introduction into cells. In some embodiments, the rAAV vector that can be used with the compositions and methods described herein is a recombinant polynucleotide construct comprising (1) the GJB2 regulatory construct described herein (e.g., a polynucleotide having at least 85% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity)), and (2) the sequence to be expressed (e.g., a polynucleotide encoding Gjb2, such as that with SEQ ID NO: 1 or SEQ ID NO: 2). The sequence of SEQ ID NO: 3 has at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and contains at least 50% less CG dinucleotides (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides) than wild-type GJB2, or a polynucleotide having at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) with the sequence of SEQ ID NO: 4 or SEQ ID NO: 28, and (3) a viral sequence that facilitates the integration and expression of the sequence to be expressed. The viral sequence may include those sequences of AAV required for cis-replication and packaging (e.g., functional ITR) of DNA into the virion. Such rAAV vectors may also contain a marker gene or a reporter gene. Available rAAV vectors contain one or more AAVWT genes that are wholly or partially deleted but still retain functional flanking ITR sequences. AAV ITRs can have any serotype suitable for a particular application. For use in the methods and compositions described herein, the ITR can be an AAV2 ITR. Methods using rAAV vectors are described, for example, in Tal et al., J. Biomed. Sci. 7:279 (2000) and Monahan and Samulski, Gene Delivery 7:24 (2000), the disclosures of which pertain to AAV vectors for gene delivery are incorporated herein by reference.

[0221] The polynucleotides and vectors described herein (e.g., the GJB2 regulatory construct operatively linked to a polynucleotide encoding Gjb2) can be incorporated into rAAV virions to facilitate the introduction of the polynucleotides or vectors into cells. The capsid proteins of AAV constitute the outer non-nucleic acid portion of the virion and are encoded by the AAV cap gene. The cap gene encodes three viral capsid proteins, VP1, VP2, and VP3, required for virion assembly. The construction of rAAV virions has been described, for example, in US 5,173,414; US 5,139,941; US ​​5,863,541; US ​​5,869,305; US 6,057,152; and US 6,376,237; as well as Rabinowitz et al., J. Virol. 76:791 (2002) and Bowles et al., J. Virol. 77:423 (2003), the contents of which, in each of these publications, pertain to AAV vectors used for gene delivery, are incorporated herein by reference.

[0222] The rAAV virions used in conjunction with the compositions and methods described herein include virions derived from a variety of AAV serotypes, including AAV 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, and PHP.S. For cells targeting GJB2 expression, AAV1, AAV2, AAV2quad(YF), AAV6, AAV8, AAV9, Anc80, Anc80L65, AAV-DJ, AAV-DJ / 9, 7m8, and PHP.B may be particularly useful. Serotypes evolved for retinal transduction can also be used in the methods and compositions described herein. The construction and use of AAV vectors and AAV proteins for different serotypes are described in, for example, Chao et al., Mol. Ther. 2:619 (2000); Davidson et al., Proc. Natl. Acad. Sci. USA 97:3428 (2000); Xiao et al., J. Virol. 72:2224 (1998); Halbert et al., J. Virol. 74:1524 (2000); Halbert et al., J. Virol. 75:6615 (2001); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001), the contents of each of which are incorporated herein by reference as they relate to AAV vectors for gene delivery.

[0223] Also used in conjunction with the compositions and methods described herein are pseudotyped rAAV vectors. Pseudotyped vectors comprise AAV vectors of a given serotype (e.g., AAV9) that have been pseudotyped from capsid genes derived from serotypes other than the given serotype (e.g., AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc.). Techniques relating to the construction and use of pseudotyped rAAV virions are known in the art and described, for example, in Duan et al., J. Virol. 75:7662 (2001); Halbert et al., J. Virol. 74:1524 (2000); Zolotukhin et al., Methods, 28:158 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001).

[0224] AAV virions with mutations within the virospinal capsid can be used to infect specific cell types more effectively than non-mutated capsid virions. For example, suitable AAV mutants may have ligand insertion mutations to facilitate AAV targeting of specific cell types. The construction and characterization of AAV capsid mutants (including insertion mutants, alanine-selective mutants, and epitope-tagged mutants) are described in Wu et al., J. Virol. 74:8635 (2000). Other rAAV viral particles that can be used in the methods described herein include those capsid heterozygotes generated by molecular breeding of the virus and by exon shuffling. See, for example, Soong et al., Nat. Genet., 25:436 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19:423 (2001).

[0225] Pharmaceutical Composition

[0226] The nucleic acid vector described herein (e.g., a vector containing a GJB2 regulatory construct described herein (e.g., a vector having at least 85% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2, e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity)) can be incorporated into a medium for administration to patients, such as human patients with sensorineural hearing loss (e.g., GJB2-related hearing loss), wherein the nucleic acid vector is operatively linked to a polynucleotide encoding Gjb2 (e.g., wild-type human Gjb2, such as that with SEQ ID NO: 1 or SEQ ID NO: 2). The sequence of SEQ ID NO: 3 has at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and contains a polynucleotide with at least 50% less CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides), or a polynucleotide with at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) with the sequence of SEQ ID NO: 4 or SEQ ID NO: 28. Pharmaceutical compositions containing a vector (such as a viral vector) operably linked to a polynucleotide encoding Gjb2, as described herein, can be prepared using methods known in the art. For example, such compositions can use, for example, physiologically acceptable loaders, excipients, or stabilizers (Remington: The Science and Practice of...). Pharmacology, 22nd edition, ed. Allen, L. (2013; incorporated herein by reference) and prepared in the desired form (e.g., as a lyophilized formulation or an aqueous solution).

[0227] Mixtures of nucleic acid vectors (e.g., viral vectors) containing a GJB2 regulatory construct operatively linked to a polynucleotide encoding Gjb2 as described herein can be prepared in water with one or more excipients, carriers, or diluents as appropriate. Dispersions can also be prepared in glycerol, liquid polyethylene glycol, mixtures thereof, and in oils. Under normal storage and use conditions, these formulations may contain preservatives to prevent microbial growth. Suitable forms for injection include sterile aqueous solutions or dispersions and sterile powders for the ad hoc preparation of sterile injectable solutions or dispersions (described in US 5,466,468, the disclosure of which is incorporated herein by reference). In either case, the formulation may be sterile and may be fluid to the extent that it is readily injectable. The formulation may be stable under manufacturing and storage conditions and may be preserved under conditions preventing contamination by microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and / or vegetable oils. For example, by using coatings such as lecithin, by maintaining the desired particle size in the case of a dispersion, and by using surfactants to maintain appropriate flowability. Microbial action can be prevented by a variety of antibacterial and antifungal agents (e.g., parabens, chlorobutanol, phenols, sorbic acid, thimerosal, etc.). In many cases, isotonic agents, such as sugars or sodium chloride, will be preferred. Prolonged absorption of the injectable composition can be achieved by using agents that delay absorption, such as aluminum monostearate and gelatin, in the composition.

[0228] For example, if necessary, the solution containing the pharmaceutical composition described herein may be appropriately buffered, and the liquid diluent may first be made isotonic with sufficient saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this regard, sterile aqueous media that may be used will be known to those skilled in the art based on this disclosure. For example, a dose may be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous infusion fluid or injected at the recommended infusion site. Depending on the condition of the subject being treated, certain dose variations will be necessary. For topical administration to the inner ear, the composition may be formulated to contain a synthetic perilymph. Exemplary synthetic perilymph comprises 20-200 mM NaCl, 1-5 mM KCl, 0.1-10 mM CaCl2, 1-10 mM glucose, and 2-50 mM HEPE, having a pH between about 6 and 9 and an osmotic pressure of about 300 mOsm / kg. In any event, the person responsible for administration will determine the appropriate dose for the individual subject. In addition, for human use, the formulation should meet the sterility, pyrogenicity, general safety, and purity standards required by the FDA Office of Biologics standards.

[0229] Treatment

[0230] The compositions described herein can be administered to subjects with sensorineural hearing loss (e.g., GJB2-related hearing loss) or at risk of developing sensorineural hearing loss via a variety of routes, such as local administration to the middle or inner ear (e.g., to the perilymph or endolymph, such as to the oval window, round window, or semicircular canals (e.g., the supine canal) or via the oval window, round window, or semicircular canals, or via intratympanic or intratympanic injection, e.g., to inner ear cells expressing GJB2), intravenous, parenteral, intradermal, transdermal, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, and oral administration. In any given case, the most appropriate route of administration will depend on the specific composition administered, the patient, the method of formulation, the method of administration (e.g., timing and route of administration), the patient's age, weight, sex, the severity of the disease being treated, the patient's diet, and the patient's excretion rate. The composition may be applied once or more (e.g., once a year, twice a year, three times a year, once every two months, once a month, or once every two weeks).

[0231] Subjects treated as described herein may be those with sensorineural hearing loss or at risk of developing sensorineural hearing loss. In some embodiments, the compositions described herein are used to treat GJB2-related hearing loss (e.g., DFNB1 or DFNA3, or hearing loss associated with Bart-Pomfley syndrome, hystrix-like ichthyosis with deafness, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with deafness, or Warwinkel syndrome). GJB2-related hearing loss, such as DFNB1 or DFNA3, can be treated by administering a nucleic acid vector containing a GJB2 regulatory construct described herein (e.g., a polynucleotide having at least 85% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity)), wherein the GJB2 regulatory construct is operatively linked to a polynucleotide encoding Gjb2 (e.g., a polynucleotide encoding wild-type human Gjb2, such as that with SEQ ID NO: 1 or SEQ ID NO: 2). The sequence of SEQ ID NO: 3 has at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and contains at least 50% less CG dinucleotides (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides) than wild-type GJB2, or a polynucleotide with at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) with the sequence of SEQ ID NO: 4 or SEQ ID NO: 28. Subjects may have or be identified as having mutations in GJB2 and / or GJB6 (e.g., mutations associated with GJB2-related hearing loss, such as mutations that disrupt GJB2 expression or Gjb2 function), and may have severe, moderate, or mild hearing loss at the start of treatment, or may be treated before the onset of symptoms (e.g., preventative treatment).

[0232] The methods described herein may include a step of screening subjects for one or more mutations in genes known to be associated with GJB2-related hearing loss (e.g., one or more mutations in GJB2 and / or GJB6) prior to treatment with or application of the compositions described herein. Subjects may be screened for gene mutations using standard methods known to those skilled in the art (e.g., genetic testing). The methods described herein may also include a step of assessing the subject's hearing prior to treatment with or application of the compositions described herein. Standard tests such as hearing tests, auditory brainstem response (ABR), electrocochleography (ECOG), and direct otoacoustic emissions (DPOAE) may be used to assess hearing. These tests may also be used to assess the subject's hearing after treatment with or application of the compositions described herein.

[0233] Treatment may include administration of a composition containing a nucleic acid carrier (e.g., an AAV carrier) at various unit doses, the nucleic acid carrier containing a GJB2 regulatory construct operatively linked to a polynucleotide encoding Gjb2 as described herein. Each unit dose will typically contain a predetermined amount of the therapeutic composition. The amount to be administered, as well as the specific route of administration and formulation, is within the skill of a person skilled in the clinical field. The unit dose need not be administered as a single injection, but may comprise continuous infusions over a set period of time. Administration may be performed using a syringe pump to control the infusion rate in order to minimize damage to the inner ear (e.g., the cochlea and / or vestibular system). When the nucleic acid vector is an AAV vector (e.g., AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, or PHP.S vector), the viral vector can, for example, be approximately 1 x 10^65. 9 One vector genome (VG) / mL to approximately 1 x 10⁻⁶ 16 VG / mL (e.g., 1 x 10⁻⁶) 9 VG / mL, 2 x 10 9 VG / mL, 3 x 10 9 VG / mL, 4 x 10 9 VG / mL, 5 x 10 9 VG / mL, 6 x 10 9 VG / mL, 7 x 10 9 VG / mL, 8 x 10 9 VG / mL, 9 x 10 9 VG / mL, 1 x 10 10VG / mL、2 x 10 10 VG / mL、3 x 10 10 VG / mL、4 x 10 10 VG / mL、5 x 10 10 VG / mL、6 x 10 10 VG / mL、7x 10 10 VG / mL、8 x 10 10 VG / mL、9 x 10 10 VG / mL、1 x 10 11 VG / mL、2 x 10 11 VG / mL、3 x 10 11 VG / mL、4 x 10 11 VG / mL、5 x 10 11 VG / mL、6 x 10 11 VG / mL、7 x 10 11 VG / mL、8 x 10 11 VG / mL、9 x10 11 VG / mL、1 x 10 12 VG / mL、2 x 10 12 VG / mL、3 x 10 12 VG / mL、4 x 10 12 VG / mL、5 x 10 12 VG / mL、6x 10 12 VG / mL、7 x 10 12 VG / mL、8 x 10 12 VG / mL、9 x 10 12 VG / mL、1 x 10 13 VG / mL、2 x 10 13 VG / mL、3 x 10 13 VG / mL、4 x 10 13 VG / mL、5 x 10 13 VG / mL、6 x 10 13 VG / mL、7 x 10 13 VG / mL、8 x10 13 VG / mL、9 x 10 13 VG / mL、1 x 10 14 VG / mL、2 x 10 14 VG / mL、3 x 10 14 VG / mL、4 x 10 14 VG / mL、5x 10 14VG / mL, 6 x 10 14 VG / mL, 7 x 10 14 VG / mL, 8 x 10 14 VG / mL, 9 x 10 14 VG / mL, 1 x 10 15 VG / mL, 2 x 10 15 VG / mL, 3 x 10 15 VG / mL, 4 x 10 15 VG / mL, 5 x 10 15 VG / mL, 6 x 10 15 VG / mL, 7 x 10 15 VG / mL, 8 x 10 15 VG / mL, 9 x 10 15 VG / mL, or 1 x 10 16 AAV carriers (VG / mL) are administered to patients in volumes from 1 µL to 200 µL (e.g., 1, 2, 3, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 µL). Approximately 1 x 10⁻⁶ AAV carriers can be used. 7 VG / ear approximately 2 x 10 15 VG / ear (e.g., 1 x 10) 7 VG / ear, 2 x 10 7 VG / ear, 3 x 10 7 VG / ear, 4 x 10 7 VG / ear, 5 x 10 7 VG / ear, 6 x 10 7 VG / Ear, 7 x 10 7 VG / Ear, 8 x 10 7 VG / Ear, 9x10 7 VG / ear, 1 x 10 8 VG / ear, 2 x 10 8 VG / ear, 3 x 10 8 VG / ear, 4 x 10 8 VG / Ear, 5 x 10 8 VG / ear, 6 x 10 8 VG / Ear, 7 x 10 8 VG / Ear, 8 x 10 8 VG / Ear, 9 x 108 VG / ear, 1 x 10 9 VG / ear, 2 x 10 9 VG / ear, 3 x 10 9 VG / ear, 4 x 10 9 VG / ear, 5 x 10 9 VG / Ear, 6 x 10 9 VG / Ear, 7 x 10 9 VG / Ear, 8 x 10 9 VG / Ear, 9 x 10 9 VG / ear, 1 x 10 10 VG / ear, 2 x 10 10 VG / ear, 3 x 10 10 VG / ear, 4 x 10 10 VG / ear, 5 x 10 10 VG / ear, 6 x 10 10 VG / Ear, 7 x 10 10 VG / Ear, 8 x 10 10 VG / Ear, 9 x 10 10 VG / ear, 1 x 10 11 VG / ear, 2 x 10 11 VG / Ear, 3 x 10 11 VG / ear, 4 x 10 11 VG / ear, 5 x 10 11 VG / ear, 6 x 10 11 VG / Ear, 7 x 10 11 VG / Ear Only, 8 x 10 11 VG / Ear, 9 x 10 11 VG / ear, 1 x 10 12 VG / ear, 2 x 10 12 VG / ear, 3 x 10 12 VG / Ear, 4 x 10 12 VG / ear, 5 x 10 12 VG / ear, 6 x 10 12 VG / Ear, 7 x 10 12 VG / Ear, 8 x 10 12 VG / One Ear, 9 x 10 12 VG / ear, 1 x 10 13 VG / ear, 2 x 10 13 VG / ear, 3 x 10 13 VG / ear, 4 x 10 13VG / Ear, 5 x 10 13 VG / ear, 6 x 10 13 VG / Ear, 7 x 10 13 VG / Ear, 8 x 10 13 VG / Ear, 9 x 10 13 VG / ear, 1 x 10 14 VG / ear, 2 x 10 14 VG / ear, 3 x 10 14 VG / ear, 4 x 10 14 VG / ear, 5 x 10 14 VG / Ear, 6 x 10 14 VG / Ear, 7 x 10 14 VG / Ear, 8 x 10 14 VG / Ear, 9 x 10 14 VG / ear, 1 x 10 15 VG / ear or 2 x 10 15 A dose of VG (per ear) was administered to the subject.

[0234] The compositions described herein are applied in amounts sufficient to improve hearing, increase or induce wild-type Gjb2 expression in GJB2-expressing cells (e.g., cochlear supporting cells), increase or improve Gjb2 function, promote or increase cochlear supporting cell survival, or improve cochlear supporting cell function and / or structure. Hearing can be evaluated using standard hearing tests (e.g., audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions) and shows an improvement of 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200%, or more) compared to pre-treatment hearing measurements. In some embodiments, the compositions are applied in amounts sufficient to improve the subject's ability to understand conversation. The compositions described herein can also be administered in amounts sufficient to slow or prevent the development or progression of sensorineural hearing loss (e.g., in subjects with a gene mutation associated with GJB2-related hearing loss but not exhibiting hearing impairment, or in subjects exhibiting only mild to moderate hearing loss at the start of treatment). GJB2 expression can be evaluated using immunohistochemistry, Western blotting, quantitative real-time PCR, or other methods known in the art for detecting proteins or mRNA, and can be increased by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200%, or more) compared to expression prior to administration of the compositions described herein. Cochlear support cell function and / or Gjb2 function can be indirectly evaluated based on hearing tests and can be increased by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200% or more) compared to cochlear support cell function and / or Gjb2 function before administration of the compositions described herein. The compositions and methods described herein can also reduce toxicity associated with the administration of nucleic acid vectors compared to toxicity observed after administration of nucleic acid vectors that do not contain the GJB2 regulatory constructs described herein (e.g., nucleic acid vectors in which polynucleotides encoding Gjb2 are expressed using a universally available promoter). These effects can occur, for example, at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 weeks or longer after administration of the compositions described herein. Depending on the dosage and route of administration used for treatment, patients may be evaluated at 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or longer after administration of the composition. Based on the evaluation results, patients may receive additional treatment.

[0235] Reagent test kit

[0236] The compositions described herein can be provided in a kit for treating sensorineural hearing loss (e.g., GJB2-related hearing loss). The compositions may include a polynucleotide containing the GJB2 regulatory construct described herein (e.g., a polynucleotide having at least 85% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) or a nucleic acid vector containing such a polynucleotide, the GJB2 regulatory construct being operatively linked to a polynucleotide encoding Gjb2 (e.g., a polynucleotide encoding wild-type human Gjb2, such as that with SEQ ID NO: 1 or SEQ ID NO: 2). The sequence of SEQ ID NO: 3 has at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and contains at least 50% less CG dinucleotides (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides) than wild-type GJB2, or is associated with SEQ ID NO: 4 or SEQ ID NO: The sequence of 28 has at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) of polynucleotides. The nucleic acid vector can be packaged in an AAV viral capsid (e.g., AAV1, AAV2, AAV2quad(YF), AAV6, AAV8, AAV9, Anc80, Anc80L65, AAV-DJ, DJ / 9, 7m8, or PHP.B). The kit may also include instructions for use by the user (such as a physician) to perform the methods described herein. Optionally, the kit may include a syringe or other device for administering the composition.

[0237] Example

[0238] The following examples are provided to provide those skilled in the art with a description of how to use, prepare, and evaluate the compositions and methods described herein, and these examples are intended only as examples of the invention and not to limit the scope of what the inventors consider to be their invention.

[0239] Example 1. Western blot of protein expression of Flag-tagged hGJB2 codon variants

[0240] Human GJB2 (hGJB2) coding sequence variants, including the wild-type coding sequence (SEQ ID NO: 5), the CpG-depleted coding sequence (CpG-dep; SEQ ID NO: 3), the codon-optimized coding sequence (CodOpt; SEQ ID NO: 28), and the CpG-depleted codon-optimized coding sequence (CO-CpG-dep; SEQ ID NO: 4), were cloned into plasmids with the same C-terminal 3xFLAG tag sequence, under the control of the CMV promoter. Using Lipofectamine 3000 (Invitrogen L3000-015), 1 μg of each plasmid was transfected into 6-well plates with 6 x 10⁶ cells / wells. 5 Different wells of HeLa cells were used. Transfected cells were incubated at 37°C for 72 hours. Cells were then harvested, and cell lysates were run on a Western blot. hGJB2-3xFlag protein was detected using an anti-Flag antibody, and an anti-actin antibody was used as an internal control. Figure 18 (Figure A). The band intensity of hGJB2-3xFlag was measured and normalized relative to the actin band intensity. Figure 18 (Figure B). These results demonstrate that, in the wild-type background and with codon optimization, the in vitro hGJB2 level moderately decreases with CpG depletion.

[0241] Example 2. In vitro propidium iodide uptake in cells expressing wild-type or codon variant hGJB2

[0242] To compare the Gjb2 function of proteins derived from different hGJB2 coding sequences, in vitro functional assays were performed. When expressed in HeLa cells, human Gjb2 forms half-channels. These channels remain closed in the presence of calcium ions but open in the absence of calcium. The uptake of propidium iodide (PI) through the open half-channels was used to measure the in vitro functional activity of Gjb2.

[0243] Variants of the hGJB2 coding sequence, including the wild-type coding sequence (SEQ ID NO: 5), the CpG-depleted coding sequence (CpG-dep; SEQ ID NO: 3), the codon-optimized coding sequence (CodOpt; SEQ ID NO: 28), and the CpG-depleted codon-optimized coding sequence (CO-CpG-dep; SEQ ID NO: 4), were cloned into plasmids under the control of the CMV promoter. Using Lipofectamine 3000 (Invitrogen L3000-015), 200 nm of each plasmid was transfected into 24-well plates with a 1x10⁻⁶ micrometer diameter. 5Different wells containing HeLa cells. The transfected cells were incubated at 37°C for 72 hours. Then, culture medium was aspirated and used in either Ca2+ or Ca2+-free medium. 2+ The PI buffer was replaced in the Hanks' balanced salt solution (HBSS). The final solution was prepared as follows: containing Ca 2+ Buffer solution: 1x HBSS (Thermo 14065056) and 0.1 mg / mL PI (Sigma P4864); Ca-free 2+ The buffer solution consisted of calcium-free 1x HBSS (Thermo 14185052), 200 mM MgCl2 (VWR 97062-850), 10 mM MEGTA (Fisher 50-255-956), and 0.1 mg / mL PI. Cells were incubated in PI buffer at room temperature for 40 minutes. The buffer was then aspirated, and cells were harvested using a TrypLE Express (Gibco 12605-010) and run on a Sony SH800 flow cytometer in analyzer mode using a 561 nm laser and a PE (600 / 60) filter. The percentage of cells taking up PI was plotted for each coding sequence variant. Figure 19 (Figure A). All variants resulted in higher PI uptake than the "no GJB2" condition. Both CpG-depleted forms were functionally similar to wild-type hGJB2, while the codon-optimized form without CpG depletion resulted in increased PI uptake.

[0244] The CMV-driven wild-type (SEQ ID NO: 5) and CpG-depleted (SEQ ID NO: 3) hGJB2 genes were packaged into AAV1 vectors. HeLa cells were transduced using these vectors at different multiples of infection (MOIs): 1 x 10-1 cells per cell. 4 1x10 5 and 1x10 6 A total of 2.5 x 10 viral genomes (vg) were transduced. 5 Cells were incubated at 37°C for 72 hours, and then treated with Ca-free methods as described previously. 2+ Replace the medium with PI buffer. Incubate the cells at room temperature for 40 minutes, then harvest the cells and run them on an SH800 flow cytometer as described above. Plot the percentage of PI-positive cells at each MOI. Figure 19 (Figure B). Both the wild-type vector and the CpG-dep vector showed increased PI uptake at higher MOIs, with the CpG-dep form showing the highest uptake at MOI = 1 x 10⁻⁶. 6 Higher uptake occurs when the volume of vitamin A is present per cell (vg / cell).

[0245] Example 3. Hearing recovery driven by CpG depletion and wild-type hGJB2 transgene in a GJB2-deficient mouse model

[0246] Newborn GJB6-LacZ mice were unilaterally injected with 1 μL of AAV1 vector via fenestration in the posterior semicircular canal 1 to 3 days after birth. This AAV1 vector was derived from transgenic plasmid P1595 containing CpG-dep hGJB2 driven by a GJB2-regulated construct. Figure 6 (SEQ ID NO: 16), or the corresponding transgenic plasmid containing wild-type hGJB2 driven by the same GJB2 regulatory construct. To test hearing recovery, animals were anesthetized with ketamine and toluenethiazide, and auditory brainstem response (ABR) and distortion product otoacoustic emissions (DPOAE) were measured in both ears (injected and uninjected). Hearing recovery was tested at multiple time points from 4 to 24 weeks post-treatment. The level and persistence of hearing recovery were comparable between the two treatment groups. Figure 20 This indicates that the efficacy driven by wild-type and CpG-depleted transcripts is equivalent.

[0247] Example 4. Hearing recovery using CpG-depleted hGJB2 transgene followed a well-defined dose-response pattern.

[0248] Newborn GJB6-LacZ mice were unilaterally injected with 1 μL of 1x, 0.25x, or 0.1x doses of the AAV1 vector generated from transgenic plasmid P1595. Figure 6 (SEQ ID NO: 16). The surgical injection route and timing were as described in Example 3. Similar to Example 3, auditory brainstem response and aberration product otoacoustic emissions were measured four weeks after treatment. The results indicated a clear dose-response relationship, with the number of responders and the extent of hearing recovery increasing with dose level ( ). Figure 21 ).

[0249] Example 5. The bGH polyA signal sequence produced higher gene expression in vitro than the SV40 polyA signal sequence.

[0250] The bovine growth hormone polyadenylation (bGH_pA) signal (SEQ ID NO: 6) or simian virus 40 polyadenylation (SV40_pA) signal (SEQ ID NO: 7) was inserted into a plasmid downstream of the H2B-EGFP sequence driven by the CMV promoter (CMV.H2B-EGFP). Using Lipofectamine 3000 (Invitrogen L3000-015), 500 nanograms of each plasmid were transfected into 24-well plates with a density of 1 x 10⁻⁶ cells / well. 5Different wells of HEK293T cells were used. Transfected cells were incubated at 37°C for 48 hours. Cells were then harvested using TrypLE Express (Gibco 12605-010) and run on a Sony SH800 flow cytometer in analyzer mode using a 488nm laser and a FITC (525 / 50) filter. The geometric mean of fluorescence in EGFP-positive cells was measured and plotted. Figure 22 In vitro, the use of the bGH_pA signaling sequence resulted in higher average expression of CMV-driven EGFP compared to the SV40_pA signaling sequence.

[0251] Example 6. The pAAVdB scaffold functions similarly to pAAVKan in vitro.

[0252] Two distinct CMV.H2B-EGFP.bGH_pA gene cassettes (sequences not shown) with different restriction enzyme cloning sites in their intragene regions were cloned into ITR-containing plasmid backbones: pAAVKan (3,157 nucleotides spanning nucleotides 2454-5420 and 1-190 in SEQ ID NO: 20) or pAAVdB (3,038 nucleotides spanning nucleotides 2399-5301 and 1-135 in SEQ ID NO: 12). Using Lipofectamine 3000 (Invitrogen L3000-015), 500 nanograms of each plasmid were transfected into 24-well plates with a 1x10⁻⁶ plate. 5 Different wells of HEK293T cells were used. Transfected cells were incubated at 37°C for 48 hours. Cells were then harvested using TrypLE Express (Gibco 12605-010) and run on a Sony SH800 flow cytometer in analyzer mode using a 488 nm laser and a FITC (525 / 50) filter. The geometric mean of fluorescence in EGFP-positive cells was measured and plotted. Figure 23 Although there were some changes between the GFP boxes, there were no significant changes in expression between the two plasmid backbones.

[0253] Example 7. Administration of a composition containing the nucleic acid vector described herein to subjects with GJB2-related hearing loss.

[0254] According to the methods disclosed herein, those skilled in the art can treat patients, such as human patients, with GJB2-related hearing loss to improve or restore hearing, or slow or stop the progression of hearing loss. For this purpose, those skilled in the art can administer to human patients a composition containing an AAV carrier (e.g., AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB, or PHP.S carrier) containing the GJB2 modulatory construct described herein (e.g., with SEQ ID NO: 1 or SEQ ID NO: 1). 2. A polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), wherein the GJB2 regulatory construct is operatively linked to a polynucleotide encoding the wild-type form of Gjb2 (e.g., a polynucleotide encoding the amino acid sequence of SEQ ID NO: 38, such as a polynucleotide having at least 90% sequence identity with the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and containing at least 50% less CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides), or a polynucleotide with SEQ ID NO: 4 or SEQ ID NO: The sequence of 28 has at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity). Compositions containing AAV carriers can be administered to patients, for example, by local application to the inner ear (e.g., injection into the perilymph or through the round window membrane), to treat sensorineural hearing loss.

[0255] After the composition is administered to a patient, those skilled in the art can monitor the improvement in the patient's response to the therapy using a variety of methods. For example, a physician can monitor the patient's hearing after administration of the composition by performing standard tests such as audiometry, ABR, electrocochleography (ECOG), and DPOAE (doponic-acoustic emissions). If the patient shows improvement in hearing on one or more tests after administration of the composition compared to the results of hearing tests prior to the administration of the composition, this indicates a good response to the treatment. Subsequent doses can be determined and administered as needed.

[0256] Exemplary embodiments of the invention are described in the following paragraphs.

[0257] E1. A nucleic acid vector comprising, in a 5' to 3' sequence:

[0258] (a) A GJB2 regulatory construct having at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) with the sequence of SEQ ID NO: 1 or SEQ ID NO: 2, operatively linked to:

[0259] (b) A human GJB2 coding sequence selected from the group consisting of: SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 28, a sequence having at least 90% sequence identity with SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and containing at least 50% less CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides) and a sequence having at least 90% sequence identity with SEQ ID NO: 4 or SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), operatively ligated to:

[0260] (c) Polyadenylation (polyA) signal sequence.

[0261] E2. The nucleic acid vector as described in E1, wherein the GJB2 regulatory construct has at least 90% sequence identity with the sequence of SEQ ID NO: 1 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0262] E3. The nucleic acid vector as described in E2, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1.

[0263] E4. The nucleic acid vector as described in E1, wherein the GJB2 regulatory construct has at least 90% sequence identity with the sequence of SEQ ID NO: 2 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0264] E5. The nucleic acid vector as described in E4, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2.

[0265] E6. The nucleic acid vector as described in any one of E1-E5, wherein the human GJB2 coding sequence has at least 90% sequence identity with the sequence of SEQ ID NO:3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), and contains at least 50% less CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides).

[0266] E7. The nucleic acid vector as described in E6, wherein the human GJB2 coding sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and does not contain CG dinucleotides.

[0267] E8. The nucleic acid vector as described in E6 or E7, wherein the human GJB2 coding sequence has the sequence of SEQ ID NO: 3.

[0268] E9. The nucleic acid vector as described in any one of E1-E5, wherein the human GJB2 coding sequence has at least 90% sequence identity with the sequence of SEQ ID NO:4 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0269] E10. The nucleic acid vector as described in E9, wherein the human GJB2 coding sequence has the sequence of SEQ ID NO: 4.

[0270] E11. The nucleic acid vector as described in any one of E1-E5, wherein the human GJB2 coding sequence has at least 90% sequence identity with the sequence of SEQ ID NO:28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0271] E12. The nucleic acid vector as described in E11, wherein the human GJB2 coding sequence has the sequence of SEQ ID NO: 28.

[0272] E13. The nucleic acid vector as described in any one of E1-E3 and E6-E8, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 3.

[0273] E14. The nucleic acid vector as described in any one of E1-E3, E9 and E10, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1 and the human GJB2 coding sequence has the sequence of SEQ ID NO: 4.

[0274] E15. The nucleic acid vector as described in any one of E1-E3, E11 and E12, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1 and the human GJB2 coding sequence has the sequence of SEQ ID NO: 28.

[0275] E16. The nucleic acid vector as described in any one of E1 and E4-E8, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 3.

[0276] E17. The nucleic acid vector as described in any one of E1, E4, E5, E9 and E10, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2 and the human GJB2 coding sequence has the sequence of SEQ ID NO: 4.

[0277] E18. The nucleic acid vector as described in any one of E1, E4, E5, E11 and E12, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2 and the human GJB2 coding sequence has the sequence of SEQ ID NO: 28.

[0278] E19. The nucleic acid vector as described in any one of E1-E18, wherein the polyA signal sequence has at least 90% sequence identity with the sequence of SEQ ID NO:6 or SEQ ID NO:7 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0279] E20. The nucleic acid vector as described in E19, wherein the polyA signal sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 6 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0280] E21. The nucleic acid vector as described in E20, wherein the polyA signal sequence has the sequence of SEQ ID NO: 6.

[0281] E22. The nucleic acid vector as described in E19, wherein the polyA signal sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 7 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0282] E23. The nucleic acid vector as described in E22, wherein the polyA signal sequence has the sequence of SEQ ID NO: 7.

[0283] E24. The nucleic acid vector as described in any one of E1-E23, further comprising a first polynucleotide having at least 90% sequence identity with SEQ ID NO: 8 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and a second polynucleotide having at least 90% sequence identity with SEQ ID NO: 9 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), wherein the first polynucleotide comprises a first member of an ITR pair and is located at the 5' of the GJB2 regulatory construct sequence, and the second polynucleotide comprises a second member of an ITR pair and is located at the 3' of the polyA signal sequence.

[0284] E25. The nucleic acid vector as described in E24, wherein the first polynucleotide has the sequence of SEQ ID NO: 8 and the second polynucleotide has the sequence of SEQ ID NO: 9.

[0285] E26. The nucleic acid vector as described in any one of E1-E23, further comprising a first polynucleotide having at least 90% sequence identity with SEQ ID NO: 10 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and a second polynucleotide having at least 90% sequence identity with SEQ ID NO: 11 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), wherein the first polynucleotide comprises a first member of an ITR pair and is located at the 5' of the GJB2 regulatory construct sequence, and the second polynucleotide comprises a second member of an ITR pair and is located at the 3' of the polyA signal sequence.

[0286] E27. The nucleic acid vector as described in E26, wherein the first polynucleotide has the sequence of SEQ ID NO: 8 and the second polynucleotide has the sequence of SEQ ID NO: 9.

[0287] E28. The nucleic acid vector as described in any one of E1-E27, wherein the stop codon is located at the 3' end of the GJB2 coding sequence (e.g., the stop codon is directly attached to the 3' end of the GJB2 coding sequence).

[0288] E29. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 157 to 2383 of SEQ ID NO: 12.

[0289] E30. A nucleic acid vector as described in E1 or E29, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 2531 of SEQ ID NO: 12.

[0290] E31. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 157 to 2383 of SEQ ID NO: 13.

[0291] E32. The nucleic acid vector as described in E1 or E31, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 2531 of SEQ ID NO: 13.

[0292] E33. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 157 to 3459 of SEQ ID NO: 14.

[0293] E34. A nucleic acid vector as described in E1 or E33, wherein the vector comprises a polynucleotide sequence containing nucleotide 1 to 3607 of SEQ ID NO: 14.

[0294] E35. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 157 to 3459 of SEQ ID NO: 15.

[0295] E36. A nucleic acid vector as described in E1 or E35, wherein the vector comprises a polynucleotide sequence containing nucleotide 1 to 3607 of SEQ ID NO: 15.

[0296] E37. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 157 to 2462 of SEQ ID NO: 16.

[0297] E38. A nucleic acid vector as described in E1 or E37, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 2610 of SEQ ID NO: 16.

[0298] E39. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 157 to 2462 of SEQ ID NO: 17.

[0299] E40. A nucleic acid vector as described in E1 or E39, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 2610 of SEQ ID NO: 17.

[0300] E41. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 157 to 3538 of SEQ ID NO: 18.

[0301] E42. The nucleic acid vector as described in E1 or E41, wherein the vector comprises a polynucleotide sequence containing nucleotide 1 to 3686 of SEQ ID NO: 18.

[0302] E43. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 157 to 3538 of SEQ ID NO: 19.

[0303] E44. A nucleic acid vector as described in E1 or E43, wherein the vector comprises a polynucleotide sequence containing nucleotide 1 to 3686 of SEQ ID NO: 19.

[0304] E45. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 212 to 2438 of SEQ ID NO: 20.

[0305] E46. A nucleic acid vector as described in E1 or E45, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 2650 of SEQ ID NO: 20.

[0306] E47. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 212 to 2438 of SEQ ID NO: 21.

[0307] E48. A nucleic acid vector as described in E1 or E47, wherein the vector comprises a polynucleotide sequence containing nucleotide 1 to 2650 of SEQ ID NO: 21.

[0308] E49. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 212 to 3514 of SEQ ID NO: 22.

[0309] E50. A nucleic acid vector as described in E1 or E49, wherein the vector comprises a polynucleotide sequence containing nucleotide 1 to 3726 of SEQ ID NO: 22.

[0310] E51. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 212 to 3514 of SEQ ID NO: 23.

[0311] E52. The nucleic acid vector as described in E1 or E51, wherein the vector comprises a polynucleotide sequence containing nucleotide 1 to 3726 of SEQ ID NO: 23.

[0312] E53. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 212 to 2517 of SEQ ID NO: 24.

[0313] E54. A nucleic acid vector as described in E1 or E53, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 2729 of SEQ ID NO: 24.

[0314] E55. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 212 to 2517 of SEQ ID NO: 25.

[0315] E56. A nucleic acid vector as described in E1 or E55, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 2729 of SEQ ID NO: 25.

[0316] E57. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 212 to 3593 of SEQ ID NO: 26.

[0317] E58. A nucleic acid vector as described in E1 or E57, wherein the vector comprises a polynucleotide sequence containing nucleotide 1 to 3805 of SEQ ID NO: 26.

[0318] E59. The nucleic acid vector as described in E1, wherein the vector comprises a polynucleotide sequence containing nucleotides 212 to 3593 of SEQ ID NO: 27.

[0319] E60. A nucleic acid vector as described in E1 or E59, wherein the vector comprises a polynucleotide sequence containing nucleotide 1 to 3805 of SEQ ID NO: 27.

[0320] E61. A polynucleotide comprising a human GJB2 coding sequence selected from the group consisting of: SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:28, a sequence having at least 90% sequence identity with SEQ ID NO:3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and comprising at least 50% less CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides) and a sequence having at least 90% sequence identity with SEQ ID NO:28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0321] E62. The polynucleotide as described in E61, wherein the human GJB2 coding sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), and contains at least 50% less CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or less CG dinucleotides).

[0322] E63. The polynucleotide as described in E62, wherein the human GJB2 coding sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and does not contain CG dinucleotides.

[0323] E64. The polynucleotide as described in E62 or E63, wherein the human GJB2 coding sequence has the sequence of SEQ ID NO: 3.

[0324] E65. The polynucleotide as described in E61, wherein the human GJB2 coding sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 4 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0325] E66. The polynucleotide as described in E65, wherein the human GJB2 coding sequence has the sequence of SEQ ID NO: 4.

[0326] E67. The polynucleotide as described in E61, wherein the human GJB2 coding sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0327] E68. The polynucleotide as described in E67, wherein the human GJB2 coding sequence has the sequence of SEQ ID NO: 28.

[0328] E69. The polynucleotide as described in any one of E61-E68, wherein the stop codon is located at the 3' end of the GJB2 coding sequence (e.g., the stop codon is directly attached to the 3' end of the GJB2 coding sequence).

[0329] E70. A polynucleotide as described in any one of E61-E69, wherein the GJB2 promoter is operatively linked to the GJB2 coding sequence.

[0330] E71. The polynucleotide as described in E70, wherein the GJB2 promoter is located at the 5' of the GJB2 coding sequence.

[0331] E72. The polynucleotide as described in E70 or E71, wherein the GJB2 promoter is contained in the GJB2 regulatory construct.

[0332] E73. The polynucleotide as described in E72, wherein the GJB2 regulatory construct has at least 90% sequence identity with the sequence of SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0333] E74. The polynucleotide as described in 73, wherein the GJB2 regulatory construct has at least 90% sequence identity with the sequence of SEQ ID NO: 1 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0334] E75. The polynucleotide as described in E74, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1.

[0335] E76. The polynucleotide as described in E75, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 3.

[0336] E77. The polynucleotide as described in E75, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 4.

[0337] E78. The polynucleotide as described in E75, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 28.

[0338] E79. The polynucleotide as described in E73, wherein the GJB2 regulatory construct has at least 90% sequence identity with the sequence of SEQ ID NO: 2 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0339] E80. The polynucleotide as described in E79, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2.

[0340] E81. The polynucleotide as described in E80, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 3.

[0341] E82. The polynucleotide as described in E80, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 4.

[0342] E83. The polynucleotide as described in E80, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 28.

[0343] E84. The polynucleotide as described in any one of E61-E83, wherein the GJB2 coding sequence is operatively linked to the polyA signal sequence.

[0344] E85. The polynucleotide as described in E84, wherein the polyA signal sequence is located at the 3' of the GJB2 coding sequence.

[0345] E86. The polynucleotide as described in E84 or E85, wherein the polyA signal sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0346] E87. The polynucleotide as described in E86, wherein the polyA signal sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 6 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0347] E88. The polynucleotide as described in E87, wherein the polyA signal sequence has the sequence of SEQ ID NO: 6.

[0348] E89. The polynucleotide as described in E86, wherein the polyA signal sequence has at least 90% sequence identity with the sequence of SEQ ID NO: 7 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity).

[0349] E90. The polynucleotide as described in E89, wherein the polyA signal sequence has the sequence of SEQ ID NO: 7.

[0350] E91. The polynucleotide as described in any one of E71-E90, further comprising a first polynucleotide having at least 90% sequence identity with SEQ ID NO: 8 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and a second polynucleotide having at least 90% sequence identity with SEQ ID NO: 9 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), wherein the first polynucleotide comprises a first member of an ITR pair and is located at the 5' of the sequence of the GJB2 promoter or the GJB2 regulatory construct, and the second polynucleotide comprises a second member of an ITR pair and is located at the 3' of the polyA signal sequence.

[0351] E92. The polynucleotide as described in E91, wherein the first polynucleotide has the sequence of SEQ ID NO: 8 and the second polynucleotide has the sequence of SEQ ID NO: 9.

[0352] E93. The polynucleotide as described in any one of E71-E90, further comprising a first polynucleotide having at least 90% sequence identity with SEQ ID NO: 10 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity) and a second polynucleotide having at least 90% sequence identity with SEQ ID NO: 11 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), wherein the first polynucleotide comprises a first member of an ITR pair and is located at the 5' of the sequence of the GJB2 promoter or the GJB2 regulatory construct, and the second polynucleotide comprises a second member of an ITR pair and is located at the 3' of the polyA signal sequence.

[0353] E94. The polynucleotide as described in E93, wherein the first polynucleotide has the sequence of SEQ ID NO: 8 and the second polynucleotide has the sequence of SEQ ID NO: 9.

[0354] E95. The polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 157 to 2383 of SEQ ID NO: 12.

[0355] E96. The polynucleotide as described in E61, E73 or E95, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 2531 of SEQ ID NO:12.

[0356] E97. The polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 157 to 2383 of SEQ ID NO: 13.

[0357] E98. The polynucleotide as described in E61, E73 or E97, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 2531 of SEQ ID NO:13.

[0358] E99. The polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 157 to 3459 of SEQ ID NO: 14.

[0359] E100. Polynucleotides as described in E61, E73 or E99, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 3607 of SEQ ID NO:14.

[0360] E101. A polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 157 to 3459 of SEQ ID NO: 15.

[0361] E102. The polynucleotide as described in E61, E73 or E101, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 3607 of SEQ ID NO: 15.

[0362] E103. The polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 157 to 2462 of SEQ ID NO: 16.

[0363] E104. The polynucleotide as described in E61, E73 or E103, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 2610 of SEQ ID NO: 16.

[0364] E105. The polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 157 to 2462 of SEQ ID NO: 17.

[0365] E106. The polynucleotide as described in E61, E73 or E104, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 2610 of SEQ ID NO: 17.

[0366] E107. The polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 157 to 3538 of SEQ ID NO: 18.

[0367] E108. A polynucleotide as described in E61, E73 or E107, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 3686 of SEQ ID NO: 18.

[0368] E109. The polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 157 to 3538 of SEQ ID NO: 19.

[0369] E110. The polynucleotide as described in E61, E73 or E109, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 3686 of SEQ ID NO: 19.

[0370] E111. The polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 212 to 2438 of SEQ ID NO: 20.

[0371] E112. The polynucleotide as described in E61, E73 or E111, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 2650 of SEQ ID NO: 20.

[0372] E113. The polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 212 to 2438 of SEQ ID NO: 21.

[0373] E114. The polynucleotide as described in E61, E73 or E113, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 2650 of SEQ ID NO: 21.

[0374] E115. The polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 212 to 3514 of SEQ ID NO: 22.

[0375] E116. The polynucleotide as described in E61, E73 or E115, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 3726 of SEQ ID NO: 22.

[0376] E117. The polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 212 to 3514 of SEQ ID NO: 23.

[0377] E118. A polynucleotide as described in E61, E73 or E117, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 3726 of SEQ ID NO: 23.

[0378] E119. The polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 212 to 2517 of SEQ ID NO: 24.

[0379] E120. Polynucleotides as described in E61, E73 or E119, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 2729 of SEQ ID NO: 24.

[0380] E121. A polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 212 to 2517 of SEQ ID NO: 25.

[0381] E122. The polynucleotide as described in E61, E73 or E121, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 2729 of SEQ ID NO: 25.

[0382] E123. The polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 212 to 3593 of SEQ ID NO: 26.

[0383] E124. The polynucleotide as described in E61, E73 or E123, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 3805 of SEQ ID NO: 26.

[0384] E125. The polynucleotide as described in E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 212 to 3593 of SEQ ID NO: 27.

[0385] E126. The polynucleotide as described in E61, E73 or E125, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotide 1 to 3805 of SEQ ID NO: 27.

[0386] E127. A nucleic acid vector comprising any one of E61-E126.

[0387] E128. A nucleic acid vector as described in any one of E1-E60 and E127, wherein the nucleic acid vector is a viral vector, plasmid, granule or artificial chromosome.

[0388] E129. The nucleic acid vector as described in any one of E1-E60, E127 and E122, wherein the nucleic acid vector is a viral vector.

[0389] E130. The nucleic acid vector as described in E129, wherein the viral vector is selected from the group consisting of adeno-associated virus (AAV), adenovirus, and lentivirus.

[0390] E131. The nucleic acid vector as described in E130, wherein the viral vector is an AAV vector.

[0391] E132. The nucleic acid vector as described in E131, wherein the AAV vector has an AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB, or PHP.S capsid.

[0392] E133. The nucleic acid vector as described in E132, wherein the AAV vector has an AAV1 capsid.

[0393] E134. The nucleic acid vector as described in E132, wherein the AAV vector has an AAV-DJ capsid.

[0394] E135. The nucleic acid vector as described in E132, wherein the AAV vector has an AAV9 capsid.

[0395] E136. The nucleic acid vector as described in E132, wherein the AAV vector has a 7m8 capsid.

[0396] E137. The nucleic acid vector as described in E132, wherein the AAV vector has an Anc80 capsid.

[0397] E138. The nucleic acid vector as described in E132, wherein the AAV vector has an AAV2 capsid.

[0398] E139. The nucleic acid vector as described in E132, wherein the AAV vector has an AAV2quad(YF) capsid.

[0399] E140. Nucleic acid vectors as described in E132, wherein the AAV vector has an AAV8 capsid.

[0400] E141. The nucleic acid vector as described in E132, wherein the AAV vector has a DJ / 9 capsid.

[0401] E142. Nucleic acid vectors as described in E132, wherein the AAV vector has a PHP.B capsid.

[0402] E143. The nucleic acid vector as described in E132, wherein the AAV vector has an AAV6 capsid.

[0403] E144. Nucleic acid vectors as described in E132, wherein the AAV vector has a PHP.S capsid.

[0404] E145. A composition comprising any one of E1-E60 and E127-E144 of a nucleic acid carrier and a pharmaceutically acceptable carrier, diluent or excipient.

[0405] E146. A cell comprising a polynucleotide as described in any one of E61-E126 or a nucleic acid vector as described in any one of E1-E60 and E127-E144.

[0406] E147. Cells as described in E146, wherein the cells are cells expressing GJB2.

[0407] E148. Cells as described in E147, wherein the GJB2-expressing cells are inner ear cells that express GJB2.

[0408] E149. The cell as described in any one of E146-E148, wherein the cell is a mammalian cell.

[0409] E150. Cells as described in E149, wherein the mammalian cell is a human cell.

[0410] E151. The cell as described in any one of E146-E150, wherein the cell is a cochlear support cell.

[0411] E152. A method of expressing human GJB2 in cells expressing GJB2, comprising contacting the GJB2-expressing cells with a nucleic acid vector as described in any one of E1-E60 and E127-E144 or a composition as described in E145.

[0412] E153. The method as described in E152, wherein the cell expressing GJB2 is an inner ear cell expressing GJB2.

[0413] E154. The method as described in E153, wherein the inner ear cells expressing GJB2 are cochlear supporting cells.

[0414] E155. The method of any one of E152-E154, wherein the contact is performed in a subject (e.g., in vivo).

[0415] E156. A method of treating a subject with GJB2-related hearing loss or at risk of developing GJB2-related hearing loss, comprising administering a therapeutically effective amount of a nucleic acid vector as described in any one of E1-E60 and E127-E144 or a composition as described in E145 to the inner ear of the subject.

[0416] E157. The method as described in E156, wherein the GJB2-related hearing loss is DFNB1, DFNA3, or hearing loss associated with Bart-Pomfley syndrome, hystrix-like ichthyosis with deafness, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with deafness, or Warwinkel syndrome.

[0417] E158. The method as described in E156, wherein the hearing loss is DFNB1 or DFNA3.

[0418] E159. The method as described in E158, wherein the subject has a mutation in GJB2, a mutation in GJB6, or a mutation in both GJB2 and GJB6.

[0419] E160. A method for improving the function or survival of cochlear supporting cells, the method comprising contacting the cochlear supporting cells with a nucleic acid vector as described in any one of E1-E60 and E127-E144 or a composition as described in E145.

[0420] E161. The method as described in E160, wherein the contact is performed in a subject (e.g., in vivo).

[0421] E162. A method for improving cochlear support cell function or cochlear support cell survival in a subject in need, the method comprising administering a therapeutically effective amount of a nucleic acid vector, as described in any one of E1-E60 and E127-E144, or a composition as described in E145, to the inner ear of the subject.

[0422] E163. The method as described in E161 or E162, wherein the subject has GJB2-related hearing loss or is at risk of developing GJB2-related hearing loss.

[0423] E164. The method as described in E163, wherein the GJB2-related hearing loss is DFNB1, DFNA3, or hearing loss associated with Bart-Pomfley syndrome, hystrix-like ichthyosis with deafness, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with deafness, or Warwinkel syndrome.

[0424] E165. The method as described in E163, wherein the hearing loss is DFNB1 or DFNA3.

[0425] E166. The method of any one of E160-E165, wherein the cochlear supporting cells are mammalian cochlear supporting cells.

[0426] E167. The method as described in E166, wherein the mammalian cochlear support cell is a human cochlear support cell.

[0427] E168. The method of any one of E155-E159 and E161-E167, wherein the method further comprises evaluating the hearing of the subject prior to administration of the nucleic acid vector or composition.

[0428] E169. The method of any one of E155-E159 and E161-E168, wherein the method further comprises evaluating the hearing of the subject after administration of the nucleic acid vector or composition.

[0429] E170. The method of any one of E155-E169, wherein the nucleic acid vector or composition is applied topically.

[0430] E171. The method as described in E170, wherein the nucleic acid vector or composition is applied to the inner ear.

[0431] E172. The method as described in E170, wherein the nucleic acid vector or composition is applied to the middle ear.

[0432] E173. The method as described in E170, wherein the nucleic acid vector or composition is administered via the tympanic membrane or tympanic cavity.

[0433] E174. The method as described in E170, wherein the nucleic acid vector or composition is applied to perilymph.

[0434] E175. The method as described in E170, wherein the nucleic acid vector or composition is applied to the endolymph.

[0435] E176. The method as described in E170, wherein the nucleic acid vector or composition is applied to or through the oval window.

[0436] E177. The method as described in E170, wherein the nucleic acid vector or composition is applied to or through a circular window.

[0437] E178. The method of any one of E155-E177, wherein the nucleic acid vector or the composition is applied in an amount sufficient to prevent or reduce hearing loss, delay the development of hearing loss, slow the progression of hearing loss, improve hearing, increase or induce the expression of human GJB2 in GJB2-expressing cells, promote or increase the survival of cochlear support cells, or improve the function of cochlear support cells.

[0438] E179. The method of any one of E155-E159 and E161-E178, wherein the subject is a human subject.

[0439] E180. A kit comprising any one of the polynucleotides described in E61-E126, any one of the nucleic acid vectors described in E1-E50 and E127-E144, or the composition described in E145.

[0440] Other implementation plans

[0441] Various modifications and variations of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in conjunction with specific embodiments, it should be understood that the claimed invention should not be unduly limited to such specific embodiments. In fact, various modifications to the described methods for carrying out the invention will be apparent to those skilled in the art and are intended to be included within the scope of the invention. Other embodiments are within the scope of the claims.

Claims

1. A nucleic acid vector comprising, in a 5' to 3' sequence: (a) A GJB2 regulatory construct having a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and a sequence having at least 90% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2, operably linked to: (b) A human GJB2 coding sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 28, a sequence having at least 90% sequence identity with SEQ ID NO: 3 and containing at least 50% less CG dinucleotides than wild-type GJB2, and a sequence having at least 90% sequence identity with SEQ ID NO: 4 or SEQ ID NO: 28, operably linked to: (c) Polyadenylation (polyA) signal sequence.

2. The nucleic acid vector of claim 1, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO:

3.

3. The nucleic acid vector of claim 1, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO:

4.

4. The nucleic acid vector of claim 1, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO:

28.

5. The nucleic acid vector of claim 1, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2; and the human GJB2 coding sequence has the sequence of SEQ ID NO:

3.

6. The nucleic acid vector of claim 1, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2; and the human GJB2 coding sequence has the sequence of SEQ ID NO:

4.

7. The nucleic acid vector of claim 1, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2; and the human GJB2 coding sequence has the sequence of SEQ ID NO:

28.

8. The nucleic acid vector according to any one of claims 1-7, wherein the polyA signal sequence has at least 90% sequence identity with SEQ ID NO:6 or SEQ ID NO:

7.

9. The nucleic acid vector of claim 8, wherein the polyA signal sequence has the sequence of SEQ ID NO:

6.

10. The nucleic acid vector of claim 8, wherein the polyA signal sequence has the sequence of SEQ ID NO:

7.

11. The nucleic acid vector according to any one of claims 1-10, wherein the vector comprises a stop codon located at the 3' end of the GJB2 coding sequence.

12. The nucleic acid vector of any one of claims 1-11, wherein the vector further comprises a first polynucleotide having at least 90% sequence identity with SEQ ID NO: 8 and a second polynucleotide having at least 90% sequence identity with SEQ ID NO: 9, the first polynucleotide comprising a first member of an ITR pair and located at the 5' of the GJB2 regulatory construct sequence, and the second polynucleotide comprising a second member of an ITR pair and located at the 3' of the polyA signal sequence.

13. The nucleic acid vector of any one of claims 1-11, wherein the vector further comprises a first polynucleotide having at least 90% sequence identity with SEQ ID NO: 10 and a second polynucleotide having at least 90% sequence identity with SEQ ID NO: 11, the first polynucleotide comprising a first member of an ITR pair and located at the 5' of the GJB2 regulatory construct sequence, and the second polynucleotide comprising a second member of an ITR pair and located at the 3' of the polyA signal sequence.

14. The nucleic acid vector according to any one of claims 1-13, wherein the nucleic acid vector is a viral vector.

15. The nucleic acid vector of claim 14, wherein the viral vector is an adeno-associated virus (AAV) vector.

16. A composition comprising a nucleic acid carrier as described in any one of claims 1-15; and a pharmaceutically acceptable carrier, diluent, or excipient.

17. A method of treating a subject suffering from or at risk of developing GJB2-related hearing loss, comprising administering a therapeutically effective amount of a nucleic acid vector as described in any one of claims 1-15 or a composition as described in claim 16 to the inner ear of the subject.

18. The method of claim 17, wherein the GJB2-related hearing loss is DFNB1 or DFNA3.

19. The method of claim 18, wherein the subject has a mutation in GJB2, a mutation in GJB6, or a mutation in both GJB2 and GJB6.

Images