Application of SNP (Single Nucleotide Polymorphism) molecular marker related to pig scrotal hernia on pig No.18 chromosome

By identifying the SNP molecular marker rs332175156 on pig chromosome 18 through genome-wide association analysis, rapid improvement of scrotal hernia in pigs was achieved, solving the problem of genetic identification and improvement of scrotal hernia in pigs and improving breeding efficiency and economic benefits.

CN121575103APending Publication Date: 2026-02-27ZHONGKAI UNIV OF AGRI & ENG +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511945167.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-22
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively identify and improve the genetic defect of scrotal hernia in pigs, leading to stunted growth and increased breeding costs.

Method used

Genome-wide association analysis (GWAS) was used to identify the SNP molecular marker rs332175156 located on chromosome 18 of pigs. Pigs with the TT genotype were selected for breeding to reduce the incidence of scrotal hernia.

Benefits of technology

By selecting the dominant alleles of SNP molecular markers, the incidence of scrotal hernia can be significantly reduced, breeding efficiency of pigs can be improved, economic losses can be reduced, and the generation interval of genetic progress can be shortened.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121575103A_ABST
    Figure CN121575103A_ABST
Patent Text Reader

Abstract

The invention discloses an application of an SNP (Single Nucleotide Polymorphism) molecular marker related to porcine scrotal hernia on a porcine chromosome 18, and the locus of the SNP molecular marker is rs332175156 and corresponds to Cgt at the 15224983 bp position on the chromosome 18 of an international porcine reference genome version 11.1; t mutation; the genotype of the gene is CC, CT or TT. The SNP molecular marker provided by the invention is remarkably related to the scrotal hernia morbidity of pigs, and the scrotal hernia morbidity of pigs with the genotype of TT of the SNP molecular marker is lower than that of pigs with the genotype of CT or CC. By breeding the pig with the SNP molecular marker genotype being TT, the improvement progress of the genetic defect of the pig scrotal hernia can be accelerated, and the morbidity of the scrotal hernia is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic breeding, and relates to application of a SNP molecular marker related to pig scrotal hernia on pig chromosome 18. BACKGROUND

[0002] As a key pillar of the global livestock industry, the modernization process of pig breeding benefits from the synergistic innovation in the fields of genetics, feeding management and animal welfare protection. Genetic defects represented by scrotal hernia have posed a systematic threat to the pig industry chain. As a common congenital developmental abnormality of boars, scrotal hernia is mainly manifested in that abdominal tissue abnormally moves down to the scrotum through the inguinal canal, which not only leads to slow growth of pigs, but also reduces feed conversion rate, thereby increasing breeding cost and culling rate. As of now, researches on pig scrotal hernia mainly revolve around three core mechanisms: testicular descent regulation mechanism disorder, peritoneal sheath closure program abnormality and collagen metabolism disorder.

[0003] In disease research, Genome-Wide Association Study (GWAS) can be used to identify differences in allele frequency by using case-control design or quantitative trait analysis, and to systematically identify genetic loci significantly associated with complex disease phenotypes. Compared with traditional candidate gene research, GWAS uses genome-wide scanning, which can discover new genetic risk loci and provide a broader perspective for genetic research of complex diseases. SUMMARY

[0004] The application aims to provide a SNP molecular marker significantly related to pig scrotal hernia on pig chromosome 18 and application thereof.

[0005] According to an aspect of the application, a SNP molecular marker related to pig scrotal hernia on pig chromosome 18 is provided, which is located at rs332175156, corresponding to a C>T mutation (single base mutation) at position 15224983bp on chromosome 18 of the international pig reference genome version 11.1; and the genotype of the SNP molecular marker is CC, CT or TT.

[0006] The SNP molecular marker provided by the application is significantly related to the incidence of pig scrotal hernia, wherein the incidence of pig scrotal hernia of pigs with the genotype TT of the SNP molecular marker is lower than that of pigs with the genotype CT or CC. By selecting pigs with the genotype TT of the SNP molecular marker, the improvement progress of the genetic defect of pig scrotal hernia can be accelerated, and the incidence of scrotal hernia can be reduced.

[0007] According to a second aspect of the application, application of a product capable of detecting the SNP molecular marker of the application is provided, and the application includes at least one of the following (1)-(4): (1) Identify the characteristics of scrotal hernia in pigs; (2) Preparation of products for identifying the characteristics of scrotal hernia in pigs; (3) Pig genetic improvement, based on the selection of pigs with the SNP molecular marker genotype TT to reduce the incidence of scrotal hernia; (4) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of the genotype of the SNP molecular marker of the present invention to assist in the genetic improvement of pigs.

[0008] In some embodiments, products for detecting the SNP molecular markers of the present invention may include at least one of the following: reagents, kits, chips, and devices capable of detecting the SNP molecular markers of the present invention.

[0009] In some embodiments, the reagents used to detect the SNP molecular markers of the present invention may include at least one of the following: primers or probes for detecting the SNP molecular markers of the present invention.

[0010] In some embodiments, the primers used to detect the SNP molecular markers of the present invention include an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3. This primer pair can specifically amplify a fragment containing the single nucleotide polymorphism at position 78 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, and can be used to detect whether the single nucleotide at position 78 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 15224983 bp on chromosome 18 of the International Pig Reference Genome Version 11.1, is C or T.

[0011] In some embodiments, the kit for detecting the SNP molecular markers of the present invention may include primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3, as well as dNTPs, DNA polymerase, and Mg. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0012] In some implementations, the pig is a Large White pig.

[0013] According to a third aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps: (1) Determine the genotype of the SNP molecular markers on chromosome 18 of pigs that are associated with porcine scrotal hernia; (2) Select individuals with the SNP molecular marker genotype TT and eliminate individuals with the genotypes CC and CT, so as to increase the frequency of the allele T at the SNP molecular marker locus in each generation, thereby reducing the incidence of scrotal hernia.

[0014] In some implementations, in step (1), the pig is a breeding pig in the core breeding pig herd.

[0015] In some implementations, the pig in step (1) is a Large White pig.

[0016] In some implementations, step (1), determining the genotype of the SNP molecular marker associated with porcine scrotal hernia on chromosome 18 of pigs, includes the following steps: Whole-genome DNA was extracted from pigs and PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3. The amplification products were sequenced, and the single nucleotide of the SNP molecular marker site in the pig to be tested was determined to be C or T based on the sequencing results, thus determining the genotype of the SNP molecular marker.

[0017] Compared with the prior art, the beneficial effects of the present invention include: (1) This invention verifies the effect of a SNP molecular marker rs332175156 located on chromosome 18 of pigs and associated with scrotal hernia on the incidence of scrotal hernia in pigs. This helps to establish a molecular marker-assisted selection breeding technology for rapid improvement of scrotal hernia traits in pigs, so as to reduce the incidence of scrotal hernia and reduce the economic losses of breeding enterprises.

[0018] (2) This invention provides a method for pig genetic improvement by selecting the dominant allele of the SNP molecular marker rs332175156 on pig chromosome 18, which is associated with scrotal hernia. This method can accelerate genetic progress and shorten the generation interval. If all individuals with the CC type of the SNP molecular marker affecting scrotal hernia in pigs can be bred into TT type individuals, the incidence of scrotal hernia in boars will be significantly reduced, the improvement of pig genetic defects will be accelerated, and the economic benefits of pig breeding will be effectively improved. Attached Figure Description

[0019] Figure 1 This is a genome-wide association study (GWAS) plot of the scrotal hernia trait in Large White pigs located on chromosome 18; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log P value. Detailed Implementation

[0020] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0021] Example 1: Identification and Validation of SNP Molecular Markers Associated with Porcine Scrotal Hernia (1) Experimental pig herd This invention used a total of 702 Large White pigs, including 40 pigs with scrotal hernia and 662 healthy pigs. The experimental pig population used in this invention consisted of 702 Large White pigs from the breeding pig division of Guangdong Wens Foodstuff Group Co., Ltd., all of which were core members of the breeding pig division, with detailed pedigree records. The pigs were raised under uniform standards. The pigs had free access to feed and water, and the feeding methods and rearing conditions were all conventional.

[0022] (2) Phenotypic measurement The identification of scrotal hernias in pigs is strictly based on the clinical diagnostic criteria for hernias: Visual observation reveals a clear asymmetry in the scrotum, with the side containing the intestines being slightly larger. When the pig is held upside down by its hind legs and the enlarged scrotum is kneaded, the intestines return to the abdominal cavity, and the scrotum shrinks. When the pig is held upright by its forelegs, its intestines enter the scrotum as it struggles and contracts its abdomen, causing the scrotum to enlarge.

[0023] (3) Extraction of porcine genomic DNA Whole-genome DNA was extracted from ear tissue samples of Large White pigs using the standard phenol-chloroform method. The DNA quality and concentration were determined using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 nanograms per microliter.

[0024] (4) Genotyping of pig whole genome variation DNA samples were sent to Beijing Novogene Technology Co., Ltd. for next-generation sequencing, and the sequencing results were in FASTQ format.

[0025] First, GATK v4.0.2.1 software was used to generate a dict file based on the pig reference genome (Sscrofa11.1). Second, BWA-MEM-0.7.12 software was used to correlate FASTQ data reads onto the pig reference genome. Third, SAMtools v1.9 software was used to generate a bam file. Fourth, Sentieon software (version 202010) was used for variant detection, during which "--algo LocusCollector", "--algo Realigner", "--algoQualCal", "--algo Haplotyper", and "algo GVCFtyper" were used to generate the Large White pig VCF file. Finally, the "VariantFiltration" function of GATK v4.0.2.1 software was used to filter SNPs, with the default parameters being: "QD<2.0, FS>60.0, SOR>3.0, MQ<40.0, MQRankSum<12.5, ReadPosRankSum<-8.0". Finally, PLINK v1.9 was used to perform quality control on the obtained genotype data, removing those with a detection rate <90%, a minor allele count (MAC) of less than 5, and those that failed the Hardy-Weinberg equilibrium test. P <10 -6 The variant sites were identified, excluding those located at unknown locations and on sex chromosomes. The remaining 15,018,537 SNP variant sites and 702 Large White pigs were used for subsequent data analysis.

[0026] (5) Genome-wide association (GWAS) analysis of dominant inheritance models Since kinship and group stratification effects may cause false positives, a kinship matrix needs to be constructed using GCTA software before association analysis, and principal component analysis should be performed using GCTA software. The first three principal components are used as covariates to correct for the group structure.

[0027] Genotypic coding at loci was based on a dominant inheritance model, with the reference allele (R) and the alternative allele (A) being encoded as dominant. In the former case, the genotype coding was RR=1, RA=0, AA=0; in the latter case, the genotype coding was AA=1, RA=0, RR=0. Finally, GWAS analysis was performed using a mixed linear model with GEMMA software. This invention employed the Bonferrini method to set the significance threshold, setting the genomic significance level threshold to 0.05 divided by the number of effective variant loci, i.e., 3.3E-09 (0.05 / 15018537).

[0028] GWAS analysis results of dominant inheritance model as follows Figure 1 As shown.

[0029] from Figure 1 It is known that in Large White pigs, there is a SNP on chromosome 18 that is significantly associated with the scrotal hernia trait, with the strongest association being 18_15224983_C (rs332175156, P =3.41×10 -16 The 78th nucleotide from the 5' end in the nucleotide sequence shown in SEQ ID NO:1 corresponds to the C>T mutation at position 15224983 bp on chromosome 18 of the International Pig Reference Genome Version 11.1.

[0030] (6) Analyze the association between different genotypes and the incidence of scrotal hernia to verify the effect of the SNP molecular marker 18_15224983_C on the scrotal hernia trait in pigs. The results are shown in Table 1.

[0031] As shown in Table 1, the incidence of scrotal hernia differed significantly among different genotypes of the SNP molecular marker 18_15224983_C, indicating that this molecular marker affects the incidence of scrotal hernia in pigs. Assisted selection at this SNP locus in pigs could reduce the incidence of scrotal hernia and thus accelerate the breeding process for genetic defects in boars.

[0032] Furthermore, Table 1 shows that the incidence of scrotal hernia is low in TT and CT genotype individuals, indicating that CC genotype is a susceptible genotype for scrotal hernia. Boars with scrotal hernias experience reduced usability, decreased growth efficiency, and increased mortality, directly impacting the profits of livestock farms. Therefore, in the breeding process, it is necessary to gradually eliminate CC and CT genotype boars and retain TT genotype boars.

[0033] Table 1 Correlation analysis between SNP molecular markers and traits

[0034] (7) Effect analysis This invention provides a SNP molecular marker significantly associated with the trait of scrotal hernia in pigs. By optimizing the dominant allele of this molecular marker, a method for pig breeding can be provided, which can accelerate the genetic progression of the scrotal hernia trait and reduce its incidence. If all individuals with the CC type of the SNP molecular marker affecting scrotal hernia in pigs can be bred into TT type individuals, the incidence of scrotal hernia will be reduced by 28%. Reducing the incidence of scrotal hernia in pigs can significantly improve the usability of breeding boars, avoid decreased growth efficiency and increased mortality, thereby increasing the profits of pig farming enterprises and enhancing their core competitiveness.

[0035] Example 2: Methods for genetic improvement of pigs The nucleotide sequence of the target fragment containing the SNP molecular marker 18_15224983_C associated with porcine scrotal hernia is shown in SEQ ID NO:1, and the primer pairs for its PCR amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0036] SEQ ID NO:1 ACTTGTGTCCCTCCCAGTTCAGGCACAGACATCCCAGTTCAAGGCGTGGACACGCAGACATTCTGAAGCCTTAATTTC Y TCATGTGCAAAATAACTGATGATGATTTCGAGATTCTCTAGCATTAGTTCTACTTTAAGAGAGAAGTATATTTGCACACGCATGTGTCACTGCAGCATTATTCA In this sequence, Y indicates a mutation site, which is either C or T, representing an allele mutation; the bolded beginning and end of the sequence indicate the primer binding positions.

[0037] Upstream primer-F: 5'-ACCTTGTGTCCCTCCCAGTTC-3' (SEQ ID NO:2); Downstream primer primer-R: 5'-TGAATAATGCTGCAGTGACACA-3' (SEQ ID NO:3).

[0038] The genetic improvement methods for pigs include the following steps: S1. Determine the genotype of the SNP molecular marker rs332175156. (1) Take ear tissue from pigs or tail tissue from piglets, extract the whole genome DNA of pigs using the standard phenol-chloroform method, and then perform quality testing and concentration determination on the extracted DNA.

[0039] (2) PCR amplification Prepare a 10 μL mixture, including: 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O; the PCR mix includes dNTPs, DNA polymerase, and Mg2+. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0040] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, with a final extension at 72℃ for 5 min.

[0041] (3) DNA sequence sequencing identification The PCR amplification products were sequenced, and the gene fragments were sequenced in both forward and reverse reactions. Based on the sequencing results, it was determined whether the single nucleotide at position 78 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 15224983 bp on chromosome 18 of the International Swine Reference Genome Version 11.1, was C or T, thus determining the genotype of the SNP molecular marker rs332175156 of the pig to be tested.

[0042] S2. Select pigs with the SNP molecular marker genotype TT as parents for breeding.

[0043] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. The application of a product for detecting SNP molecular markers on porcine chromosome 18 associated with porcine scrotal hernia, characterized in that, The SNP molecular marker site is rs332175156, and the application includes at least one of the following items (1) to (4): (1) Identify the characteristics of scrotal hernia in pigs; (2) Preparation of products for identifying the characteristics of scrotal hernia in pigs; (3) Pig genetic improvement, based on breeding pigs with the SNP molecular marker genotype TT to reduce the incidence of scrotal hernia; (4) Prepare a product for assisting in the genetic improvement of pigs, wherein the product is based on the identification of the genotype of the SNP molecular marker to assist in the genetic improvement of pigs.

2. The application according to claim 1, characterized in that, The product for detecting SNP molecular markers on porcine chromosome 18 associated with porcine scrotal hernia includes at least one of the following: reagents, kits, chips, and devices for detecting the SNP molecular markers.

3. The application according to claim 2, characterized in that, The reagents used to detect the SNP molecular marker include at least one of the following: primers or probes for detecting the SNP molecular marker.

4. The application according to claim 3, characterized in that, The primers used to detect the SNP molecular marker include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3.

5. The application according to any one of claims 1 to 4, characterized in that, The pig in question is a Large White pig.

6. A method for genetic improvement of pigs, characterized in that, Includes the following steps: (1) Determine the genotype of the SNP molecular markers on chromosome 18 of pigs that are associated with porcine scrotal hernia; (2) Select individuals with the SNP molecular marker genotype TT; The site of the SNP molecular marker is rs332175156.

7. The method for genetic improvement of pigs according to claim 6, characterized in that, In step (1), the method for determining the genotype of the SNP molecular marker associated with porcine scrotal hernia on chromosome 18 of pigs includes the following steps: Whole-genome DNA was extracted from pigs and PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3. The amplification products were sequenced, and the genotype of the SNP molecular marker associated with porcine scrotal hernia on chromosome 18 of pigs was determined based on the sequencing results.

8. The method for genetic improvement of pigs according to claim 6 or 7, characterized in that, The pig in question is a Large White pig.