Aggregation-induced electrochemical luminescence microcystic toxin-LR sensing platform based on supramolecular organic framework

Abstract

The invention relates to an aggregation-induced electrochemical luminescence microcystic toxin-LR sensing platform based on a supramolecular organic framework, and provides a preparation and detection method of the platform. The invention particularly relates to preparation of the aggregation-induced electrochemiluminescence microcystic toxin-LR sensing platform based on the supramolecular organic framework and a detection method of the aggregation-induced electrochemiluminescence microcystic toxin-LR sensing platform based on the supramolecular organic framework. A subject-object recognition and supramolecular constraint enhanced AIECL strategy is adopted, and CB [8] is selected as a host molecule. The molecular movement of TPE-CEPy is limited through the host-guest binding effect, and a TPE-CEPy-CB [8] composite system is successfully constructed. The material is constructed based on a subject-object recognition mechanism, and the luminous efficiency and stability of the AIECL are remarkably improved. The invention belongs to the field of analytical chemistry.

Description

TECHNICAL FIELD

[0001] The application relates to an aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on a supramolecular organic framework, and provides a preparation and detection method of the platform. Specifically, the application relates to the preparation of the aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on the supramolecular organic framework and the detection method of the aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on the supramolecular organic framework. The application belongs to the field of analytical chemistry. BACKGROUND

[0002] Cyanobacteria, as oxygenic photosynthetic autotrophic prokaryotes, are widely distributed in global aquatic ecosystems, and the cyanobacterial toxins produced by the cyanobacteria pose a serious threat to drinking water safety. Among them, microcystin-LR (MC-LR) produced by microcystis is particularly harmful. Microcystin-LR (MC-LR) belongs to the cyclic heptapeptide hepatotoxin, and can selectively accumulate in human liver cells through organic anion transporting polypeptides (OATPs). Therefore, it is crucial to develop a novel, simple, sensitive and efficient analysis method for detecting the content of microcystin-LR in the environment. In recent years, electrochemiluminescence (ECL) is a luminescence process triggered by an electrochemical reaction, which can induce the generation of an excited state substance. ECL can realize high-sensitivity detection and rapid analysis of the detected substance, and has broad application prospects in cell monitoring, nucleic acid detection and other fields. Aggregation-induced electrochemiluminescence (AIECL) is an extension of the aggregation-induced luminescence mechanism in the field of electrochemiluminescence. The AIECL system has the potential to exhibit enhanced luminescence characteristics through solution monomer polymerization, and its representative systems include pi-conjugated coumarin derivatives, siloxane-based framework structures and tetraphenyl ethylene structures. Based on this, the application designs an aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on a supramolecular organic framework for the detection of microcystin-LR (MC-LR). In the application, the AIECL strategy of host-guest recognition and supramolecular constraint enhancement is adopted, and CB[8] is selected as the host molecule. Through the host-guest combination effect, the molecular motion of TPE-CEPy is limited, and a TPE-CEPy@CB[8] composite system is successfully constructed. The material is constructed based on the guest-host recognition mechanism, and the luminescence efficiency and stability of the AIECL are significantly improved. In the biosensing design, Zn 2+The activated DNase (S)-specific cleavage function competes with MC-LR for aptamer (Apt)-triggered intensity "on-off-on" mechanism, establishing a highly specific recognition strategy. When MC-LR is present in sufficient quantities, its strong binding to the aptamer inhibits DNase production, thereby suppressing the ECL intensity pathway. Conversely, under conditions of insufficient MC-LR concentration, the DNase cleavage reaction is reactivated, triggering intensity amplification, thus achieving dynamic regulation of ECL intensity and significantly improving the sensitivity and reliability of MC-LR detection. Summary of the Invention

[0003] The purpose of this invention is to provide a method for preparing and detecting a microcystin-LR sensing platform based on a supramolecular organic framework, thereby enabling rapid and accurate detection of microcystin-LR.

[0004] The technical solution of the present invention is as follows: To achieve the above objectives, the technical solution adopted by the present invention is as follows: 1. An aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on a supramolecular organic framework, characterized by the following preparation steps: (1) Preparation of tetraphenylethylene derivatives modified based on supramolecular organic framework strategy 1) Under nitrogen protection, a mixture of 1,1,2,2-tetrakis(4-((E)-2-(pyridin-4-yl)vinyl)phenyl)ethylene (55-65 mg, 0.06-0.10 mmol) and 3-bromopropionic acid (75-80 mg, 0.40-0.70 mmol) was dissolved in anhydrous DMF (1 mL). The reaction system was stirred vigorously at 100°C for 24 hours. After cooling to room temperature, acetone (100 mL) was slowly added as an antisolvent to precipitate the crude mixture. The resulting orange precipitate was collected by vacuum filtration and washed successively with petroleum ether (3 × 10 mL) and acetone (3 × 10 mL) to remove unreacted raw materials and residual solvent. The target product was dried under vacuum at 60°C for 6 hours to obtain orange crystalline solid TPE-CEPy. 2) Through the host-guest recognition between CB[8] and TPE-CEPy, after being sonicated in 2.5 mL of deionized water for 30 minutes, a supramolecular TPE-CEPy@CB[8] assembly was synthesized until a uniform orange solution was obtained. Then, the solution was magnetically stirred at 20°C for 24 hours to ensure complete dispersion and self-assembly. The orange color of the solution can be used as a visual indicator of dissolution and complex formation. (2) Preparation of an aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on a supramolecular organic framework 1) Polish the glassy carbon electrode with a diameter of 4 mm using alumina polishing powder of 1.0 mm, 0.3 mm and 0.05 mm respectively, and rinse it clean with ultrapure water; 2) Drop 10-20 µL of TPE-CEPy@CB[8] onto the electrode surface and let it air dry at room temperature; 3) Add 8-15 μL of H0-MB solution to the electrode surface and incubate at 4 °C for 12 hours; 4) Containing LST, F and Zn 2+ 20-40 μL of the reaction mixture of (1 M) (pretreated at 37℃ for 2 hours) was added to the modified electrode surface and incubated at 4℃ for 2 hours to complete the biosensor assembly. The electrode surface was washed with buffer after each layer of modification to obtain an aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on a supramolecular organic framework. The DNA sequence mentioned above is: MC-LR aptamer: ATACCACCTCATTATGCCCCATCTCCGCTCAAATGCTCAGACTCCTGTGGTAATCGATTT L: AAATCGATTACCACAGGAGTCTGAGCATTTGATATAGGGGAAACGAAGATGTACAGTATCGCAC F:AAACCTATATCAAATGCTCAGACTC H0:C6SH-TTTGTTCACTCTCACTAT / rA / GGAAGAGATGCTGAGTGAAC-MB 2. The detection method of the aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on a supramolecular organic framework as described in claim 1, characterized in that the steps are as follows: (1) The three-electrode system of the electrochemical workstation was used for testing. The Ag / AgCl electrode was used as the reference electrode, the platinum wire electrode was used as the counter electrode, and the prepared aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on supramolecular organic framework was used as the working electrode. The electrochemical workstation and the chemiluminescence detector were connected together. The high voltage of the photomultiplier tube was set to 600-800 V, the cyclic voltammetric scan potential range was 0 ~ 1.6 V, and the scan rate was 0.2-0.6 V / s. (2) In 10 mL of PBS buffer solution containing 50-100 μL of tri-n-propanediamine at pH 6.4-8.0, the electrochemiluminescence signal intensity generated by different concentrations of microcystin-LR standard solution was detected by an electrochemiluminescence system, and working curves were plotted. (3) Use the sample solution to be tested instead of the standard solution for determination.

[0005] Beneficial results of the present invention (1) Using the AIECL strategy of host-guest recognition and supramolecular constraint enhancement, CB[8] was selected as the host molecule. By restricting the molecular motion of TPE-CEPy through the host-guest binding effect, the TPE-CEPy@CB[8] composite system was successfully constructed. This material was constructed based on the host-guest recognition mechanism, which significantly improved the luminescence efficiency and stability of AIECL. (2) In biosensor design, by integrating Zn 2+ The activated DNase (S)-specific cleavage function competes with MC-LR for aptamer (Apt)-triggered intensity "on-off-on" mechanism, establishing a highly specific recognition strategy. When MC-LR is present in sufficient quantities, its strong binding to the aptamer inhibits DNase production, thereby suppressing the ECL intensity pathway. Conversely, under conditions of insufficient MC-LR concentration, the DNase cleavage reaction is reactivated, triggering intensity amplification, thus achieving dynamic regulation of ECL intensity and significantly improving the sensitivity and reliability of MC-LR detection. (3) Under optimal detection conditions, the working curve of this biosensor is as follows: I = 8994 - 2882 lg c MC-LR ( R² = 0.997) achieved 0.01-100 ng mL -1 The study developed an ultrasensitive MC-LR detection strategy based on ECL intensity, which significantly improves the reliability of ECL biosensing by expanding the dynamic detection range and achieving an ultra-low limit of detection (LOD) of 1.35 pg mL⁻¹. Attached Figure Description

[0006] Figure 1 The image shows a scanning electron microscope image of a tetraphenylethylene derivative modified based on a supramolecular organic framework strategy, obtained in Example 1. Figure 2 The following are the operating curves of the aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on the supramolecular organic framework obtained in Example 2: I = 8994 - 2882 lg c MC-LR (R² = 0.997), detection range is 0.01–100 ng / mL -1 The detection limit is as low as 1.35 pg mL. -1 ; Detailed Implementation

[0008] Example 1 The preparation of an aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on a supramolecular organic framework includes the following steps: (1) Preparation of tetraphenylethylene derivatives modified based on supramolecular organic framework strategy 1) Under nitrogen protection, a mixture of 1,1,2,2-tetrakis(4-((E)-2-(pyridin-4-yl)vinyl)phenyl)ethylene (62 mg, 0.08 mmol) and 3-bromopropionic acid (76 mg, 0.50 mmol) was dissolved in anhydrous DMF (1 mL). The reaction system was stirred vigorously at 100°C for 24 hours. After cooling to room temperature, acetone (100 mL) was slowly added as an antisolvent to precipitate the crude mixture. The resulting orange precipitate was collected by vacuum filtration and washed successively with petroleum ether (3 × 10 mL) and acetone (3 × 10 mL) to remove unreacted raw materials and residual solvent. After the target product was dried under vacuum at 60°C for 6 hours, orange crystalline solid TPE-CEPy was obtained. 2) Through the host-guest recognition between CB[8] and TPE-CEPy, after being sonicated in 2.5 mL of deionized water for 30 minutes, a supramolecular TPE-CEPy@CB[8] assembly was synthesized until a uniform orange solution was obtained. Then, the solution was magnetically stirred at 20°C for 24 hours to ensure complete dispersion and self-assembly. The orange color of the solution can be used as a visual indicator of dissolution and complex formation. (2) Preparation of an aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on a supramolecular organic framework 1) Polish the glassy carbon electrode with a diameter of 4 mm using alumina polishing powder of 1.0 mm, 0.3 mm and 0.05 mm respectively, and rinse it clean with ultrapure water; 2) 15 µL of TPE-CEPy@CB[8] was drop-coated onto the electrode surface and dried at room temperature; 3) Add 10 μL of H0-MB solution to the electrode surface and incubate at 4 °C for 12 hours; 4) Containing LST, F and Zn 2+10 μL of a (1 M) reaction mixture (pretreated at 37 °C for 2 hours) was added dropwise to the modified electrode surface, and the biosensor was assembled by incubation at 4 °C for 2 hours. The electrode surface was washed with buffer after each modification. An aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on a supramolecular organic framework was thus prepared.

[0009] Example 2 The detection method based on the aggregation-induced electrochemiluminescence microcystin-LR sensing platform using a supramolecular organic framework comprises the following steps: (1) The three-electrode system of the electrochemical workstation was used for testing. The Ag / AgCl electrode was used as the reference electrode, the platinum wire electrode was used as the counter electrode, and the prepared aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on supramolecular organic framework was used as the working electrode. The electrochemical workstation and the chemiluminescence detector were connected together. The high voltage of the photomultiplier tube was set to 800 V, the cyclic voltammetric scan potential range was 0 ~ 1.6 V, and the scan rate was 0.3 V / s. (2) In 10 mL of PBS buffer solution containing 80 μL of tri-n-propanediamine at pH 7.4, the electrochemiluminescence signal intensity generated by different concentrations of microcystin-LR standard solution was detected by an electrochemiluminescence system, and working curves were plotted. (3) Use the sample solution to be tested instead of the standard solution for determination.

Claims

1. A supramolecular organic framework-based aggregation-induced electrochemiluminescence microcystin-LR sensing platform, characterized in that, The preparation steps are as follows: (1) Preparation of tetraphenylethylene derivatives modified based on supramolecular organic framework strategy 1) Under nitrogen protection, a mixture of 1,1,2,2-tetrakis(4-((E)-2-(pyridin-4-yl)vinyl)phenyl)ethylene (55-65 mg, 0.06-0.10 mmol) and 3-bromopropionic acid (75-80 mg, 0.40-0.70 mmol) was dissolved in anhydrous DMF (1 mL). The reaction system was stirred vigorously at 100°C for 24 hours. After cooling to room temperature, acetone (100 mL) was slowly added as an antisolvent to precipitate the crude mixture. The resulting orange precipitate was collected by vacuum filtration and washed successively with petroleum ether (3 × 10 mL) and acetone (3 × 10 mL) to remove unreacted raw materials and residual solvent. The target product was dried under vacuum at 60°C for 6 hours to obtain orange crystalline solid TPE-CEPy. 2) Through the host-guest recognition between CB[8] and TPE-CEPy, after being sonicated in 2.5 mL of deionized water for 30 minutes, a supramolecular TPE-CEPy@CB[8] assembly was synthesized until a uniform orange solution was obtained. Then, the solution was magnetically stirred at 20°C for 24 hours to ensure complete dispersion and self-assembly. The orange color of the solution can be used as a visual indicator of dissolution and complex formation. (2) Preparation of an aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on a supramolecular organic framework 1) Polish the glassy carbon electrode with a diameter of 4 mm using alumina polishing powder of 1.0 mm, 0.3 mm and 0.05 mm respectively, and rinse it clean with ultrapure water; 2) Drop 10-20 µL of TPE-CEPy@CB[8] onto the electrode surface and let it air dry at room temperature; 3) Add 8-15 μL of H0-MB solution to the electrode surface and incubate at 4 °C for 12 hours; 4) Containing LST, F and Zn 2+ 20-40 μL of a (1 M) reaction mixture (pretreated at 37°C for 2 hours) was added dropwise to the modified electrode surface, and the biosensor was assembled by incubation at 4°C for 2 hours. After each layer of modification, the electrode surface was washed with buffer solution to obtain an aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on a supramolecular organic framework; The DNA sequence mentioned above is: MC-LR aptamer: ATACCACCTCATTATGCCCCATCTCCGCTCAAATGCTCAGACTCCTGTGGTAATCGATTT L: AAATCGATTACCACAGGAGTCTGAGCATTTGATATAGGGGAAACGAAGATGTACAGTATCGCAC F:AAACCTATATCAAATGCTCAGACTC H0:C6SH-TTTGTTCACTCTCACTAT / rA / GGAAGAGATGCTGAGTGAAC-MB.

2. The detection method of the aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on a supramolecular organic framework as described in claim 1, characterized in that, The steps are as follows: (1) The three-electrode system of the electrochemical workstation was used for testing. The Ag / AgCl electrode was used as the reference electrode, the platinum wire electrode was used as the counter electrode, and the prepared aggregation-induced electrochemiluminescence microcystin-LR sensing platform based on supramolecular organic framework was used as the working electrode. The electrochemical workstation and the chemiluminescence detector were connected together. The high voltage of the photomultiplier tube was set to 600-800 V, the cyclic voltammetric scan potential range was 0 ~ 1.6 V, and the scan rate was 0.2-0.6 V / s. (2) In 10 mL of PBS buffer solution containing 50-100 μL of tri-n-propanediamine at pH 6.4-8.0, the electrochemiluminescence signal intensity generated by different concentrations of microcystin-LR standard solution was detected by an electrochemiluminescence system, and working curves were plotted. (3) Use the sample solution to be tested instead of the standard solution for determination.

Images