Fusarium oxysporum mitochondrial inner membrane mdm33 protein and applications thereof

Abstract

The application belongs to the field of agricultural biotechnology, and particularly relates to a Fusarium oxysporum mitochondrial inner membrane MDM33 protein and application thereof. FoMDM33 and The gene is related to Fusarium oxysporum pathogenicity, and knocking out the gene can cause the Fusarium oxysporum infection ability to be reduced; the combination with the FOMDM33 protein can cause the FOMDM33 protein to be degraded, so that the pathogenic bacteria are inhibited from causing harm to plants. The gene and the protein can be used for plant pathogenic fungal disease prevention and control research and pesticide development.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology, specifically, it relates to the MDM33 protein of the inner mitochondrial membrane of Fusarium oxysporum and its application. Background Technology

[0002] Fusarium oxysporum ( Fusarium oxysporum Fusarium oxysporum is a globally distributed soil-borne fungus with extremely strong survival ability and host adaptability, posing a serious threat to agricultural production and human health. This pathogen has a wide host range, infecting more than 1,000 plant species, including cucurbits, solanaceae, legumes, cotton, bananas, and flowers, causing diseases such as wilt and root rot. Notably, Fusarium oxysporum can not only harm plants but also cause fusarium disease in humans, leading to severe conditions such as pneumonia and keratitis. Because Fusarium oxysporum can survive in soil for 5–10 years, and chemical agents have difficulty penetrating the vascular bundles, its control is challenging. Currently, the long-term reliance on single-target chemical control strategies has led to the rapid development of drug resistance in the pathogen, significantly reducing the effectiveness of existing fungicides. Therefore, it is urgent to identify new key pathogenic factors or growth and development regulators to provide potential molecular targets for developing novel fungicides with high efficacy and low risk of resistance.

[0003] The main bottleneck in current pesticide research and development lies in the severe shortage of available specific targets. Statistics show that among the 862 registered pesticides globally, fungicides, insecticides, and herbicides correspond to only 52, 26, and 20 molecular targets, respectively. Traditional broad-spectrum chemical pesticides not only suffer from low utilization rates—approximately 99% of applied pesticides fail to act on target organisms—but also pose potential threats to the ecological environment and human health. Against the backdrop of increasingly prominent demands for green agricultural development and ecological security, the development of novel control strategies with high efficiency, low dosage, high selectivity, low cost, and environmental friendliness is imperative. Target identification and molecular design research can effectively expand the available target library, providing new insights into solving the problem of pesticide resistance. By analyzing the three-dimensional structural information of target protein-small molecule complexes, not only can the rational design of targeted fungicides be promoted, but also the deep integration of pesticide receptor structural biology and green pesticide research and development will be advanced. This target-oriented pesticide innovation strategy not only meets the major needs of my country's green agricultural development but also provides a new solution for the sustainable management of plant diseases globally. Summary of the Invention

[0004] The mitochondrial inner membrane protein MDM33 is found only in fungi, and its homologs have not yet been found in mammals. It plays a crucial role in mitochondrial function. This invention, through long-term research, has obtained a mitochondrial inner membrane gene (named...) from Fusarium oxysporum. FoMDM33The discovery that it is related to the pathogenicity of Fusarium oxysporum provides important data for a comprehensive understanding of the pathogenic mechanism of Fusarium oxysporum, and for the prevention and control of diseases caused by Fusarium oxysporum and the development of fungicides. Thus, this invention was completed.

[0005] The technical solution of the present invention is as follows: In a first aspect, the present invention provides a Fusarium oxysporum mitochondrial inner membrane protein, which is derived from Fusarium oxysporum and is named FoMDM33 in the present invention. The nucleotide sequence of the protein gene is shown in SEQ ID NO:1, the CDS sequence is shown in SEQ ID NO:2, and the encoded amino acid sequence is shown in SEQ ID NO:3.

[0006] In a second aspect, the present invention provides FoMDM33 The applications of this gene include: regulating the pathogenicity of *Fusarium oxysporum* and regulating its sensitivity to imidazole fungicides. Regulating the pathogenicity of *Fusarium oxysporum* can be used to study the infection mechanisms and interactions between *Fusarium oxysporum* infection and plants.

[0007] In one embodiment, the application is to modulate the sensitivity of Fusarium oxysporum to imidazole fungicides.

[0008] In one embodiment, the application is to modulate the sensitivity of Fusarium oxysporum to thioconazole and imazalil.

[0009] In one embodiment, FoMDM33 Gene overexpression increases the susceptibility of Fusarium oxysporum to imidazole fungicides; knockout FoMDM33 gene The infectivity of Fusarium oxysporum is reduced.

[0010] In one embodiment, gene editing or homologous recombination can be used to... FoMDM33 Gene knockout or gene silencing can be used to obtain transgenic Fusarium oxysporum, which has reduced pathogenicity.

[0011] In a third aspect of the invention, the FoMDM33 protein is used to design and screen drugs against plant fungal diseases; preferably, the fungal disease is caused by Fusarium oxysporum infection. Preferably, the drug is an imidazole drug.

[0012] In one embodiment, the present invention discloses an application of FoMDM33 protein in the design and screening of imidazole drugs against Fusarium oxysporum, wherein the drug targets FoMDM33 protein, binds to FoMDM33 protein, and thereby inhibits Fusarium oxysporum infection. Beneficial effects

[0013] (1) This invention has discovered the mitochondrial inner membrane gene derived from Fusarium oxysporum. FoMDM33 It can regulate the pathogenicity of Fusarium oxysporum.

[0014] (2) This invention found that binding to the FoMDM33 protein can degrade the FoMDM33 protein, thereby inhibiting the harm of pathogens to plants. Therefore, MDM33 can serve as a fungicide target and a key protein in the pathogenic mechanism of diseases, and has broad application prospects in the research on the prevention and control of plant pathogenic fungal diseases and the development of pesticides. Attached Figure Description

[0015] Figure 1 This is a diagram showing the colony growth of wild-type Fol4287 and ΔFoMDM33 mutant of *Fusarium oxysporum*, a tomato-specific strain of this invention, on PDA plates. Figure 2 The results of pathogenicity assays of wild-type Fol4287 and ΔFoMDM33 mutants of Fusarium oxysporum, a tomato-specific strain of this invention, on tomato seedlings are presented. Figure 3 Colony diagrams showing the susceptibility of the wild-type Fol4287 and ΔFoMDM33 mutants of *Fusarium oxysporum*, a tomato-specific strain of this invention, to thioconazole, prochloraz, and iprodione. Figure 4 The images show the mitochondrial morphology of the wild-type Fol4287 and ΔFoMDM33 mutants of the tomato-specific Fusarium oxysporum of this invention. Figure 5 The present invention provides that imazalil can promote the degradation of FoMDM33 protein; Figure 6 The present invention provides that imazalil binds to FoMDM33 protein to promote the thermal stability of FoMDM33 protein; Figure 7 The present invention aims to enhance the resistance of FoMDM33 to protease hydrolysis by binding imazalil to the FoMDM33 protein. Detailed Implementation

[0016] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and experimental examples are commercially available. Unless otherwise stated, all reagents used in this invention are analytical grade reagents. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0017] Material source: The wild-type Fusarium oxysporum strain Fol4287 used in this invention was provided by the Fungal Laboratory of Qingdao Agricultural University. This strain... FoMDM33The genomic DNA sequence of the gene is shown in SEQ ID NO:1, the CDS sequence is shown in SEQ ID NO:2, and the amino acid sequence of the FoMDM33 protein encoded by the gene is shown in SEQ ID NO:3. Based on sequence alignment, the gene should belong to the mitochondrial inner membrane gene.

[0018] Example 1: Obtaining the Fusarium oxysporum gene knockout mutant ΔFoMDM33 1.1 Construction of the FoMDM33 knockout mutant of Fusarium oxysporum

[0019] Obtained through analysis and testing FoMDM33 gene The relevant information indicates that the gene coding sequence (CDS) is 1464 bp long, as shown in SEQ ID NO:2; it encodes 484 amino acids, as shown in SEQ ID NO:3. Approximately 700 bp upstream and downstream of the FoMDM33 coding region were selected. Using Fusarium oxysporum Fo as a template, homologous arm fragments were obtained by PCR amplification using primers FoMDM33-up-F / FoMDM33-up-R and FoMDM33-down-F / FoMDM33-down-R, respectively. Using the vector PKOV21 as a template, a 1349 bp fragment of the hygromycin phosphotransferase gene (HPH) was amplified. Then, using the FoMDM33 upper and lower homologous arm fragments and the hygromycin phosphotransferase (HPH) gene fragment obtained in the previous step as templates, the HPH fragment was sequentially ligated to the upper and lower homologous arms via overlap PCR. The primers used were FoMDM33-HY-R and FoMDM33-YG-F, resulting in a UP / HY-HPH-YG / DOWN fusion fragment of approximately 2836 bp, which can be used for gene knockout. The primer sequences are shown below: FoMDM33up-F: TGTCCAGCATCTCAACGA (SEQ ID NO:4) FoMDM33up-R:AAGGTGAGTAAGGCGGTGA (SEQ ID NO:5) FoMDM33-down-F: TGGAGTGGGACTAAACCTTT (SEQ ID NO: 6) FoMDM33-down-R:ACTCTCAGGTATGGTTGTCTCA (SEQ ID NO:7) FoMDM33-HY-R: AGGTCGCCAACATCTTCTT (SEQ ID NO:8) FoMDM33-YG-F:ACCTGCCTGAAACCGAACT (SEQ ID NO:9)

[0020] 1.2 Obtaining the FoMDM33 knockout mutant of Fusarium oxysporum

[0021] Using PEG-mediated protoplast transformation technology FoMDM33 gene Knockout was performed. Spores of wild-type Fusarium oxysporum Fol4287, cultured for approximately 5-7 days, were collected, filtered, and added to a 100 mL YEPD Erlenmeyer flask. The flask was incubated at 25°C with shaking at 180 rpm for 14-20 h. Fresh mycelia were collected and washed three times with KCl buffer. The mycelia were then transferred to Lysing enzyme solution and incubated at 30°C with shaking at 120 rpm for 2-3 h. The digestion product was filtered into a new 50 mL centrifuge tube and centrifuged at 10°C, 5000 rpm for 10 min. The supernatant was discarded, and the flask was washed twice with ice-cold KCl buffer. The precipitate was resuspended in 1 mL STC buffer and centrifuged at 10°C, 5000 rpm for 2 min. The supernatant was discarded, and the precipitate was resuspended in 800 μL of STC buffer. 200 μL of SPTC solution was added, and the mixture was inverted to mix. 60-120 μL of the target gene and 5 μL of 5 mM [a specific enzyme] were added. Spermine solution was gently inverted several times to mix thoroughly; it was placed on ice for 30 min; 500 μL SPTC solution was added, and the mixture was placed at 25°C in the dark for 20 min; the above mixture was added to an Erlenmeyer flask containing 20 mL RMbuffer; it was incubated overnight at 25°C with shaking at 120 rpm in the dark; the well-computed mycelia were added to 100 mL of PDA medium with the corresponding antibiotic at a suitable temperature, mixed well, and poured into 9 mm diameter petri dishes; it was incubated upside down at 25°C for 3-4 days. After single colonies grew on the surface of the plate, a small amount of mycelial fragments were transferred to PDA plates containing the same antibiotic for further verification. Single colonies were picked from the plate and inoculated onto new PDA plates containing hygromycin, which were then identified as positive transformants. The genome of the transformants was extracted, and the target gene in the transformants was verified by PCR. FoMDM33 The presence of the target gene, which was detected in the wild-type strain Fol4287, while a band indicating homologous substitution was detected in the transformant, suggests that... FoMDM33 Gene knockout was successful.

[0022] Example 2: Growth, development, and pathogenicity analysis of Fusarium oxysporum FoMDM33 deletion strain

[0023] The screened transformants were cultured on antibiotic-free PDA medium, and the colony growth of the transformants was observed and statistically analyzed. The results are as follows: Figure 1As shown: Cultured for 3 days, wild type (Fol4287) FoMDM33 Deletion strain ( ΔFoMDM33 )compared to, ΔFoMDM33 The colony diameter is smaller than that of Fol4287.

[0024] Various strains of *Fusarium oxysporum* were cultured on antibiotic-free PDA medium for approximately 7 days, and conidia were collected. Tomato seedlings were placed in a prepared conidia suspension, inoculated, and then placed in an incubator. After 14 days of incubation at 25°C with humidity, photographs were taken and the disease incidence was recorded. Specific results are as follows: Figure 2 As shown. Fol4287 caused wilting symptoms in tomato seedlings. Knockout transformants... ΔFoMDM33 The infected seedlings showed significantly weaker wilting symptoms than the wild type, indicating that knockout... FoMDM33 After gene modification, the pathogenicity of Fusarium oxysporum was significantly suppressed.

[0025] Wild-type Fusarium oxysporum (WT) and the knockout mutant ΔMDM33 were inoculated onto PDA medium containing different fungicides: thioconazole (0.5, 1 μg / mL), prochloraz (0.025, 0.05 μg / mL), and iprodione (0.5, 1 μg / mL). The cultures were incubated in the dark at 25°C. Colony diameter was measured using the cross-crossing method after 4 days, and colony morphology was observed. Each treatment was replicated in triplicate. Results are as follows: Figure 3 The colony morphology and inhibition rate statistics show that thioconazole nitrate and prochloraz significantly inhibited Fusarium oxysporum wild-type bacteria more effectively than the knockout mutant ΔFoMDM33, indicating that... FoMDM33 The gene knockout reduced the strain's sensitivity to thioconazole and imazalil, but did not change its sensitivity to iprodione.

[0026] Wild-type *Fusarium oxysporum* (WT) and the knockout mutant ΔFoMDM33 were inoculated onto PDA medium and cultured in the dark at 25°C. Conidia were harvested after 7 days and allowed to germinate. Mitochondrial morphology was observed using Mito-tracker staining. Each treatment was performed in triplicate. Results are as follows: Figure 4 As shown, wild-type mitochondria are filamentous, while the knockout mutant mitochondria are enlarged and ring-shaped, indicating that... FoMDM33 Gene knockout alters the structure of mitochondria.

[0027] Example 3: Obtaining Fusarium oxysporum FoMDM33 overexpression strain

[0028] Constructing a replenishment carrier First, the vector pYF11-GFP was linearized using the restriction endonuclease XhoⅠ, following the instructions in the NEB manual. Using Guy11 genomic DNA as a template, primers were then applied... A 4500 bp FoMDM33 fragment was amplified. The vector was transformed into the corresponding knockout mutant using PEG-mediated protoplast transformation, and complement transformants were initially screened using bleomycin. Subsequently, complement transformants were further identified by combining antibiotic resistance, GFP fluorescent tag, and related phenotypes.

[0029] : TTTCGTAGGAACCCAATCTTCAAATGCAGCCGTTTGCTCGT (SEQ IDNO: 10) : CACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACGCAGCGCAATACTTCCTGT (SEQ ID NO: 11)

[0030] Example 4: Test of FoMDM33 Degradation Promoted by Imazalil

[0031] Will FoMDM33 The overexpressing strain was cultured on PDA plates for 7 days, and conidia were collected. The collected spores were then placed on liquid YEPD medium and cultured on a shaker at 25°C and 120 rpm for 48 hours. The germinated spores were divided into two equal portions; one portion was added to DMSO, and the other to prochloraz. Both portions were cultured for another 4 hours. Protein was then extracted and analyzed by Western blot using a GFP antibody. The results are shown below. Figure 5 As shown, the FoMDM33 of the FoMDM33-GFP strain with added prochloraz was degraded, while the FoMDM33 of the FoMDM33-GFP strain with added DMSO was not degraded.

[0032] Example 5: Imazalil can bind to FoMDM33.

[0033] 5.1 CETSA verified that prochloraz can bind to FoMDM33. Will FoMDM33 The overexpressing strain was cultured on PDA plates for 7 days, and conidia were collected. The collected spores were then placed on liquid YEPD medium and cultured on a shaker at 25°C and 120 rpm for 48 hours. The germinated spores were divided into 10 equal portions; 5 portions were added to DMSO, and the other 5 portions were added to prochloraz. DMSO and prochloraz were then incubated at different temperatures (46°C, 50°C, 54°C, 58°C, 62°C, 66°C, 70°C) for another 4 hours each. Protein was then extracted and analyzed by Western blot. Results are as follows: Figure 6As shown, the amount of FoMDM33 in the DMSO group gradually decreased with increasing temperature. Iprodione can increase the stability of FoMDM33 by forming a ligand-protein complex, and the decrease in FoMDM33 protein level was less than that in the DMSO group. It was found that within the tested temperature range (46-70℃), it significantly increased the heat tolerance of FoMDM33. The results indicate that, compared to the control group, imidacloprid increases the stability of FoMDM33 with increasing temperature. These results further confirm that imidacloprid can directly target and bind to the FoMDM33 protein.

[0034] 5.2 DARTS verified that imazalil can bind to FoMDM33. To further confirm whether FoMDM33 is the direct target of imazalil, validation analysis using DARTS was performed. The results are as follows: Figure 7 As shown, after incubation of Fusarium oxysporum total protein with DMSO and 4 µg / mL prochloraz, and hydrolysis with different concentrations of streptoprotein E (0.25 mg / mL, 0.5 mg / mL, 1 mg / mL), the FoMDM33 protein treated with DMSO showed significant degradation with increasing streptoprotein E concentration, while the FoMDM33 protein level treated with prochloraz decreased with increasing streptoprotein E concentration, and its protein level was significantly lower than that of the DMSO control group. This effect was also shown to be dose-dependent. These results confirm that prochloraz can directly target and bind to the FoMDM33 protein.

[0035] The above description, in conjunction with specific embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection defined by the claims submitted herein.

Claims

1. A kind FoMDM33 The application of genes is characterized by, The application is to regulate the pathogenicity of Fusarium oxysporum. FoMDM33 The gene nucleotide sequence is shown in SEQ ID NO:1, the CDS sequence is shown in SEQ ID NO:2, and the encoded amino acid sequence is shown in SEQ ID NO:

3.

2. A kind FoMDM33 The application of genes is characterized by, The application is as follows: to regulate the sensitivity of Fusarium oxysporum to thioconazole and prochloraz, knocking out this gene reduces the sensitivity of Fusarium oxysporum to thioconazole and prochloraz. FoMDM33 The gene nucleotide sequence is shown in SEQ ID NO:1, the CDS sequence is shown in SEQ ID NO:2, and the encoded amino acid sequence is shown in SEQ ID NO:

3.

3. The application of FoMDM33 protein in the design and screening of drugs against plant fungal diseases, characterized in that, The fungal disease is caused by Fusarium oxysporum infection; the drug is an imidazole drug that targets the FoMDM33 protein, binds to the FoMDM33 protein, and thereby inhibits Fusarium oxysporum infection; the amino acid sequence of the FoMDM33 protein is shown in SEQ ID NO:3.

Images