Application of SNP (Single Nucleotide Polymorphism) molecular marker located on pig chromosome 1 and related to birth weight

By detecting the SNP molecular marker rs692141632 on pig chromosome 1, pigs carrying the mutant T allele were identified and bred, solving the problem of difficulty in increasing pig birth weight in existing technologies, and achieving a significant increase in pig birth weight and accelerating the breeding process.

CN121575124AActive Publication Date: 2026-02-27SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202610107906.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-27
Publication Date
2026-02-27
Estimated Expiration
2046-01-27

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively utilize genetic breeding methods to improve the birth weight trait in pigs, thus affecting the production efficiency and economic benefits of pig farms.

Method used

By detecting the SNP molecular marker rs692141632 located on pig chromosome 1, especially the mutation with nucleotide sequence C>T, pigs carrying the mutant T allele are identified and selected, and the frequency of this allele is increased generation by generation to improve birth weight.

Benefits of technology

It significantly increases the birth weight of piglets, enhances the survival rate, growth rate and disease resistance of newborn piglets, optimizes the reproductive performance of sows, and improves the economic benefits and competitiveness of pig farms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121575124A_ABST
    Figure CN121575124A_ABST
Patent Text Reader

Abstract

The invention discloses application of an SNP (Single Nucleotide Polymorphism) molecular marker located on a pig chromosome 1 and related to birth weight. The locus of the SNP molecular marker corresponds to Cgt at the 267736954 bp on a chromosome 1 of an international pig reference genome version 11.1; the genotype of the SNP molecular marker is CC, CT or TT. According to the present invention, by detecting the single nucleotide polymorphism and / or the genotype of the SNP molecular marker, the identification of the birth weight character of the pig can be achieved, and by breeding the pig carrying the mutant T allele and eliminating the pig with the genotype of CC, the birth weight of the offspring pig can be improved so as to improve the survival rate, the growth and development speed and the disease resistance of the newborn piglet.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to the application of SNP molecular markers located on pig chromosome 1 that are associated with birth weight. Background Technology

[0002] The pig farming industry plays a vital role in agricultural economic development. Birth weight of piglets is a key economic trait in pig production, directly determining the production efficiency and economic benefits of pig farms. In practice, birth weight is not only closely related to the survival rate, growth rate, and disease resistance of newborn piglets, but also significantly affects weaning weight, market entry time, and overall feed conversion efficiency. Proper birth weight management can effectively reduce lactation mortality, improve herd uniformity, and optimize sow reproductive performance, forming a crucial foundation for achieving modern, efficient pig farming.

[0003] From a genetic breeding perspective, birth weight, as a trait with moderate heritability, possesses good potential for genetic improvement. In-depth analysis of the genetic mechanisms and molecular basis of birth weight, and the establishment of scientific and efficient breeding methods, are of great significance for optimizing the selection of growth traits in pigs and achieving the sustainable development of pig breeding. Summary of the Invention

[0004] The purpose of this invention is to provide an application of a SNP molecular marker located on chromosome 1 of pigs that is significantly associated with the primary weight trait in pigs.

[0005] According to one aspect of the invention, an application is provided for a product for detecting SNP molecular markers located on chromosome 1 of pigs that are associated with birth weight, the application comprising at least one of the following (1) to (4): (1) Identify the birth weight traits of pigs; (2) Prepare products for identifying the birth weight traits of pigs; (3) Pig genetic improvement, based on eliminating pigs with the SNP molecular marker genotype CC to increase the birth weight of pigs; (4) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of SNP molecular markers to assist in the genetic improvement of pigs.

[0006] The present invention relates to a SNP molecular marker on pig chromosome 1 that is associated with birth weight. The site is rs692141632, corresponding to the C>T mutation at 267736954 bp on chromosome 1 in the International Pig Reference Genome 11.1. This mutation is beneficial to increasing the birth weight of pigs. The genotype of the SNP molecular marker is CC, CT, or TT.

[0007] The SNP molecular markers of this invention are significantly correlated with the birth weight trait in pigs. Specifically, pigs carrying the mutant T allele have a significantly higher birth weight than pigs without the mutant T allele, indicating that the mutant T allele is the dominant allele for the birth weight trait in pigs. By detecting the single nucleotide polymorphisms and / or genotypes of the SNP molecular markers of this invention, the birth weight trait in pigs can be identified. Furthermore, in pig genetic breeding, selecting pigs carrying the mutant T allele can accelerate the breeding process and increase the birth weight of piglets.

[0008] In some embodiments, products for detecting SNP molecular markers associated with birth weight located on pig chromosome 1 may include at least one of the following: reagents, kits, chips, and devices for detecting SNP molecular markers associated with birth weight located on pig chromosome 1.

[0009] In some embodiments, the reagents used to detect SNP molecular markers associated with birth weight located on pig chromosome 1 may include at least one of the following: primers or probes for detecting SNP molecular markers associated with birth weight located on pig chromosome 1.

[0010] In some implementations, the pigs are three-way crossbred pigs. Specifically, they are three-way crossbred pigs bred using a "three-way crossbreeding" model based on the Duroc, Landrace, and Large White breeds, including Duroc-Landrace-Landrace three-way crossbred pigs, Duroc-Landrace-Landrace three-way crossbred pigs, etc.

[0011] In some embodiments, the primers used to detect SNP molecular markers associated with birth weight on pig chromosome 1 include an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3. This primer can specifically amplify a fragment containing the single nucleotide polymorphism at position 389 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, and can be used to detect whether the single nucleotide at position 389 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 267736954 bp on chromosome 1 of the International Pig Reference Genome Version 11.1, is C or T.

[0012] In some embodiments, the kit for detecting SNP molecular markers associated with birth weight on pig chromosome 1 may include primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3, as well as dNTPs, DNA polymerase, and Mg2+. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0013] According to a second aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps: (1) Determine the genotype of the SNP molecular markers located on chromosome 1 of pigs that are associated with birth weight; (2) Select individuals carrying the mutant T allele and eliminate individuals with the CC genotype to increase the frequency of the T allele at this locus in each generation, thereby increasing the birth weight of the offspring pigs.

[0014] In some implementations, in step (1), the pig is a breeding pig in the core breeding pig herd.

[0015] In some implementations, in step (1), the breeding pig is a three-way crossbred pig.

[0016] In some implementations, step (1), determining the genotype of the SNP molecular marker associated with birth weight located on chromosome 1 of the pig, includes the following steps: Whole-genome DNA was extracted from breeding pigs and amplified by PCR using primers with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3. The amplified products were sequenced, and the genotypes of SNP molecular markers associated with birth weight located on chromosome 1 of pigs were determined based on the sequencing results.

[0017] Compared with the prior art, the beneficial effects of the present invention include: (1) This invention verifies the effect of SNP molecular markers located on the nucleotide sequence of pig chromosome 1 that are significantly associated with the birth weight trait of pigs on the birth weight trait of pigs. This helps to establish a molecular marker-assisted selection breeding technology for rapid improvement of the birth weight trait of pigs, thereby increasing the birth weight of piglets and thus improving the survival rate, growth rate and disease resistance of newborn piglets.

[0018] (2) This invention provides a method for genetic improvement of pigs based on SNP molecular markers located on chromosome 1 of pigs that are associated with birth weight. By selecting the dominant alleles of these SNP molecular markers, the birth weight trait in pigs can be selected quickly and accurately, accelerating the breeding process. Applying the SNP molecular markers located on chromosome 1 of pigs associated with birth weight of this invention to the genetic improvement program for the birth weight trait in pigs can significantly improve the health level of piglets, increase the growth rate of piglets, increase the number of weaned piglets, and thus increase the profits of breeding enterprises and enhance their core competitiveness. Attached Figure Description

[0019] Figure 1 This is a genome-wide association study (GWAS) plot of primary weight traits on chromosome 1 in three-way crossbred pigs; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log P value.

[0020] Figure 2 A graph showing the results of birth weight analysis for pigs with different genotypes. Detailed Implementation

[0021] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0022] Example 1: Identification and Validation of SNP Molecular Markers Associated with Primary Weight Traits in Pigs (1) Experimental pig herd This invention used a total of 1457 three-way crossbred pigs. The experimental pig population consisted of 1457 three-way crossbred pigs from the breeding pig division of Guangdong Wens Foodstuff Group Co., Ltd., and 74 Duroc, 161 Landrace, and 156 Large White grandparent pigs identified by pedigree. The Duroc, Landrace, and Large White pigs were the core group from the breeding pig division, and their pedigree records were detailed. The pigs had free access to feed and water, and the feeding methods and rearing conditions remained consistent throughout, following conventional practices.

[0023] (2) Phenotypic measurement After the piglets are born, their weight is measured and recorded using an electronic scale.

[0024] (3) Extraction of porcine genomic DNA Whole-genome DNA was extracted from ear tissue samples of each collected three-way crossbred pig individual using the standard phenol-chloroform method. The DNA quality and concentration were determined using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 nanograms per microliter.

[0025] (4) Genotyping of pig whole genome variation DNA samples were subjected to next-generation sequencing by Beijing Novogene Technology Co., Ltd., and the sequencing results were in FASTQ format.

[0026] First, GATK v4.0.2.1 software was used to generate a dict file based on the pig reference genome (Sscrofa11.1). Second, BWA-MEM-0.7.12 software was used to correlate FASTQ data reads onto the pig reference genome. Third, SAMtools v1.9 software was used to generate a bam file. Fourth, Sentieon software (version 202010) was used for variant detection, during which "--algo LocusCollector", "--algo Realigner", "--algoQualCal", "--algo Haplotyper", and "algo GVCFtyper" were used to ultimately generate the VCF file for the three-way crossbred pig. Finally, the "VariantFiltration" function of GATK v4.0.2.1 software was used to filter SNPs, with the default parameters being: "QD<2.0, FS>60.0, SOR>3.0, MQ<40.0, MQRankSum<12.5, ReadPosRankSum<-8.0". For INDEL filtering, the parameters were: "QD<2.0, QUAL<50.0, FS>100.0, and ReadPosRankSum<-20.0". Finally, PLINK v1.9 was used to perform quality control on the obtained genotype data, removing variant sites with a detection rate <90%, a mimor allelic frequency (MAF) <5%, and excluding variant sites located at unknown locations and on sex chromosomes. The remaining 17,475,192 variant sites and 1457 samples were used for subsequent data analysis.

[0027] (5) Genome-wide association analysis (GWAS) Because kinship and population stratification effects can cause false positives, a kinship matrix needs to be constructed using GCTA software before association analysis. Principal component analysis (PCA) is then performed using GCTA software, with the first three principal components used as covariates to correct for population structure. Finally, GWAS analysis is performed using a mixed linear model from GCTA software. This invention references the Bonferroni significance threshold, setting the chromosome significance threshold to 1 / N (…). P =5.72×10 -8 ), where N is the number of mutation sites.

[0028] GWAS analysis results are as follows Figure 1 As shown.

[0029] from Figure 1It can be seen that in three-way crossbred pigs, there is a SNP locus on chromosome 1 that significantly affects birth weight, and the most strongly associated SNP is 1_267736954_C_T ( P = 1.212×10 -8 This refers to nucleotide 389 in SEQ NO.1, which corresponds to the C>T mutation at 267736954 bp on chromosome 1 of the International Pig Reference Genome Version 11.1.

[0030] (6) Analyze the association between different genotypes and the birth weight phenotype of three-way crossbred pigs to verify the effect of SNP sites on the birth weight of pigs.

[0031] The results are shown in Table 1. Figure 2 As shown.

[0032] As shown in Table 1, the SNP molecular marker 1_267736954_C_T of this invention is highly significantly correlated with the birth weight trait of three-way crossbred pigs. P <0.01), indicating that this molecular marker significantly affects the birth weight trait in pigs. Assisted selection at this SNP site in pigs can increase the birth weight of piglets in this population, thereby accelerating their growth rate. Additionally, according to Table 1 and... Figure 2 It was found that individuals carrying the mutant T allele had significantly higher birth weights than those without, indicating that the mutant T allele is the dominant allele for birth weight in pigs. Birth weight, as an important indicator of genetic improvement in breeding pigs, is not only closely related to the survival rate, growth rate, and disease resistance of newborn piglets, but also significantly affects weaning weight, market age, and overall feed conversion efficiency. Therefore, in the breeding process, it is necessary to gradually cull breeding pigs that do not carry the T allele (i.e., cull breeding pigs with the CC genotype) and retain breeding pigs carrying the mutant T allele to increase the frequency of the mutant T allele at this locus generation by generation.

[0033] Table 1 Correlation analysis between SNP molecular markers and traits

[0034] (7) Effect analysis This invention provides a SNP molecular marker 1_267736954_C_T that is significantly associated with the birth weight trait in pigs. Marker-assisted selection using this SNP marker can accelerate genetic progress and shorten generation intervals. Specifically, if all CC-type breeding pigs in a population can be bred into CT-type breeding pigs, the average birth weight of offspring piglets can be increased by 9.55%. Birth weight, as an important indicator of pig genetic improvement, is not only closely related to the survival rate, growth rate, and disease resistance of newborn piglets, but also significantly affects weaning weight, time to market, and overall feed conversion efficiency.

[0035] Example 2: Methods for genetic improvement of pigs The target fragment containing SNP loci significantly associated with the birth weight trait in three-way crossbred pigs is a 667 bp nucleotide sequence from chromosome 1, the specific nucleotide sequence of which is shown in SEQ ID NO:1. The primer pairs for PCR amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0036] SEQ ID NO:1 TTGGGTGTCTCATTGGATGGCTGACTTCACTTAGCATGATAATTTCTGGGTCCATCCATGTTGCTAAAAATGCCGGTATTTCGTTCCTTTTAATGGCTGAGCAATATTCCATTGTGTATATGGACCACATCTTCTTGATCCACTCCTCTGTCGATGGACATTTAGGTTGTTTCCATGTCTTGACTATTGAAAATA GTGCTGCAATGAACATCGGAGTACATGTGTCTTTGCGAGTCGTGGTTTTCTCTGGATAGATGCCCAGGAGTGGGATTGCTGGATCAAATGGTAGTTCTATGTTTAGTTTTCTGAGGAATCTCCATACTGTTTTCCACAGTGGTTGCACCAATTTACAATCCCACCAACAGTGTACTAGGGTTCCTTTTTCTCCA Y ATCCTCTCCAGCACTTCTTGTTTGTAGACTTTTTGATGATGGCCCTTCTGGCTGGTGTAAGGTGGTACCTCAGAGTGGTTTTGATTTGCATTCCTCTAATAATGAGTGATGTTGAACATCTTTTCATGTGTTTTTTGGC CATCTGTATGTCTTCTTTGGAGAACTGTCTGTTTAGATCTGCCCATTTTTTGATGGGGTTGTTTGGTTTTTTTGGTATGGAGCTGCAGAAGGTGTTTATGAATTTTGGAGATGAATCCCTAGTCAGTTGATTCATTTGC.

[0037] The Y marked in the sequence is the mutation site, which is T or C, indicating an allele mutation; the bolded beginning and end of the sequence indicate the primer binding position.

[0038] Upstream primer-F: 5'- TTGGTGTCTCATTGGATGGC-3' (SEQ ID NO:2); Downstream primer primer-R: 5'-GCAAATGAATCAACTGACTAGGG-3' (SEQ ID NO:3).

[0039] The genetic improvement methods for pigs include the following steps: S1. Determine the genotypes of SNP molecular markers associated with the primary weight trait in pigs: (1) Take ear tissue from pigs or tail tissue from piglets, extract the whole genome DNA of pigs using the standard phenol-chloroform method, and then perform quality testing and concentration determination on the extracted DNA.

[0040] (2) PCR amplification Prepare a 10 μL mixture, including: 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O; the PCR mix includes dNTPs, DNA polymerase, and Mg2+. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0041] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, with a final extension at 72℃ for 5 min.

[0042] (3) DNA sequence sequencing identification The PCR amplification products were sequenced, and the gene fragments were sequenced in both forward and reverse reactions. Based on the sequencing results, it was determined whether the single nucleotide at position 389 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 267736954 bp on chromosome 1 of the International Swine Reference Genome Version 11.1, was T or C, thus determining the genotype of the SNP molecular marker 1_267736954_C_T in the pig to be tested.

[0043] S2. Select pigs carrying the mutant T allele, that is, select pigs with genotype CT or TT as parents for breeding, and cull pigs with genotype CC, so as to increase the frequency of the T allele at this SNP locus in each generation.

[0044] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. The application of a product for detecting SNP molecular markers located on pig chromosome 1 that are associated with birth weight, characterized in that, The SNP molecular marker is located at position 267736954 bp on chromosome 1 of the International Swine Reference Genome Version 11.1, and the nucleotide type of this position is C or T; the genotype of the SNP molecular marker is CC, CT or TT, and the application includes at least one of the following (1) to (4): (1) Identify the birth weight traits of pigs; (2) Prepare products for identifying the birth weight traits of pigs; (3) Pig genetic improvement, based on culling pigs with the SNP molecular marker genotype CC to increase the birth weight of pigs; (4) Prepare a product for assisting in the genetic improvement of pigs, wherein the product is based on the identification of the genotype of the SNP molecular marker to assist in the genetic improvement of pigs.

2. The application according to claim 1, characterized in that, The product for detecting SNP molecular markers located on pig chromosome 1 that are associated with birth weight includes at least one of the following: reagents, kits, chips, and devices for detecting the SNP molecular markers.

3. The application according to claim 2, characterized in that, The reagents used to detect the SNP molecular marker include at least one of the following: primers or probes for detecting the SNP molecular marker.

4. The application according to claim 3, characterized in that, The primers used to detect the SNP molecular marker include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3.

5. The application according to any one of claims 1 to 4, characterized in that, The pigs in question are three-way crossbred pigs.

6. A method for genetic improvement of pigs, characterized in that, Includes the following steps: (1) Determine the genotype of the SNP molecular markers located on chromosome 1 of pigs that are associated with birth weight; (2) Eliminate individuals with the SNP molecular marker genotype CC; The SNP molecular marker is located at 267736954 bp on chromosome 1 of the International Pig Reference Genome Version 11.1, and the nucleotide type at this site is C or T.

7. The method for genetic improvement of pigs according to claim 6, characterized in that, In step (1), the method for determining the genotype of the SNP molecular markers associated with birth weight located on chromosome 1 of pigs includes the following steps: Whole-genome DNA was extracted from pigs and amplified by PCR using primers with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3. The amplified products were sequenced, and the genotypes of SNP molecular markers associated with birth weight located on chromosome 1 of pigs were determined based on the sequencing results.

8. The method for genetic improvement of pigs according to claim 6 or 7, characterized in that, The pigs in question are three-way crossbred pigs.

Citation Information

Patent Citations

  • SNP marker related to pig birth weight character and application

    CN112980962A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to pig birth weight and application of SNP molecular marker

    CN115948570A

  • IGF2 marker assisted selection for porcine reproductive traits

    WO2007133075A2