Aureobasidium sp. Strain ZX033 for producing fumaric acid and gluconic acid and application of Aureobasidium sp. Strain ZX033

By knocking out the GOX gene and optimizing fermentation conditions in the Rhizopus strain ZX033, the problem of low efficiency in the production of fumaric acid and gluconic acid by Rhizopus strains in the existing technology was solved, achieving efficient carbon source redirection and yield improvement, which is suitable for industrial production.

CN121574835APending Publication Date: 2026-02-27SOUTHWEST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511992604.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-26
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

In the existing technology, the use of Rhizopus strains for the production of fumaric acid and gluconic acid has problems such as slow growth rate, long fermentation cycle, many organic acid by-products, high cost of separation and purification of target products, and difficulty in controlling the fermentation process. In addition, non-Rhizopus yeasts are not efficient in modifying the fumaric acid synthesis pathway.

Method used

The glucose oxidase (GOX) gene of the Bruxelles strain ZX033 was knocked out using gene editing technology to construct the genetically engineered strain ZX033-ΔGOX. Carbon metabolic flux was redirected to improve fumarate synthesis efficiency. The GOX knockout vector was transferred into the strain via PEG-mediated transformation, and the fermentation medium conditions were optimized.

Benefits of technology

This method enables a more efficient channeling of carbon sources to the fumaric acid synthesis pathway, simplifies cultivation conditions, makes it suitable for industrial fermentation production, and improves the yield and production efficiency of fumaric acid and gluconic acid.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121574835A_ABST
    Figure CN121574835A_ABST
Patent Text Reader

Abstract

The invention discloses an aureobasidium sp. Strain ZX033 for producing fumaric acid and gluconic acid and application of the aureobasidium sp. Strain ZX033. The preservation number of the aureobasidium sp. Strain ZX033 is CCTCC M 20252559. The invention also provides a separation and identification method of the strain. The ITS sequence and the LSU sequence of the strain are respectively shown as SEQ ID NO.1 and SEQ ID NO.2. Experiments prove that the strain can simultaneously produce fumaric acid and gluconic acid through fermentation. Furthermore, a glucose oxidase (GOX) gene of the ZX033 strain is successfully knocked out through a genetic engineering means, and an engineering strain ZX033-delta GOX is constructed. The fumaric acid production capacity of the engineering strain is remarkably improved, compared with an original strain, the yield in a specific culture medium can be improved by 28.7% or above, and the engineering strain has better industrial application potential. The invention provides a new strain resource and a fermentation process for efficiently producing fumaric acid and gluconic acid.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a short-strain styrax strain ZX033 that produces fumaric acid and gluconic acid, and also to the application of this strain. Background Technology

[0002] Fumaric acid, also known as fumaric acid, is an important four-carbon platform compound and is listed by the U.S. Department of Energy as one of the most valuable bio-based chemicals. It has a wide range of applications, including as an acidity regulator in the food industry, in the production of unsaturated polyester resins in the chemical industry, and as a synthetic raw material in the pharmaceutical field. Gluconic acid is also an organic acid with significant applications, and there is strong demand in the food, pharmaceutical, and construction industries. Currently, the industrial production of fumaric acid still mainly relies on petroleum-based chemical synthesis methods, such as the maleic anhydride isomerization method. However, chemical synthesis methods not only consume non-renewable fossil resources but also pose environmental risks, limiting the application of fumaric acid in food, pharmaceutical, and other fields with high requirements for raw material cleanliness.

[0003] The production of fumaric acid from renewable biomass resources using microbial fermentation has become a research hotspot. Currently, research on fumaric acid production via fermentation mainly focuses on filamentous fungi, particularly Rhizopus species such as *Rhizopus oryzae* and *Rhizopus arrhizus*. However, Rhizopus strains used as production strains have some inherent drawbacks: relatively slow growth rates and long fermentation cycles; and the production of various organic acid byproducts such as malic acid and lactic acid during fermentation, leading to high selectivity and final purification costs for the target product, fumaric acid. Furthermore, the complex morphological regulation of filamentous fungi and the rheological challenges they face in large-scale fermenters also increase the difficulty of process control.

[0004] To address these challenges, researchers have attempted to develop non-Rhizopus microbial cell factories. Some unconventional yeasts have attracted attention due to their strong environmental robustness, simple nutritional requirements, and increasingly sophisticated genetic manipulation tools. However, modifying these yeasts for the production of fumaric acid and gluconic acid still faces challenges, such as the lack of efficient fumaric acid synthesis pathways. Previous studies have attempted to heterologously express enzyme genes related to the fumaric acid synthesis pathway in *Pichia pastoris* or *Pichia stylosa*, but the yields are still significantly lower than those of *Rhizopus*.

[0005] The genus *Aureobasidium* spp. produces a variety of valuable metabolites, such as pullulan and polymalic acid. In recent years, strains of this genus have also been found to have the potential to produce organic acids, including fumaric acid. However, there are relatively few reports on fumaric acid production by *Aureobasidium* strains. Within this genus, *Aureobasidium castaneae* has the potential to produce fumaric acid and gluconic acid, but there are no reports or systematic studies on this topic.

[0006] Metabolic engineering is a powerful tool in strategies to increase the yield of target products. By using gene editing technologies such as the CRISPR / Cas9 system to target and modify the metabolic network of industrial strains, performance can be significantly improved. In systems that co-produce fumarate and gluconic acid, glucose oxidase (GOX) is the key enzyme catalyzing the oxidation of glucose to gluconic acid. If the focus is more on high fumarate production, knocking out the GOX gene is expected to reduce the diversion of carbon sources to gluconic acid, thereby directing carbon sources more efficiently to the fumarate synthesis pathway. Summary of the Invention

[0007] In view of this, one objective of the present invention is to provide a *Aureobasidium castaneae* strain ZX033 that produces fumaric acid and gluconic acid; a second objective of the present invention is to provide the application of the *Aureobasidium castaneae* strain ZX033 in the production of fumaric acid and / or gluconic acid; a third objective of the present invention is to provide a method for producing fumaric acid and / or gluconic acid; a fourth objective of the present invention is to provide a genetically engineered strain of *Aureobasidium castaneae* strain ZX033, namely ZX033-ΔGOX; and a fifth objective of the present invention is to provide the application of the genetically engineered strain ZX033-ΔGOX in the production of fumaric acid.

[0008] To achieve the above objectives, the present invention provides the following technical solution: 1. A short-stemmed fungus strain (Aureobasidium castaneae) ZX033 producing fumaric acid and gluconic acid, wherein the short-stemmed fungus strain ZX033 is deposited at the China Center for Type Culture Collection, with accession number CCTCC M20252559.

[0009] 2. Application of the aforementioned short-stalked dermal strain ZX033 in the production of fumaric acid and / or gluconic acid.

[0010] 3. A method for producing fumaric acid and / or gluconic acid, obtained by fermentation using the aforementioned *Synthia spp.* strain ZX033.

[0011] 4. The genetically engineered strain ZX033-ΔGOX of the short-skinned pufferfish strain ZX033, wherein the strain ZX033-ΔGOX is a short-skinned pufferfish strain ZX033 with the glucose oxidase gene GOX knocked out, and the nucleic acid sequence of the glucose oxidase gene GOX is shown in SEQ ID NO.3.

[0012] The preferred method of knocking out the glucose oxidase gene GOX in the *Bacillus brevis* strain ZX033 is to construct a gene GOX knockout vector, then transform the knockout vector into *Bacillus brevis* ZX033 via PEG-mediated transformation, and after culturing, screen transformants to obtain the engineered strain ZX033-ΔGOX.

[0013] Preferably, the method for constructing the GOX gene knockout vector is to amplify the upstream homologous arm sequence SEQ ID NO.5 and the downstream homologous arm sequence SEQ ID NO.6 of the GOX gene, as well as the hygromycin resistance marker expression cassette sequence SEQ ID NO.4, and fuse the three to obtain the GOX gene knockout vector.

[0014] 5. Application of the genetically engineered strain ZX033-ΔGOX in the production of fumaric acid.

[0015] The beneficial effects of this invention are as follows: This invention provides a *Bacillus brevis* strain ZX033 isolated from mangrove leaves, capable of producing fumaric acid and gluconic acid. The *Bacillus brevis* strain obtained by this invention has simple cultivation conditions, is suitable for industrial fermentation production, and has excellent development and application prospects. Knocking out the GOX gene in ZX033, the engineered strain ZX033-ΔGOX achieves the redirection of carbon metabolic flux, enabling carbon sources to be more effectively directed to the fumaric acid synthesis pathway, which is of great significance for the industrial production of fumaric acid.

[0016] strain preservation In this invention, ZX033 was isolated from leaves of mangroves in Sanya, Hainan; it was deposited at the China Center for Type Culture Collection (CCTCC M 20252559), located at Wuhan University, Wuhan, Hubei Province, China, on November 17, 2025, and classified as Aureobasidium castaneae. Attached Figure Description

[0017] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration: Figure 1 This is a colony morphology diagram of ZX033 on YPD agar medium; Figure 2 Image of ZX033 methylene blue stained; Figure 3Phylogenetic tree based on ZX033 ITS sequence; Figure 4 Phylogenetic tree based on the ZX033 LSU sequence; Figure 5 The figure shows the fermentation results of ZX033 under different nitrogen source concentrations; Figure 6 The fermentation results of ZX033 with and without the addition of corn steep liquor and citric acid are shown in the figure. Figure 7 The image shows the sequencing alignment results of the ZX033-ΔGOX gene knockout. Figure 8 The figure shows the fermentation results of three culture media: ZX033 and ZX033-ΔGOX. Detailed Implementation

[0018] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0019] Preparation of the culture medium for this invention: YPD liquid culture medium preparation: Weigh 20 g / L glucose, 10 g / L yeast extract, and 20 g / L peptone, add 1 L of water to dissolve completely, dispense into Erlenmeyer flasks, sterilize at 121℃ for 20 min, and cool before use.

[0020] To prepare the seed culture medium, weigh out 60 g / L glucose, 2.7 g / L NH4Cl, 4.2 g / L KNO3, 0.1 g / L KH2PO4, 0.1 g / L MgSO4, 0.178 g / L ZnSO4·7H2O, 0.5 g / L KCl, 1 g / L corn steep liquor, and 20 g / L CaCO3. Add water to a final volume of 1 L, stir thoroughly to dissolve, dispense into Erlenmeyer flasks, autoclave at 121℃ for 20 minutes, and cool before use.

[0021] To prepare the fermentation medium, weigh out 90 g / L glucose, 1.35 g / L NH4Cl, 2.1 g / L KNO3, 0.1 g / L KH2PO4, 0.1 g / L MgSO4, 0.178 g / L ZnSO4·7H2O, 0.5 g / L KCl, 0.5 g / L corn steep liquor, 1 g / L citric acid monohydrate, and 30 g / L CaCO3. Add water to bring the volume to 1 L, stir thoroughly to dissolve, dispense into Erlenmeyer flasks, autoclave at 121℃ for 20 minutes, and cool before use.

[0022] Example 1 1) Isolation and purification of *Brachystomata* The sample used for separation was plant leaves. Using scissors sterilized with 75% alcohol (by volume), the inner or central portion of the leaf was cut to 0.5 cm in a clean bench. 2 Collect tissue blocks of varying sizes. Transfer the excised tissue blocks into an Erlenmeyer flask containing sterile physiological saline and shake for 20 min. Then, transfer the liquid to an Erlenmeyer flask containing YPD liquid medium, add filtered and sterilized chloramphenicol to a final concentration of 0.01%, and incubate at 220 rpm and 25°C until the liquid becomes turbid. Dilute the turbid liquid proportionally, and spread 100 µL evenly onto pre-prepared YPD agar medium. Incubate in an inverted oven at 25°C for 2–4 days, observing colony growth regularly. Streak and purify the grown colonies as needed until single colonies are isolated.

[0023] 2) Morphological observation of short-stalked mold The isolated and purified bacterial strain was streaked onto YPD agar medium and incubated upside down at 30°C for 7 days. The colony morphology of the strain was observed, and the results are shown in the attached figure. Figure 1 As shown: The strain grows well on YPD agar medium, appearing light yellow, convex upwards, moist, spreading towards the edge, producing hyphae, and easily picked up; methylene blue stained cells are spindle-shaped. Figure 2 ).

[0024] 3) Molecular biological identification of ZX033 The isolated and purified strain was analyzed for ITS and LSU sequences (see SEQ ID NO.1 and SEQ ID NO.2) and identified as *Aureobasidium castaneae*, named *Aureobasidium castaneae* ZX033. ZX033 was isolated from mangrove leaves and showed 100% homology with *Aureobasidium castanea* accession number CFCC 54591 in GenBank. Based on the ITS sequences of 14 strains and 1 outgroup strain with similar species at the genus level, and the LSU sequences of 11 strains and 1 outgroup strain with similar species at the genus level, a phylogenetic tree of the ITS sequences was constructed using the Maximum Likelihood (ML) method with MEGA11 software. Figure 3 ) and LSU sequence phylogenetic tree ( Figure 4 The results confirmed that its classification was Aureobasidium castaneae, specifically Aureobasidium castaneae ZX033.

[0025] The ITS sequence is as follows: SEQ ID NO.1: TCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAGTAAGGGTGCTCGCCGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGCTCGGTCTCGAGCCGCAGGGGCTTCGGCCCAGGCGAGCGCCCGCCAGAGTTAAACCAAACTCTTGTTTATATAACCGGTCGTCTGAGCAAAAATTTTGAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCACTGCTTGGTATTGGGCCCCGTCCCCCTCCGCGGGGGGCGCGCCTCAAAGACCTCGGCGAGGCCTCACCGGCTTTAGGCGTAGTAGAATTCTTTCGAACGTCTTTAAAAGGGGAGGACTTCTGCCGACAGAAGCCTTTAATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA The LSU sequence is as follows SEQ ID NO.2: ACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCTTCGGGTCCGCATTGTAATTTGTAGAGGATGCTTTGGGGCAGCCGCCTGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACAGGACATGGCACCCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTTTGACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTCTGGACAGGCCAGCATCAGTTTTGGCGGCCGGATAAAGGCCTAGGGAATGTGGCTCTCGCTTCGGCGGGAGTGTTATAGCCCTGGGTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTGCGCGTAATGAAAGTGAACGGAGGTGGGAACCGCAAGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGA 4) Depositing of ZX033 The isolated strain was deposited at the China Center for Type Culture Collection on November 17, 2025, with accession number CCTCC M 20252559, and classified as Aureobasidium castaneae ZX033 strain, accession number CCTCC M 20252559.

[0026] Example 2 Detection of fumaric acid and gluconic acid in fermentation products 1) ZX033 was inoculated into YPD liquid medium and cultured at 30℃ and 220 rpm on a shaker until the logarithmic growth phase. It was then inoculated into seed medium and cultured at 30℃ and 220 rpm for 48 h. Then it was inoculated into seed fermentation medium. The fermentation process was as follows: 30 mL liquid volume in a 250 mL shake flask, culture temperature 30℃, shaker speed 220 rpm, culture time 72 h.

[0027] 3) After fermentation, the fermentation broth was diluted, filtered, and the contents of fumaric acid and gluconic acid were determined by high-performance liquid chromatography (HPLC). The results are attached. Figure 5 As shown in the control group, the contents of fumaric acid and gluconic acid in the fermentation broth were 11.07 g / L and 33.96 g / L, respectively, confirming that the strain has the ability to produce both acids simultaneously.

[0028] Example 3 Fermentation medium optimization 1) Nitrogen source optimization Five groups of fermentation media were prepared: 1 g / L NH4Cl and 1 g / L KNO3, 1 g / L NH4Cl, 2 g / L NH4Cl, 1 g / L KNO3, and 2 g / L KNO3. The basic fermentation media were weighed out.

[0029] ZX033 was inoculated into YPD liquid medium and cultured at 30℃ and 220 rpm on a shaker until the logarithmic growth phase. It was then inoculated into seed medium and cultured at 30℃ and 220 rpm for 48 h. Finally, it was inoculated into the optimized fermentation medium. The fermentation process was as follows: 30 mL liquid volume in a 250 mL shake flask, culture temperature 30℃, shaker speed 220 rpm, and culture time 72 h.

[0030] To optimize the fermentation process, five different nitrogen sources were added to the basal medium: 1 g / L NH4Cl, 1 g / L KNO3, 1 g / L NH4Cl, 2 g / L NH4Cl, 1 g / L KNO3, and 2 g / L KNO3. The basal medium was prepared by weighing 90 g / L glucose, 0.1 g / L KH2PO4, 0.1 g / L MgSO4, 0.178 g / L ZnSO4·7H2O, 0.5 g / L KCl, 0.5 g / L corn steep liquor, 1 g / L citric acid monohydrate, and 30 g / L CaCO3, adding water to a final volume of 1 L, stirring thoroughly to dissolve, dispensing into Erlenmeyer flasks, and autoclaving at 121℃ for 20 minutes. After cooling, the mixture was ready for use.

[0031] The results of nitrogen source optimization are attached. Figure 5 As shown in the experiment on the effects of different nitrogen sources on the production of fumaric acid and gluconic acid by *Brachystomiae brevis* fermentation, the highest fumaric acid yield (12.03 g / L) was achieved when 1 g / L KNO3 was used as the nitrogen source, which was superior to other nitrogen source conditions. For gluconic acid, the combined nitrogen source group of 1 g / L NH4Cl and 1 g / L KNO3 achieved the highest yield (35.87 g / L), but the yield using 1 g / L KNO3 alone was still 35.45 g / L, showing a close match. Considering both product yields and the ease of culture medium preparation, 1 g / L KNO3 was ultimately determined to be the optimal nitrogen source.

[0032] 2) Experiment with the addition of corn steep liquor and citric acid Three groups of fermentation culture media were prepared: one group with only corn steep liquor, one group with only citric acid, and one group with both.

[0033] ZX033 was inoculated into YPD liquid medium and cultured at 30℃ with a shaker at 220 rpm until the logarithmic growth phase. It was then inoculated into seed culture medium and cultured at 30℃ with a shaker at 220 rpm for 48 h. Finally, it was inoculated into seed fermentation medium. The fermentation process involved filling 250 mL shake flasks with 30 mL of liquid, incubating at 30℃ with a shaker speed of 220 rpm for 72 h. Three groups were set up during fermentation: one group had corn steep liquor added to the basal medium, another group had citric acid added, and the third group had a mixture of corn steep liquor and citric acid added, respectively. For the basal fermentation medium, weigh out 90 g / L glucose, 1.35 g / L NH4Cl, 2.1 g / L KNO3, 0.1 g / L KH2PO4, 0.1 g / L MgSO4, 0.178 g / L ZnSO4·7H2O, 0.5 g / L KCl, and 30 g / L CaCO3. Add water to a final volume of 1 L, stir thoroughly to dissolve, and dispense into Erlenmeyer flasks. Autoclave at 121℃ for 20 minutes, then cool before use. After fermentation, dilute and filter the fermentation broth, and determine the contents of fumaric acid and gluconic acid using high-performance liquid chromatography (HPLC). The results are attached. Figure 6 As shown, the highest fumaric acid yield was achieved when both citric acid and citric acid were added, reaching 11.52 g / L. However, when only citric acid was added, the fumaric acid yield was 11.46 g / L, and the yields of the two groups were close. The highest gluconic acid yield was achieved in the group with only citric acid added, reaching 19.01 g / L. Considering the yields of the two products and the ease of preparing the culture medium, the optimal solution for the culture medium was finally determined to be the addition of only citric acid.

[0034] In summary, the optimized culture medium formula is 90 g / L glucose, 1 g / L KNO3, 0.1 g / L KH2PO4, 0.1 g / L MgSO4, 0.178 g / L ZnSO4·7H2O, 0.5 g / L KCl, 1 g / L citric acid monohydrate, and 30 g / L CaCO3.

[0035] Example 4 Construction of glucose oxidase (GOX) gene knockout engineered strain ZX033-ΔGOX 1) ZX033 genome extraction ZX033 was inoculated into YPD liquid medium and cultured at 30°C and 220 rpm for 24 h on a shaker. The logarithmic growth phase bacterial culture was collected to obtain the genome. The genome extraction method was performed according to the kit (Tiangen Fungal Genomic DNA Kit DP317).

[0036] 2) Construction of the knockout vector Using homologous recombination, the GOX gene in the original genome was replaced with a hygromycin resistance marker expression cassette. The GOX gene coding sequence is shown in SEQ ID NO.3, and the hygromycin resistance marker expression cassette sequence is shown in SEQ ID NO.4. Based on the GOX gene sequence of strain ZX033, upstream and downstream homologous arms at its 5' and 3' ends were designed (as shown in SEQ ID NO.5 and SEQ ID NO.6). The upstream and downstream homologous arms and the hygromycin resistance gene expression cassette were seamlessly spliced ​​into a complete fusion fragment using molecular cloning technology to construct a GOX gene knockout vector.

[0037] Upstream homologous arm SEQ ID NO.5: AAGAGCAATGCTCGACACACTCAATCTGGCAAGTGGCCATCTTGTACGTCGCGTGATGTGCTGGGTATTCTTGCGCTGATATGTAGACCTGCATATTTTGCAAGTTTGCCTCCACTCCACCACCACTTGTAGGAATTGTGTGTATCATACTTGGTCTCCTAGATTTTTGGTACAACTTCCATGCGCTTGGAGGTCAGAATTGGTCCCTCTATGTAGAACAGTTTACGAGTGTTGTGTATTGTTGAGTGACCTGGAGGCGACTTAAACATGATGAACTGCGCCAGGAATAATCGACATTCTTGGCTTTAAACATGACCGACTTGGCCGCCGACAAAAGGCTCCCAAGCTTTGCCAACGCTGGCTGTGCCGTGCACCTACTGAGTTTGAAAGCTACTCGCAACGGCTCAAAAGGGCCTTCTCCAGATTATCACATCATAGCGCATATGCCAATTGTGCTCTCAACACCTTTGCCAGGCCATCTTGTGCTTGTCCGACCTCAACATGACCCTTGGCAAGAACCATGTGCATCGCTCTACGCTGCGCAATTCGCTGTATCTTATCGCTTGTTCTCTTGTCCTCAACTCTCTTGATGGTTTGCTTTGCATATCGCAATTCTCGGTCCGGCGCCATTACGGATCGACTGTGACTACATTGATGTTGGGACGACCTTGATGTGACTTCCACAGATATAAGTTCCAGGTGGATCCTCTCGAGATATAGTATCACGAACCACTTCTATTCCTCAGGAGTCGTCTCAATACAAC Downstream homology arm SEQ ID NO.6: ATCAGCCGATTGAGAACGACGCGAGAATGACGCGATATCGACTATAGTTATAAACTGCAGTAATAGATAAGAATAAAGTCCTTCTGATGTAAAAACAACTGCTCCGCTGCGCCGTCATCGACTGACCGAATCCGGTGCGATTACATCGTAGCCGTCTAGCCGTAGTTCTGCCGCGTGGAAA AGCTAAAAACTTGGCGAGGCTGTCGGGCTCGGAGACATTATTATTGAATACTATCTAGTACTTGACCATTTAAGCCCACTTTCAGCGTTATCTTATACTTGTATTTGTCTACCTATCTTCTCTGAAATCCTGGCGTATCTCGCTTATTTGCTACTAAATCCTTGTCGTCGTCGTTGTCGTTGTCG CATCGAGTCTAGCGTCTATCGTCGGAAGTAGTACGCTACAAATGACACTTTGAAACCGGACGACTGTTCTCATAAAAAATAGGATGGTCCGAGATTACTGTCATCAAGAGAGACAATCTTGCTCAAGGAAGCTCATGCTATTGCAAGTGTTACCTGGTCAGGGTGTCGAAATATGCGGCCATGTCTT GTGGTGAACAACCTTGACCCGCTTGCTTGGAGCGTCAACGCTTTTCGAACGCGACCTTCGTTCCCTCGCCTAGACAAGCAGGATATCGACAATGTCAACTGCTGTCATGTTGAGTTCTTCTCAGCCCGCCGAGAAGTCTAGCATGGAATCTCGATCACTTCGATCCTGCGCTACAGAGCACTGAGAG The specific method uses the ZX033 genome as a template and employs Vazyme 2 × Phanta UniFi Master Mix (Dye Plus)-P526 high-fidelity DNA polymerase to amplify the upstream and downstream homologous arms of the knockout vector. The primers are as follows: Upstream homologous arm primer F: 5'-AAGAGCAATGCTCGACACACTC-3' (SEQ ID No. 7); Upstream homologous arm primer R: 5'-GTTGTATTGAGACGACTCCTGAGG-3' (SEQ ID No. 8); Downstream homologous primer F: 5'-ATCAGCCGATTGAGAACGACG-3' (SEQ ID No. 9); Downstream homologous arm primer R: 5'-CTCTCAGTGCTCTGTAGCGCAG-3' (SEQ ID No. 10).

[0038] The PCR amplification system consisted of: 25 μL of 2 × Phanta UniFi Master Mix (Dye Plus), 20 μL of ddH2O, 2 μL each of forward and reverse primers, and 1 μL of genomic DNA. The amplification program was: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 60℃ annealing for 10 s, 72℃ extension for 30 s, for 30 cycles; followed by a final extension at 72℃ for 5 min. The amplified products were purified to obtain the forward and reverse homologous arms for later use.

[0039] Using plasmid pk2-hyg as a template, the hygromycin resistance marker expression cassette was amplified using Vazyme 2×Phanta UniFi Master Mix (Dye Plus)-P526 high-fidelity DNA polymerase. The primers are as follows: Primer F: 5'-GAGTCGTCCAATACAACTACCGTTCGTATAATGTATGCTATACG-3' (SEQ ID No. 11); Primer R: 5'-CGTTCTCAATCGGCTGATTACCGTTCGTATAGCATACATTATACG-3' (SEQ ID No. 12); The PCR amplification system consisted of: 25 μL of 2×Phanta UniFi Master Mix (Dye Plus), 20 μL of ddH2O, 2 μL each of forward and reverse primers, and 1 μL of genomic DNA. The amplification program was: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 60℃ annealing for 10 s, 72℃ extension for 60 s, for 30 cycles; followed by a final extension at 72℃ for 5 min. The amplified product was purified to obtain the hygromycin resistance marker expression cassette for later use.

[0040] Using upstream and downstream homologous arms and hygromycin resistance marker expression cassette as templates (mixed in equimolar ratio), the GOX gene knockout vector fragment was amplified using Vazyme 2× Phanta UniFi Master Mix (Dye Plus)-P526 high-fidelity DNA polymerase. The primers were SEQ ID No. 7 and SEQ ID No. 12 mentioned above. The amplified product was purified to obtain the GOX gene knockout vector for later use.

[0041] 2) PEG-mediated protoplast transformation To prepare HC medium, weigh out 3 g / L yeast extract, 10 g / L peptone, 10 g / L glucose, 1 g / L beef extract, and 3 g / L malt extract. Add 1 L of water and dissolve thoroughly. Dispense into Erlenmeyer flasks, sterilize at 121°C for 20 minutes, and cool before use.

[0042] Weigh out 6 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, 2 g / L beef extract, 6 g / L malt extract, and 182.1 g / L sorbitol for HCS medium. Dissolve them thoroughly in 1 L of water, sterilize at 121℃ for 20 min, and cool before use.

[0043] The screening medium consisted of 1.6 g / L KH2PO4, 0.4 g / L Na2SO4, 0.8 g / L KCl, 0.2 g / L MgSO4·7H2O, 0.1 g / L CaCl2, 0.002 g / L FeSO4·7H2O, 0.0018 g / L ZnSO4·7H2O, 0.001 g / L MnCl2·4H2O, 0.0001 g / L CuSO4·5H2O, 3 g / L KNO3, 10 g / L glucose, 182.1 g / L sorbitol, and 15 g / L agar powder. Water was added to bring the volume to 1 L. After thorough stirring and dissolution, the mixture was autoclaved at 121°C for 20 minutes. After cooling to 60°C, the filtered and sterilized antibiotic was added, with a final concentration of hygromycin B of 100 μg / mL.

[0044] For the secondary screening medium, weigh out 1.6 g / L KH2PO4, 0.4 g / L Na2SO4, 0.8 g / L KCl, 0.2 g / L MgSO4·7H2O, 0.1 g / L CaCl2, 0.002 g / L FeSO4·7H2O, 0.0018 g / L ZnSO4·7H2O, 0.001 g / L MnCl2·4H2O, 0.0001 g / L CuSO4·5H2O, 3 g / L KNO3, 10 g / L glucose, and 15 g / L agar powder. Add water to a final volume of 1 L, stir thoroughly to dissolve, autoclave at 121℃ for 20 minutes, cool to 60℃, and then add the filtered and sterilized antibiotic. The final concentration of hygromycin B is 100 μg / mL.

[0045] To prepare Buffer I, weigh out 1.47 g of trisodium citrate and 18.21 g of sorbitol, dissolve them in primary water, adjust the pH to 5.8 with 1 M citric acid, bring the volume to 100 mL with primary water, sterilize at 121°C for 20 min, and cool before use.

[0046] STC buffer preparation: Weigh 18.21 g sorbitol, 0.27 g CaCl2, and 0.30 g Tris. Dissolve them in primary water, adjust the pH to 7.5 with hydrochloric acid, and bring the volume to 100 mL with primary water. Sterilize at 121°C for 20 min and cool before use.

[0047] PTC buffer preparation: Weigh equal masses of STC buffer and polyethylene glycol 4000, heat to dissolve, sterilize at 121℃ for 20 min, and cool for later use.

[0048] ZX033 was inoculated into HC medium and cultured to the logarithmic growth phase. The bacterial suspension was collected, centrifuged, and resuspended in an equal volume of buffer I. Decomposition enzymes and lysin were added to the bacterial suspension for incubation to prepare protoplasts. After incubation, the cells were centrifuged again, resuspended in an equal volume of STC buffer, and aliquoted into sterile EP tubes. The constructed knockout vector was added to the protoplasts, followed by incubation with 1 mL of PTC buffer. After incubation, the cells were collected by centrifugation, washed with 1 mL of HCS medium, resuspended, and incubated for 2 h. A suitable amount was then spread onto selection medium and cultured until transformants appeared. Single colonies were picked and screened on rescreening medium until transformants appeared.

[0049] Transformants were validated by PCR using Vazyme 2×Taq Master Mix (Dye Plus)-P112 DNA polymerase to determine whether the GOX gene was successfully knocked out. The validation primers are as follows: Verify upstream primer F: 5'-GGAACCTCGGTATTCAGAACCT-3' (SEQ ID No. 13) Validate downstream primer R: 5'-GTTACCCGGCATCATTGTCG-3' (SEQ ID No. 14) The validation PCR amplification system consisted of: 25 μL of 2 × Vazyme Taq Master Mix (Dye Plus), 20 μL of ddH2O, 2 μL each of forward and reverse primers, and 1 μL of genomic DNA. The amplification program was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 72℃ annealing for 15 s, 62℃ extension for 4 min, 30 cycles; and 72℃ extension for 5 min. After the reaction, the reaction products were analyzed by agarose gel electrophoresis and sequenced. The sequencing alignment results are shown below. Figure 7 As shown.

[0050] The correct band was verified to be 3598 bp, and the GOX-knockout genetically engineered strain was named ZX033-ΔGOX.

[0051] Example 5 Fermentation performance test of engineered strain ZX033-ΔGOX To prepare the seed culture medium, weigh out 60 g / L glucose, 2.7 g / L NH4Cl, 4.2 g / L KNO3, 0.1 g / L KH2PO4, 0.1 g / L MgSO4, 0.178 g / L ZnSO4·7H2O, 0.5 g / L KCl, 1 g / L corn steep liquor, and 20 g / L CaCO3. Add water to a final volume of 1 L, stir thoroughly to dissolve, dispense into Erlenmeyer flasks, autoclave at 121℃ for 20 minutes, and cool before use.

[0052] Prepare the fermentation medium by weighing 90 g / L glucose, 1.35 g / L NH4Cl, 2.1 g / L KNO3, 0.1 g / L KH2PO4, 0.1 g / L MgSO4, 0.178 g / L ZnSO4·7H2O, 0.5 g / L KCl, 0.5 g / L corn steep liquor, 1 g / L citric acid monohydrate, and 30 g / L CaCO3. Add water to a final volume of 1 L, stir thoroughly to dissolve, dispense into Erlenmeyer flasks, autoclave at 121℃ for 20 minutes, and cool before use.

[0053] Fermentation medium 2 consists of 90 g / L glucose, 1 g / L KNO3, 0.1 g / L KH2PO4, 0.1 g / L MgSO4, 0.178 g / L ZnSO4·7H2O, 0.5 g / L KCl, 1 g / L citric acid monohydrate, and 30 g / L CaCO3. Fermentation medium 3 consists of 90 g / L glucose, 2 g / L (NH4)2SO4, 0.3 g / L KH2PO4, 0.3 g / L MgSO4·7H2O, 0.3 g / L ZnSO4·7H2O, 2 g / L corn starch, and 30 g / L CaCO3.

[0054] ZX033 and ZX033-ΔGOX were inoculated into YPD liquid medium and cultured at 30℃ and 220 rpm on a shaker until the logarithmic growth phase. They were then inoculated into seed culture medium and cultured at 30℃ and 220 rpm for 48 h. Finally, they were inoculated into seed fermentation medium. The fermentation process was as follows: 30 mL of liquid was added to a 250 mL shake flask, the culture temperature was 30℃, the shaker speed was 220 rpm, and the culture time was 72 h.

[0055] After fermentation, the fermentation broth was diluted, filtered, and the fumaric acid content was determined by high performance liquid chromatography.

[0056] Fermentation results are attached. Figure 8As shown, ZX033-ΔGOX exhibited improved acid production performance in all three culture media. In fermentation medium 1, ZX033-ΔGOX produced the highest amount of fumaric acid, reaching 15.78 g / L, which was 28.7% higher than that of the original strain.

[0057] The above-described embodiments are merely preferred embodiments provided to fully illustrate the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention. The scope of protection of the present invention is defined by the claims.

Claims

1. A short-stalked fungus strain (Aureobasidium castaneae) ZX033 producing fumaric acid and gluconic acid, characterized by: The strain ZX033 of *Briefomus brevicorum* is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC M20252559.

2. The use of the short-stalked dermal strain ZX033 according to claim 1 in the production of fumaric acid and / or gluconic acid.

3. A method for producing fumaric acid and / or gluconic acid, characterized in that: It was obtained by fermentation using the short-stalked dermal strain ZX033 as described in claim 1.

4. The genetically engineered strain ZX033-ΔGOX of *Bacillus brevis* strain ZX033, characterized by: The strain ZX033-ΔGOX is a short-stalked dermatophyte strain ZX033 with the glucose oxidase gene GOX knocked out. The nucleic acid sequence of the glucose oxidase gene GOX is shown in SEQ ID NO.

3.

5. The genetically engineered strain ZX033-ΔGOX according to claim 4, characterized in that: The method for knocking out the glucose oxidase gene GOX in the Bruxelles strain ZX033 is to construct a gene GOX knockout vector, then transform the knockout vector into Bruxelles ZX033 via PEG-mediated transformation, and after culturing, screen transformants to obtain the engineered strain ZX033-ΔGOX.

6. The genetically engineered strain ZX033-ΔGOX according to claim 5, characterized in that: The method for constructing the GOX gene knockout vector is to amplify the upstream homologous arm sequence SEQ ID NO.5 and the downstream homologous arm sequence SEQ ID NO.6 of the GOX gene, as well as the hygromycin resistance marker expression cassette sequence SEQ ID NO.4, and fuse the three to obtain the GOX gene knockout vector.

7. The use of the genetically engineered strain ZX033-ΔGOX according to any one of claims 4 to 6 in the production of fumaric acid.