Preparation method and application of akabane virus vaccine based on BEI inactivation

By optimizing the BEI inactivation process, the integrity of the antigen structure of the Akabane virus vaccine was ensured, which solved the problem of low neutralizing antibody titer in existing vaccines and achieved high immunogenicity and virus inhibition effect.

CN121570583AActive Publication Date: 2026-02-27FOSHAN UNIVERSITY
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202610101988.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-26
Publication Date
2026-02-27
Estimated Expiration
2046-01-26

AI Technical Summary

Technical Problem

Existing Akabane virus inactivated vaccines are prone to damaging the conformation of viral surface antigens during the inactivation process, resulting in insufficient immunogenicity and low neutralizing antibody titers, which makes it difficult to meet the needs of high-quality vaccine development and standard positive serum preparation.

Method used

The virus was treated with BEI inactivating agent at 37°C for 4 hours, and the reaction was terminated with sodium thiosulfate. The final concentration was limited to 0.002 mol/L to ensure complete inactivation of the virus and integrity of the antigen structure. The virus was then mixed with adjuvant to prepare the vaccine.

Benefits of technology

It significantly improved the neutralizing antibody titer, induced a highly efficient immune response in mouse and rabbit models, significantly inhibited viral replication and RNA copy number, and enhanced the immune effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121570583A_ABST
    Figure CN121570583A_ABST
Patent Text Reader

Abstract

The invention discloses a preparation method and application of an akabane virus vaccine based on BEI inactivation. The BEI inactivation process is optimized aiming at the AKAVFS202301 akabane virus strain, so that the virus antigen structure is effectively reserved while the complete inactivation of the virus is ensured; the prepared inactivated vaccine can induce an experimental animal to generate a high-titer neutralizing antibody, the titer of the neutralizing antibody of rabbit immune serum is 56, the titer of the neutralizing antibody of mouse immune serum is 55, and the obtained immune serum can significantly reduce the virus RNA copy number of AKAV, inhibit virus replication activity and significantly reduce the proportion of positive cells infected with AKAV. In conclusion, the akabane virus vaccine provided by the invention realizes efficient antigen retention and remarkably enhanced immune response, has the advantages of strong immunogenicity, remarkable virus inhibition effect and the like, and has a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of animal virology and veterinary vaccine research and development technology, specifically relating to the preparation method of Akabane virus vaccine based on BEI inactivation and its application. Background Technology

[0002] Akabane virus (AKAV) belongs to the order Bunyavirales, family Peribunyaviridae, and genus Orthobunyavirus. Its genome consists of three RNA segments: L, M, and S. It can cause polymorphic birth defects in ruminants such as cattle and sheep, including abortion, stillbirth, hydrocephalus, and joint contractures. Currently, there is no commercially available vaccine in my country, and there is a lack of standardized strains, neutralizing antibody resources, and supporting testing tools, severely restricting the epidemiological surveillance, laboratory diagnosis, and vaccine development for Akabane disease. Existing inactivated Akabane disease vaccine research mostly uses traditional chemical inactivation methods such as formaldehyde. However, these inactivating agents easily destroy the conformation of key viral surface antigens, especially the Gc protein encoded by the M gene, whose intact structure is crucial for inducing high levels of viral neutralizing antibodies. Due to the severe damage to the antigenic structure during inactivation, traditional inactivated vaccines generally suffer from insufficient immunogenicity and low neutralizing antibody titers, thus limiting their protective efficacy. Therefore, there is an urgent need to establish an inactivated vaccine preparation process that can maintain the integrity of the antigen conformation to the maximum extent while ensuring complete inactivation of the virus and significantly improve immunogenicity, so as to provide key technical support for vaccine development, preparation of standard positive serum and subsequent virological detection methods.

[0003] In reported studies of AKAV inactivated vaccines, neutralizing antibody titers are generally low. For example, in Reference 1 (Yeon-HeeKim, Chang-Hee Kweon, Dong-Seob Tark, et al., Development of inactivated trivalent vaccine for the teratogenic Aino, Akabane and Chuzan viruses.[J]Biologicals 39 (2011) 152e157), mice and cattle were immunized twice with trivalent inactivated vaccines against Aino virus, Akabane virus, and Chuzan virus (3 mL of vaccine injected 3 weeks apart). The neutralizing antibody titers against Akabane virus were mostly only 1:64 to 1:256, and the Akabane virus used was the K-9 strain. In Reference 2 (Dong-Kun Yang, Ha-Hyun Kim, Hyun-Ye Jo, et al., Development of inactivated Akabane and bovineephemeral fever vaccine for The Akabane virus strain used in cattle was KV0505. A regimen of multiple booster immunizations was added to the basic immunization; however, the neutralizing antibody titers in cattle and sows remained at 1:64–1:512. In reference 3 (Yohsuke OGAWA, Masahiro EGUCHI and Yoshihiro SHIMOJI. Two Akabane virus glycoprotein Gc domains induce neutralizing antibodies in mice.[J]The Journal of veterinary medical science. Volume 84, Issue 4. 2022. PP 538-542), three immunizations using recombinant Gc protein still resulted in low neutralizing antibody titers in mice. Patent CN117100849A (A positive Akabane virus serum and its preparation method) used four immunizations, achieving neutralizing antibody titers of 1:512–1:720 in guinea pig serum and 1:512 in rabbit serum. In summary, even with multiple immunizations (3-4 times), the neutralizing antibody titers of existing domestic and international AKAV inactivated vaccines are generally still lower than 1:512, which is insufficient to meet the needs of high-quality vaccine development and standard positive serum preparation. Summary of the Invention

[0004] The Gc glycoprotein on the envelope of Akabane virus (AKAV) is a key antigenic determinant for inducing viral neutralizing antibodies, but this protein is highly sensitive to chemical inactivation conditions. While there are reports of using inactivating agents such as formaldehyde or binary ethylenimine (BEI) to treat the virus in existing technologies, most studies have not systematically optimized inactivation conditions to address the antigenic structural characteristics of AKAV. This inactivation process easily leads to conformational damage to key antigens, resulting in insufficient immunogenicity of inactivated vaccines and generally low neutralizing antibody titers, making it difficult to meet the requirements for high-quality vaccine preparation and the preparation of standard positive sera.

[0005] To address the aforementioned issues, this invention does not simply employ BEI as an inactivating agent. Instead, it optimizes the BEI inactivation process based on the biological characteristics of Akabane virus. This invention establishes an inactivation process system adapted to AKAV by limiting the final BEI concentration to 0.002 mol / L, controlling the inactivation time at 37°C to approximately 4 hours, and promptly adding sodium thiosulfate to terminate the reaction after inactivation. This ensures the virus completely loses its replication activity while avoiding irreversible damage to the viral surface antigens caused by excessive inactivation.

[0006] After treatment with the above-described inactivation process for AKAV virus, the inactivated virus exhibited good antigen structure preservation in various immunological assays. The inactivated viral antigens could still be stably recognized by specific antibodies against the N and Gc proteins of AKAV. Western blot and immunofluorescence experiments showed that the Gc protein was clearly expressed with a stable signal, without significant degradation or epitope loss, indicating that the inactivation process of this invention effectively maintained the native conformation of the key neutralizing antigens of AKAV while achieving complete inactivation.

[0007] The Akabane virus inactivated vaccine prepared using the above inactivation process, after multiple immunizations in mouse and rabbit models, induced neutralizing antibody titers significantly higher than those of existing technologies, and significantly inhibited AKAV replication in cells, reduced viral RNA copy number, and viral antigen expression levels. These results demonstrate that the BEI inactivation process established in this invention exhibits significant advantages in both antigen retention and immunogenicity, providing key technical support for obtaining a highly effective Akabane virus inactivated vaccine.

[0008] The first objective of this invention is to provide an Akabane virus vaccine containing an inactivated Akabane virus strain AKAV_FS202301 and an adjuvant.

[0009] Preferably, the adjuvant is Freund's complete adjuvant or ISA 61 VG adjuvant.

[0010] Preferably, the Akabane virus vaccine is prepared by the following steps: S1. To a viral titer of 10 7 TCID 50 Add 1% (v / mL) of BEI inactivating agent at a concentration of 0.2 mol / L to the AKAV_FS202301 virus solution, stir at 37℃ for more than 4 h, and then add 2 mol / L sodium thiosulfate solution to terminate the inactivation reaction to obtain the inactivated Akabane virus strain AKAV_FS202301. S2. The inactivated Akabane virus strain AKAV_FS202301 is emulsified with Freund's complete adjuvant or ISA 61 VG adjuvant at a volume ratio of 1:1 to obtain the Akabane virus vaccine.

[0011] Preferably, the preparation method of the AKAV_FS202301 virus solution is as follows: Vero cells are infected with Akabane virus strain AKAV_FS202301 until CPE occurs, and virus particles are released by repeated freeze-thaw cycles. Cell debris is removed by centrifugation at 12000 r / min, and the resulting supernatant is the AKAV_FS202301 virus solution.

[0012] Preferably, the BEI inactivator is prepared as follows: 4.1% BEA by mass is dissolved in a 1.6% sodium hydroxide solution, and cyclized at 37°C for 1.5 h, with vigorous shaking for 10 s every 15 min during the reaction. After the reaction is complete, a 0.2 mol / L BEI inactivator is obtained.

[0013] The second objective of this invention is to provide a method for preparing serum containing Akabane virus antibodies, comprising the following steps: S1. Immunize animals with the Akabane virus vaccine described in any one of the above statements; S2. Isolate the serum of immunized animals.

[0014] Preferably, when the animal is a rabbit, the immunization procedure is as follows: immunization 4 times, with an interval of 14 days between each immunization, using ISA 61 VG adjuvant; the immunization dose is 0.5 mL; When the animal is a mouse, the immunization procedure is as follows: the adjuvant used for the first immunization is Freund's complete adjuvant, and the adjuvant used for subsequent immunizations is ISA 61 VG adjuvant; the immunization dose is 0.2 mL; Preferably, the serum is serum taken 7 days after the last immunization.

[0015] When the animal is a rabbit, the neutralizing antibody titer of its immune serum is 5. 6That is, under a serum dilution of 1:15625, 50% of the experimental cells can be protected from cytopathic effect (CPE); when the animal is a mouse, the neutralizing antibody titer of its immune serum is 5. 5 That is, under the condition of serum dilution ratio of 1:3125, 50% of experimental cells can be protected from CPE.

[0016] A third objective of this invention is to provide a serum containing Akabane virus antibodies prepared using the method described above.

[0017] A fourth objective of this invention is to provide the application of the serum in the preparation of a reagent for the prevention and treatment of Akabane disease.

[0018] The beneficial effects of this invention are: The AKAV_FS202301 strain screened in this invention has the following comprehensive advantages: ① Strong epidemiological adaptability: derived from the latest epidemic cases, it is highly consistent with the current epidemic branch. ② High cell adaptability: it rapidly expands on Vero cells, with a titer reaching 10. 7 TCID 50 / mL. ③ Excellent genetic and antigenic stability: The antigen structure remains stable in continuous amplification and multiple immunological experiments. ④ Excellent adaptability to inactivation method: BEI can completely inactivate the virus while maintaining antigenicity. ⑤ Strong immunogenicity: It can induce high-titer neutralizing antibodies in mice and rabbits. ⑥ Significant viral replication inhibition effect: It can significantly reduce viral RNA copy number, protein expression, and the proportion of infected cells. ⑦ Overall immune effect is superior to existing technologies: Compared with publicly reported existing inactivated vaccines, the vaccine prepared by this invention can achieve higher neutralizing titers and stronger protective effects. Attached Figure Description

[0019] Figure 1 The proliferation characteristics of AKAV in different cells.

[0020] Figure 2 The effect of BEI inactivation on AKAV was detected by qPCR; **** indicates that the expression level of NSs in AKAV after inactivation for different time periods was significantly reduced compared with that before inactivation (p<0.0001).

[0021] Figure 3 The effect of neutralizing antibodies in rabbit immune serum on AKAV virus copy number; *, **, *** indicate that neutralizing antibodies in rabbit immune serum significantly inhibited the expression of NSs gene in AKAV virus (i.e., significantly inhibited AKAV virus copy number) at the levels of p<0.05, p<0.01, and p<0.001.

[0022] Figure 4The effect of neutralizing antibodies in mouse immune serum on AKAV virus copy number; * and *** indicate that neutralizing antibodies in mouse immune serum significantly inhibited the expression of the NSs gene in AKAV virus at the levels of p<0.05 and p<0.001 (i.e., significantly inhibited AKAV virus copy number).

[0023] Figure 5 The results showed that neutralizing antibodies in rabbit immune serum inhibited AKAV virus replication, leading to a decrease in AKAV Gc protein expression.

[0024] Figure 6 The result is that neutralizing antibodies in mouse immune serum inhibit AKAV virus replication, leading to a decrease in AKAV Gc protein expression.

[0025] Figure 7 To verify the inhibition of AKAV virus copies by neutralizing antibodies in rabbit immune serum, IFA staining was performed; scale bar is 100 µm.

[0026] Figure 8 To verify the inhibition of AKAV virus copies by neutralizing antibodies in mouse immune serum, IFA staining was performed; scale bar is 100 µm.

[0027] Figure 9 Phylogenetic analysis based on AKAV S gene sequence. Detailed Implementation

[0028] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0029] The selection criteria and process for using AKAV strains as vaccine strains are as follows: (1) Representative strains derived from the latest epidemiological cases The AKAV_FS202301 strain (GenBank accession number: PQ567128.1) was isolated from actual positive cases in my country in recent years. In the phylogenetic tree (… Figure 9 The AKAV strain clusters with currently prevalent strains in Asia within the same genetic lineage, exhibiting a clear epidemiological advantage and representing the current main prevalence trend of AKAV. Therefore, the AKAV_FS202301 strain is more epidemiologically suitable as a vaccine strain.

[0030] (2) Evaluation of cell proliferation capacity and screening for high fitness With a titer of 10 7 TCID 50 MDBK, Vero, and BHK-21 cells were inoculated with AKAV_FS202301 virus solution at a concentration of / mL to compare viral replication kinetics in different cell lines. TCID assays were performed at 24, 48, 72, and 96 h. 50Measurement. Experimental results ( Figure 1 The results showed that replication was fastest and titers were highest on Vero cells, consistently reaching 10-1. 7 TCID 50 / mL; the replication curve exhibits typical logarithmic growth phase characteristics, with a rapid increase in viral titer within 24–96 h, indicating that this strain is highly adapted to Vero cells; replication is relatively slow and titers are lower on MDBK and BHK-21. These results demonstrate that AKAV_FS202301 exhibits strong adaptability and efficient replication capacity in commonly used vaccine production cell lines, which is beneficial for large-scale vaccine production.

[0031] (3) Screening of virus titer and production performance The virus fluid was harvested multiple times during the culture process, and its titer remained stable at 10. 7 TCID 50 / mL, which is higher than the AKAV titer levels reported in many studies, indicating that AKAV_FS202301 has excellent production performance and is a high-titer strain suitable as a raw material for the preparation of inactivated vaccines.

[0032] (4) Screening for genetic and antigenic structural stability This invention describes the continuous amplification of FS202301 on Vero cells and its application in BEI inactivation, animal immunization, and various immunological experiments. Results show that viral-specific antigens (N and Gc proteins) can be stably recognized by monoclonal antibodies or immune sera: Western blot ( Figure 5 , Figure 6 The Gc protein band was clear and without loss in the IFA ( ) Figure 7 , Figure 8 The fluorescence signal remained stable, and no loss of replication ability or antigenic attenuation was observed during the experiment. Therefore, it can be concluded that AKAV_FS202301 exhibits good genetic and antigenic structural stability throughout the amplification-inactivation-immunization process, meeting the requirements for vaccine strains.

[0033] (5) Screening for inactivation stability and antigen retention ability AKAV virus can be completely inactivated by treating it with 0.002 mol / L BEI at 37°C for 4 h. Figure 2 Compared to existing AKAV, the required inactivation time is significantly reduced. After inactivation, the viral surface antigen can still be recognized by the N protein monoclonal antibody and specific immune serum, and no antigen destruction was detected. Therefore, AKAV_FS202301 has good adaptability to BEI inactivation methods.

[0034] (6) Screening for immunogenicity and protective effect BEI inactivated virus was used to prepare a vaccine via ISA 61VG emulsification. Mice and rabbits were immunized according to an immunization schedule of 0, 14, 28, and 42 days. Blood samples were collected 7 days after the last immunization for virus neutralization experiments, qPCR, Western blotting, and in vitro analyzing (IFA). The results are as follows: ① The titer of neutralizing antibodies increased significantly ( Figure 3 , Figure 4 The neutralizing titer in rabbit serum was up to 1:15625, and the neutralizing titer in mouse serum was up to 1:3125. Both could inhibit AKAV infection of cells and prevent CPE formation.

[0035] ② Significantly inhibits viral replication ( Figure 3 , Figure 4 qPCR results showed that rabbit serum reduced viral RNA copy number by about 85% and mouse serum by about 70%.

[0036] ③Gc protein expression decreased significantly ( Figure 5 , Figure 6 Western blot results showed that the Gc band in the immune serum-treated group was significantly weakened or even disappeared; the expression level in the control group was strong. This indicates that immune serum can effectively block viral replication and protein expression.

[0037] ④ The proportion of infected cells decreased significantly ( Figure 7 , Figure 8 The IFA results showed that the number of fluorescent cells was significantly reduced in the immune serum group, while a large number of strong positive signals appeared in the negative serum group. This indicates that the immune serum can significantly inhibit viral amplification in cells.

[0038] (7) The overall immunization effect is significantly higher than that of the currently available AKAV inactivated vaccine.

[0039] Based on the above results, it can be concluded that the inactivated vaccine prepared by this invention can induce animals to produce neutralizing antibody titers that are significantly higher than those of the existing publicly available AKAV inactivated vaccines, and can significantly inhibit viral replication, indicating that AKAV_FS202301 has significant advantages in terms of immunogenicity and protective effect as a vaccine strain.

[0040] Example 1: Preparation of inactivated vaccine (1) Virus preparation Virus solution was prepared using T75 cell culture dishes. Vero cells were pre-seeded in all T75 cell culture dishes and cultured to approximately 80%–90% confluence. Under this confluence condition, the number of adherent cells in a single T75 cell culture dish is approximately 1 × 10⁻⁶. 7 ~5×10 7 Each T75 cell culture dish was inoculated with 2 mL of virus at a titer of 10. 7 TCID50 The virus solution of Akabane virus was inoculated at a ratio of approximately 2-4 TCID⁻¹ / mL (the "virus solution" refers to the supernatant obtained after the virus has infected cells and the cells have developed typical cytopathic effects (CPE), through repeated freeze-thaw cycles to release virus particles, followed by centrifugation at 12000 r / min to remove cell debris). 50 The ratio of virus to cells was determined to ensure sufficient viral infection and efficient amplification. After 4 days, significant cytopathic effect (CPE) was observed, and the viral fluid was harvested to allow for viral amplification. To compare viral proliferation characteristics in different cell lines, the viral fluid was inoculated into Vero, MDBK, and BHK-21 cells using the same inoculation method. All cell lines were cultured to approximately 80%–90% confluence before inoculation, and the viral inoculation volume, viral titer, and virus-to-cell ratio were kept consistent to ensure comparability of viral replication results across different cell lines. After inoculation, the viral fluid was discarded, and an appropriate amount of maintenance medium (DMEM) was added. Culture was continued, and viral samples were harvested at different time points.

[0041] TCID 50 Detection method: The virus solution to be tested was serially diluted with serum-free DMEM medium, 5 times. 1 ~5 10 After serial dilutions, the cells were added to 8 wells of a pre-prepared 96-well plate containing the corresponding cell lines. Each dilution was added to 8 wells at a time, with 0.1 mL of DMEM medium added to each well. The plates were then incubated at 37°C with 5% CO2. Cytopathic effects were observed after 4 days, and TCID was calculated using the Kärber method. 50 .

[0042] The results showed that AKAV_FS202301 replicated fastest and had the highest titer on Vero cells, consistently reaching 10-1. 7 TCID 50 / mL, the replication curve showed typical logarithmic growth, with the viral titer increasing nearly linearly from 24 h to 96 h, indicating that viral replication was not significantly inhibited and was in a high replication activity phase; while in the BHK-21 and MDBK cell lines, the viral proliferation rate was significantly slower (see Figure 1 The above results indicate that the AKAV_FS202301 strain exhibits strong adaptability and efficient replication in commonly used vaccine production cell lines, which is beneficial for large-scale vaccine production.

[0043] (2) Determination of BEI inactivation effect The BEI inactivator was prepared as follows: BEA (purchased from Shanghai Maclean Biochemical Technology Co., Ltd., catalog number B802635) was added at a mass fraction of 4.1% to a sodium hydroxide solution with a mass fraction of 1.6%, and a cyclization reaction was carried out at 37°C for 1.5 h. During the process, the mixture was stirred with a magnetic stirrer (80 r / min) to ensure that BEA was completely cyclized to generate BEI under alkaline conditions. After the reaction was completed, a 0.2 mol / L BEI inactivator was obtained.

[0044] To a viral titer of 10 7 TCID 50 1% (v / mL) of BEI inactivating agent at a concentration of 0.2 mol / L was added to the virus solution (virus solution harvested from Vero cells in Example 1), resulting in a final BEI concentration of 0.002 mol / L. The solution was then incubated at 37°C with slow, continuous stirring for inactivation. Samples of 5 mL were taken at inactivation times 0 (NC), 1, 2, 3, 4, and 5 h, and 4 μL of 2 mol / L sodium thiosulfate (Na2S2O3) solution was added to each sample to terminate the inactivation reaction. The inactivated virus solution was then inoculated into Vero cells, and quantitative real-time PCR (qPCR) was performed 24 h later to verify the inactivation effect. Specifically, qPCR was performed targeting the NSs gene in the AKAV_FS202301 virus to detect the viral genome copy number. The total volume of the qPCR reaction system was 20 μL, and the composition was as follows: 10 μL of 2×Universal Blue SYBR Green qPCR Master Mix (purchased from Servicebio, catalog number G3326-15), 0.4 μL each of forward and reverse primers, 2 μL of template, and sterile deionized water was added to 20 μL; the sequence of the forward primer was: TAAGACGCCACAACCAAGTGT (SEQ ID NO.1); the sequence of the reverse primer was: CCGAAATGCGATGGAGCGTA (SEQ ID NO.2).

[0045] result( Figure 2 The results showed that inactivation for 1 hour significantly reduced the activity of the AKAV_FS202301 virus, and inactivation for 4 hours completely inactivated the AKAV_FS202301 virus.

[0046] (3) Preliminary assessment of vaccine preparation and adjuvant In the vaccine preparation process, addressing the relatively weak immunogenicity of the inactivated Akabane virus antigen, the immunomodulatory effects of different types of adjuvants were initially screened. Specifically, inactivated AKAV_FS202301 virus was emulsified with Freund's complete adjuvant, aluminum adjuvant, ISA 61 VG adjuvant, and ISA 201 VG adjuvant at a 1:1 volume ratio to prepare inactivated vaccines. Mice were subcutaneously immunized at multiple sites, with each mouse receiving a dose of 0.2 mL. Serum antibody levels in mice were detected before immunization and 14 days after the first immunization using an indirect ELISA method. The results showed that specific antibodies were detected in the serum of mice immunized with vaccines from all adjuvant groups, with the Freund's complete adjuvant group inducing the highest antibody titer (OD). 450 =1.488), followed by the ISA61 VG adjuvant group (OD 450 =1.181), again for the ISA 201 VG adjuvant group (OD 450 =0.728), while the aluminum adjuvant group induced relatively low antibody levels (OD). 450 =0.523). The above results indicate that different adjuvants have different immune initiation capabilities against Akabane virus inactivated antigen during the initial immunization phase, providing experimental basis for the selection of adjuvants in subsequent immunization strategies.

[0047] Example 2: Effect of neutralizing serum on viral replication (1) Based on the above adjuvant screening results, considering that Freund's complete adjuvant has a strong immune-initiating ability in the first immunization, but may cause a strong local inflammatory response under multiple immunization conditions, a staged adjuvant strategy was adopted in subsequent animal immunization experiments. For mouse immunization experiments, Freund's complete adjuvant with strong immunostimulatory ability was selected in the first immunization stage to effectively initiate the body's initial immune response to Akabane virus antigen; in the subsequent booster immunization stage, ISA 61 VG adjuvant with relatively mild immunostimulatory effect and stable antigen sustained-release effect was selected to improve the tolerance and stability of multiple immunizations while ensuring the immune enhancement effect. For rabbit immunization experiments, considering that rabbits are large in size, have a high single injection volume, and have the animal tolerance requirements for multiple immunizations, this invention uses ISA 61 VG adjuvant with relatively mild immunostimulatory effect and widely used in livestock vaccines throughout the rabbit immunization process to ensure the safety and stability of the immune effect of multiple immunizations.

[0048] (2) Based on the above immunization strategy, mice and rabbits were selected as the immunization animals, and subcutaneous injections were performed at multiple sites according to the immunization schedule of 0, 14, 28, and 42 days. Mice were injected with 0.2 mL of inactivated vaccine each time. The first immunization used a vaccine prepared by emulsifying inactivated Akabane virus AKAV_FS202301 with Freund's complete adjuvant, and subsequent immunizations used a vaccine prepared by emulsifying inactivated Akabane virus AKAV_FS202301 with ISA 61 VG adjuvant. Rabbits were injected with 0.5 mL of inactivated vaccine each time. The vaccine used was prepared by emulsifying inactivated Akabane virus AKAV_FS202301 with ISA 61 VG adjuvant. Blood was collected 7 days after the last immunization, and serum was separated according to the standard method for subsequent virus neutralization experiments and immunological detection.

[0049] (3) Virus neutralization assay (VNT): The fixed virus dilution serum method was used. Vero cells were selected for the experiment. When the cells grew to 80% confluence, the virus neutralization assay was started. DMEM medium was used, and serum was serially diluted 5 times. The serum dilution factors were 5, 25, 125, 625, 3125, 15625, 78125, 390625, and 1953125. The virus solution (10 7 TCID 50 ( / mL) Dilute to 100 TCID 50 / mL, take an equal volume of 100 TCID 50 The virus solution was mixed with serum at a concentration of / mL and incubated in EP tubes at 37°C for 1 h. The serum-virus mixture was then added to 200 μL of each well of a 96-well plate confluent with Vero cells. For the negative control, only DMEM medium was added; for the positive control, only 100 TCID45 was added. 50 / mL of virus solution was incubated in a CO2 incubator (37℃, 5% CO2 environment) for 96 h, and cell morphological changes and cytopathic effects (CPE) were observed. Results showed that serum collected from rabbits and mice 7 days after the last immunization had a significant neutralizing effect on the virus, with rabbit serum showing a neutralizing titer of 5. 6 This indicates that the serum, at a dilution of 1:15625, can protect 50% of the experimental cells from CPE; the neutralizing titer of the mouse serum is 5. 5 This indicates that the serum, when diluted 1:3125, can protect 50% of the experimental cells from CPE.

[0050] (4) Real-time quantitative PCR: Serum diluted to different concentrations using DMEM medium (serum dilution factors of 5, 25, 125, 625, 3125, 15625, 78125, 390625, and 1953125) was mixed with AKAV_FS202301 virus solution (100 TCID50). 50After mixing in equal volumes (e.g., 1 / mL), the mixture was incubated at 37°C for 1 h and then used to infect Vero cells. 24 h later, the cells were lysed using TRIzol to extract total RNA, which was then reverse transcribed into cDNA. Finally, the viral genome copy number was detected using quantitative real-time PCR targeting the AKAV_FS202301 virus NSs gene. The total volume of the quantitative real-time PCR reaction system was 20 μL, including 10 μL of SYBR Green I; 0.4 μL each of forward and reverse primers; 2 μL of template; and sterile deionized water to a final volume of 20 μL. The forward primer sequence was TAAGACGCCACAACCAAGTGT (SEQ ID NO.1); the reverse primer sequence was CCGAAATGCGATGGAGCGTA (SEQ ID NO.2). The internal control gene was the GAPDH gene, with the forward primer sequence being GAGAAGGCTGGGGCTCATTT (SEQ ID NO.3); and the reverse primer sequence being AGTGATGGCATGGACTGTGG (SEQ ID NO.4).

[0051] The results showed that, compared with the control group (NC), the immune serum significantly inhibited AKAV replication at multiple dilution concentrations. The inhibitory effect on viral replication gradually weakened with increasing serum dilution, but within the dilution range with neutralizing activity, the viral RNA levels in the immune serum-treated groups were significantly lower than those in the control group. This inhibitory effect was observed in both rabbit and mouse immune serum treatments, and the differences were statistically significant (P < 0.001). Figure 3 , Figure 4 ).

[0052] (5) Western blot: Serum from rabbits and mice that had undergone four immunizations was serially diluted using DMEM medium (serum dilutions were 5, 25, 125, 625, 3125, 15625, 78125, 390625, and 1953125, respectively). The diluted serum was then mixed with an equal volume of virus solution (100 TCID50). 50After mixing ( / mL), the mixture was incubated at 37°C for 1 h. The serum-virus mixture was then added to a 24-well plate filled with Vero cells and cultured at 37°C for 24 h. The DMEM medium was discarded, and the cells were washed twice with PBS. Proteins were extracted from the cells using 1×SDS-PAGE protein loading buffer, followed by protein denaturation (100°C, 10 min), centrifugation for 10 min (12,000 r / min), and homogenization. The protein samples were then added to the sample wells of a gel and electrophoresed (120 V, 30 min). After the bromophenol blue dye reached the edge of the gel, the sample was transferred to a 0.2 μm nitrocellulose membrane (NC membrane) (100 V, 1 h). The membrane was blocked with 5% skim milk powder (1 h). After discarding the skim milk powder, the NC membrane was washed with 1×TBST. AKAV Gc protein monoclonal antibody (laboratory-prepared) was added as the primary antibody and the membrane was incubated overnight at 4°C. The NC membrane was then washed with 1×TBST (5 washes, 5 washes per wash). The mice were incubated with goat anti-mouse secondary antibody (purchased from ProteinTech, catalog number SA00013) for 1 hour, washed again with 1×TBST (washed 5 times, 5 minutes each time), and finally exposed to ECL chemiluminescence solution to detect the expression of Akabane virus Gc protein. The results showed that the expression of Akabane virus Gc protein in mice was significantly reduced. Figure 6 ) and domestic rabbit ( Figure 5 In the neutralizing serum treatment group, Gc protein expression was significantly reduced or absent, while in the control group, expression was significant. This indicates that immune serum can reduce viral protein expression levels by inhibiting viral replication or promoting viral clearance.

[0053] (6) Indirect immunofluorescence (IFA): Neutralizing serum diluted to different concentrations using DMEM medium was mixed with AKAV_FS202301 virus solution (100 TCID50). 50 After mixing equal volumes of the culture supernatant (e.g., * / mL) and incubating at 37°C for 1 h, Vero cells were infected. IFA staining was performed 24 hours later. Specific sample processing methods were as follows: The cell culture supernatant was discarded, and the cells were washed three times with PBS, then fixed with 4% formaldehyde solution for 30 min. Permeabilization was then performed with 0.3% Triton solution for 10 min. Blocking: The cells were blocked with 5% BSA (blocking solution) at room temperature for 1 h. The blocking solution was then discarded, and monoclonal antibody against Akabane virus N protein (laboratory-prepared) was added. The cells were incubated overnight at 4°C (protected from light). Then, FITC-labeled fluorescent secondary antibody (purchased from Proteintech, catalog number SA00013) was added, and the cells were incubated at 37°C for 1 h. After incubation, the antibody was discarded, and the cells were washed three times with PBST and observed under an inverted fluorescence microscope.

[0054] The results showed that rabbits ( Figure 7 ) and mice ( Figure 8The proportion of virus-positive cells in the immune serum treatment group was significantly reduced, and the fluorescence signal was significantly weakened, indicating that viral replication was inhibited; while a large number of strongly positive fluorescent cells appeared in the unimmunized control serum group.

[0055] The above results fully demonstrate that AKAV_FS202301 is an excellent strain suitable for the production of Akabane virus inactivated vaccines. The technical route of this invention is scientific, safe, and stable, and has prospects for industrial application.

Claims

1. A Akabane virus vaccine, characterized in that, It contains inactivated Akabane virus strain AKAV_FS202301 and adjuvant.

2. The Akabane virus vaccine according to claim 1, characterized in that, The adjuvant is Freund's complete adjuvant or ISA 61 VG adjuvant.

3. The Akabane virus vaccine according to claim 2, characterized in that, Its preparation method includes the following steps: S1. To a viral titer of 10 7 TCID 50 Add 1% (v / mL) of BEI inactivating agent at a concentration of 0.2 mol / L to the AKAV_FS202301 virus solution, stir at 37℃ for more than 4 h, and then add 2 mol / L sodium thiosulfate solution to terminate the inactivation reaction to obtain the inactivated Akabane virus strain AKAV_FS202301. S2. The inactivated Akabane virus strain AKAV_FS202301 is emulsified with Freund's complete adjuvant or ISA 61 VG adjuvant at a volume ratio of 1:1 to obtain the Akabane virus vaccine.

4. The Akabane virus vaccine according to claim 3, characterized in that, The preparation method of the AKAV_FS202301 virus solution is as follows: Vero cells are infected with Akabane virus strain AKAV_FS202301 until the disease effect is observed. Virus particles are released by repeated freeze-thaw cycles. Cell debris is removed by centrifugation at 12000 r / min. The resulting supernatant is the AKAV_FS202301 virus solution.

5. The Akabane virus vaccine according to claim 3, characterized in that, The preparation method of the BEI inactivator is as follows: 4.1% BEA by mass is dissolved in a 1.6% sodium hydroxide solution by mass, and cyclized at 37°C for 1.5 h, with vigorous shaking for 10 s every 15 min during the process. After the reaction is completed, a 0.2 mol / L BEI inactivator is obtained.

6. A method for preparing serum containing Akabane virus antibodies, characterized in that, Includes the following steps: S1. Immunizing animals with the Akabane virus vaccine according to any one of claims 1 to 5; S2. Isolate the serum of immunized animals.

7. The method according to claim 6, characterized in that, When the animal is a rabbit, the immunization procedure is as follows: immunize 4 times, with an interval of 14 days between each immunization, using ISA 61 VG adjuvant; the immunization dose is 0.5 mL. When the animal is a mouse, the immunization procedure is as follows: the adjuvant used for the first immunization is Freund's complete adjuvant, and the adjuvant used for subsequent immunizations is ISA 61 VG adjuvant; the immunization dose is 0.2 mL.

8. The method according to claim 6, characterized in that, The serum mentioned is the serum taken 7 days after the last immunization.

9. A serum containing Akabane virus antibodies prepared by the method according to claims 6-8.

10. The use of the serum according to claim 9 in the preparation of a reagent for preventing and treating Akabane disease.

Citation Information

Patent Citations

  • Cow akabane immunogenic antigen and vaccine

    CN114989269A

  • Acamovirus vaccine strain and application thereof

    CN115141812A

  • Akabane virus positive serum and preparation method thereof

    CN117100849A

  • Application of vinetura-199 in preparation of medicine for preventing and treating akabane virus

    CN119499259A

  • Preparation method of akabane virus inactivated vaccine

    CN120733019A