Peptide composition and application thereof

By designing specific peptide compositions for targeted antibody conjugation, the problem of disordered antibody conjugation in traditional conjugation methods is solved, improving the signal value and signal-to-noise ratio of immunoassay, and enhancing the sensitivity and specificity of detection.

CN121591849APending Publication Date: 2026-03-03HEAVYBIO INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511676435.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-14
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

Traditional chemical conjugation methods result in disordered antibody molecule conjugation, affecting the sensitivity and specificity of immunoassay. There is an urgent need for a method that can directionally conjugate antibodies.

Method used

By employing a specific peptide composition containing a first peptide and a second peptide, and through multiple rounds of mutation design and screening, targeted conjugation of antibodies can be achieved, avoiding random conjugation.

Benefits of technology

It improves the signal value and signal-to-noise ratio in immunoassay, reduces the background level, and enhances the sensitivity and specificity of the test.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention provides a peptide composition, the peptide composition comprises a first peptide and a second peptide, the amino acid sequence of the first peptide is X0-X1-R-A-X2-X3-X4-I-V-M-X5-D-X6-X7-K-X8-X9-R, and the amino acid sequence of the second peptide is as shown in SEQ ID NO: 20, SEQ ID NO: 24 or SEQ ID NO: 25. By utilizing the peptide composition, directional coupling of the antibody can be realized, and random coupling is avoided, so that the signal value and the signal-to-noise ratio in immunodetection are effectively improved, and the background level is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a peptide composition and its applications. Background Technology

[0002] Chemiluminescence immunoassay (CLIA) is an indispensable technique in modern clinical testing. It combines the high specificity of immune responses with the high sensitivity of chemiluminescence technology, enabling the detection of very low concentrations of target substances. It plays a crucial role in the determination of tumor markers, hormone levels, and viral antibodies. This method offers advantages such as a wide detection range, high automation, and safety and environmental friendliness, and has become one of the mainstream technologies in the field of in vitro diagnostics.

[0003] In immunoassays, antibody or antigen immobilization techniques are one of the key factors affecting detection performance. An ideal labeling method should maintain the activity and spatial structural integrity of biomolecules such as antibodies, ensuring that their antigen-binding sites are fully exposed and oriented towards the reaction phase.

[0004] Traditional chemical conjugation methods have significant limitations. Antibody molecules possess multiple functional groups (such as amino and carboxyl groups) available for conjugation, and the conjugation reaction is random, making it impossible to control a fixed orientation. The binding of the conjugate to the antibody is disordered, leading to the masking or conformational alteration of the antigen-binding site. Only the antibody-binding site can be fully exposed and bind to the target molecule. This conjugation method severely affects the sensitivity and specificity of immunoassay.

[0005] Therefore, there is an urgent need in this field for a method that can directionally conjugate antibodies. Summary of the Invention

[0006] To address the problems existing in the prior art, the present invention provides a peptide composition and a method for targeted antibody conjugation using the peptide composition.

[0007] In a first aspect, the present invention provides a peptide composition comprising a first peptide and a second peptide. The amino acid sequence of the first peptide is X0-X1-RA-X2-X3-X4-IVM-X5-D-X6-X7-K-X8-X9-R, where,

[0008] X0 is missing or is K.

[0009] X1 is missing or selected from K or A.

[0010] X2 is selected from G and D.

[0011] X3 is selected from A and P.

[0012] X4 is selected from P, H, S, T, and Q.

[0013] X5 is selected from V and T.

[0014] X6 is selected from Y, A, and L.

[0015] X7 is selected from Y, D, and S.

[0016] X8 is selected from P and R.

[0017] X9 is selected from L and A;

[0018] The amino acid sequence of the second peptide is shown in SEQ ID NO:20, SEQ ID NO:24 or SEQ ID NO:25.

[0019] In a second aspect, the present invention provides a nucleic acid molecular composition comprising a first nucleic acid molecule and a second nucleic acid molecule, wherein the first nucleic acid molecule encodes a first peptide of the peptide composition of the first aspect of the present invention, and the second nucleic acid molecule encodes a second peptide of the peptide composition of the first aspect of the present invention.

[0020] In a third aspect, the present invention provides a kit comprising:

[0021] (1) The peptide composition of the first aspect of the present invention;

[0022] or

[0023] (2) The nucleic acid molecular composition and optional expression vector of the second aspect of the present invention.

[0024] In a fourth aspect, the present invention provides the use of the peptide composition of the first aspect of the present invention, the nucleic acid molecular composition of the second aspect of the present invention, or the kit of the third aspect of the present invention in immunological detection.

[0025] In a fifth aspect, the present invention provides an antigen detection method, the method comprising the following steps:

[0026] (1) Add immune complexes to the test sample containing the antigen.

[0027] in,

[0028] The immune complex comprises a fusion protein of a first peptide of the peptide composition of the first aspect of the present invention and a first antibody, and a second peptide of the peptide composition of the first aspect of the present invention conjugated to a marker.

[0029] or

[0030] The immune complex comprises a fusion protein of a second peptide of the peptide composition of the first aspect of the present invention and a first antibody, and a first peptide of the peptide composition of the first aspect of the present invention coupled with a marker.

[0031] The first antibody is an antibody against the antigen;

[0032] (2) Add buffer solution to wash and remove unbound substances;

[0033] (3) The chemiluminescence reaction is excited by the triggering liquid, and the concentration of the antigen is determined according to the luminescence intensity.

[0034] In summary, the present invention provides a peptide composition and a method for targeted antibody conjugation using the peptide composition, which has the following beneficial effects:

[0035] The peptide composition of the present invention can achieve targeted conjugation of antibodies, avoiding random conjugation, thereby effectively improving the signal value and signal-to-noise ratio in immunoassay and reducing the background level. Attached Figure Description

[0036] To more clearly illustrate the technical solutions in the specific embodiments of the present invention, the accompanying drawings in the specific embodiments will be briefly described below.

[0037] Figure 1 All PTS sequences involved in this invention are shown.

[0038] Figure 2 The filtered PTS sequence of the present invention is shown.

[0039] Figure 3 The signal-to-noise ratio results of an embodiment of the present invention are shown. Detailed Implementation

[0040] The present invention will be described in detail below. It should be understood that the following description is merely illustrative and is not intended to limit the scope of the invention; the scope of protection of the invention is defined by the appended claims. Furthermore, those skilled in the art will understand that modifications can be made to the technical solutions of the present invention without departing from its spirit and intent. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter pertains. Before a detailed description of the invention, the following definitions are provided to better understand it.

[0042] In the context of this invention, many embodiments use the expressions "comprising," "including," or "basically / mainly composed of." The expressions "comprising," "including," or "basically / mainly composed of" should be understood as open-ended expressions, indicating that they include not only the elements, components, parts, and method steps specifically listed after the expression, but also other elements, components, parts, and method steps. Additionally, in this document, the expressions "comprising," "including," or "basically / mainly composed of" may also be understood as closed-ended expressions in certain circumstances, indicating that they only include the elements, components, parts, and method steps specifically listed after the expression, and do not include any other elements, components, parts, or method steps. In this case, the expression is equivalent to the expression "composed of."

[0043] It should be noted that, unless explicitly stated in the context, all numerical values ​​or ranges mentioned in this article are defined by the term "about". In this article, for a given numerical value, the term "about" means ±5% of that value, such as ±4%, ±3%, ±2%, or ±1%. For a range of numerical values, the term "about" means ±5% of the upper or lower limit of that range, such as ±4%, ±3%, ±2%, or ±1%.

[0044] In this paper, ordinal numbers such as "first," "second," and "third" are sometimes used to modify or limit elements, components, parts, method steps, solutions, solvents, temperatures, systems, etc. It should be noted that in this paper, these expressions are only used to distinguish the elements, components, parts, method steps, solutions, solvents, temperatures, systems, etc. that they modify or limit, and are not intended to limit their order or importance.

[0045] In this document, amino acids are generally represented by single-letter or three-letter abbreviations known in the art. For example, alanine can be represented by Ala or A, glycine by Gly or G, valine by Val or V, leucine by Leu or L, isoleucine by Ile or I, proline by Pro or P, phenylalanine by Phe or F, tyrosine by Tyr or Y, tryptophan by Trp or W, serine by Ser or S, threonine by Thr or T, cysteine ​​by Cys or C, methionine by Met or M, asparagine by Asn or N, glutamine by Gln or Q, aspartic acid by Asp or D, glutamic acid by Glu or E, lysine by Lys or K, arginine by Arg or R, and histidine by His or H.

[0046] Similarly, in this paper, nucleotides or bases are represented by single-letter abbreviations, for example, adenine is represented by A, guanine by G, cytosine by C, and thymine by T.

[0047] As previously stated, the present invention aims to provide a peptide composition and a method for targeted antibody conjugation using the peptide composition.

[0048] The inventors of this invention used Streptococcus canis ( Streptococcus canis Based on the peptide (SEQ ID NO:55), mutations were designed according to the predicted three-dimensional structure of the protein to construct a series of mutants. Among numerous mutants ( Figure 1 By screening for peptide combinations that can be efficiently and specifically linked, targeted labeling of antibodies can be achieved.

[0049] Therefore, in a first aspect, the present invention provides a peptide composition comprising a first peptide (also referred to herein as "PTS") and a second peptide (also referred to herein as "PTL"),

[0050] The amino acid sequence of the first peptide is X0-X1-RA-X2-X3-X4-IVM-X5-D-X6-X7-K-X8-X9-R, where,

[0051] X0 is missing or is K.

[0052] X1 is missing or selected from K or A.

[0053] X2 is selected from G and D.

[0054] X3 is selected from A and P.

[0055] X4 is selected from P, H, S, T, and Q.

[0056] X5 is selected from V and T.

[0057] X6 is selected from Y, A, and L.

[0058] X7 is selected from Y, D, and S.

[0059] X8 is selected from P and R.

[0060] X9 is selected from L and A;

[0061] The amino acid sequence of the second peptide is shown in SEQ ID NO:20, SEQ ID NO:24 or SEQ ID NO:25.

[0062] In one embodiment, the amino acid sequence of the first peptide is as shown in SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 or SEQ ID NO:18. Figure 2 ).

[0063] Inventor based on Streptococcus canis Through multiple rounds of mutation and testing, it was discovered that the PTS+PTL combination mentioned above can achieve efficient and specific binding, thereby enabling targeted conjugation of antibodies and avoiding random conjugation. This effectively improves the signal value and signal-to-noise ratio in immunoassay and reduces the background level.

[0064] In a second aspect, the present invention provides a nucleic acid molecular composition comprising a first nucleic acid molecule and a second nucleic acid molecule, wherein the first nucleic acid molecule encodes a first peptide of the peptide composition of the first aspect of the present invention, and the second nucleic acid molecule encodes a second peptide of the peptide composition of the first aspect of the present invention.

[0065] In one specific implementation, the nucleic acid sequence corresponding to the amino acid sequence of the first peptide as shown in SEQ ID NO:3 may be as shown in SEQ ID NO:29;

[0066] The nucleic acid sequence corresponding to the amino acid sequence of the first peptide as shown in SEQ ID NO:5 can be as shown in SEQ ID NO:31;

[0067] The nucleic acid sequence corresponding to the amino acid sequence of the first peptide as shown in SEQ ID NO:10 can be as shown in SEQ ID NO:36;

[0068] The nucleic acid sequence corresponding to the amino acid sequence of the first peptide as shown in SEQ ID NO:11 can be as shown in SEQ ID NO:37;

[0069] The nucleic acid sequence corresponding to the amino acid sequence of the first peptide as shown in SEQ ID NO:13 can be as shown in SEQ ID NO:39;

[0070] The nucleic acid sequence corresponding to the amino acid sequence of the first peptide as shown in SEQ ID NO:15 can be as shown in SEQ ID NO:41;

[0071] The nucleic acid sequence corresponding to the amino acid sequence of the first peptide as shown in SEQ ID NO:16 can be as shown in SEQ ID NO:42;

[0072] The nucleic acid sequence corresponding to the amino acid sequence of the first peptide as shown in SEQ ID NO:17 can be as shown in SEQ ID NO:43;

[0073] The nucleic acid sequence corresponding to the amino acid sequence of the first peptide, as shown in SEQ ID NO:18, can be as shown in SEQ ID NO:44.

[0074] In another specific embodiment, the nucleic acid sequence corresponding to the amino acid sequence of the second peptide as shown in SEQ ID NO:20 can be as shown in SEQ ID NO:46;

[0075] The nucleic acid sequence corresponding to the amino acid sequence of the second peptide as shown in SEQ ID NO:24 can be as shown in SEQ ID NO:50;

[0076] The nucleic acid sequence corresponding to the amino acid sequence of the second peptide, as shown in SEQ ID NO:25, can be as shown in SEQ ID NO:51.

[0077] In a third aspect, the present invention provides a kit comprising:

[0078] (1) The peptide composition of the first aspect of the present invention;

[0079] or

[0080] (2) The nucleic acid molecular composition and optional expression vector of the second aspect of the present invention.

[0081] In one embodiment, the expression vector is a eukaryotic expression vector and / or a prokaryotic expression vector. In a preferred embodiment, the expression vector is a eukaryotic expression vector pCDNA3.1 and a prokaryotic expression vector pET28a(+). In one specific embodiment, a first nucleic acid molecule is inserted into the multiple cloning site of the eukaryotic expression vector pCDNA3.1, and a second nucleic acid molecule is inserted into the multiple cloning site of the prokaryotic expression vector pET28a(+). In another specific embodiment, a second nucleic acid molecule is inserted into the multiple cloning site of the eukaryotic expression vector pCDNA3.1, and a first nucleic acid molecule is inserted into the multiple cloning site of the prokaryotic expression vector pET28a(+).

[0082] In one embodiment, the kit further comprises a DNA ligase. In a specific embodiment, the DNA ligase may be a T4 DNA ligase, a T7 DNA ligase, or... E. coli DNA ligases, but not limited to these.

[0083] In a fourth aspect, the present invention provides the use of the peptide composition of the first aspect of the present invention, the nucleic acid molecular composition of the second aspect of the present invention, or the kit of the third aspect of the present invention in immunological detection.

[0084] In one embodiment, the immunological assay may be the targeted conjugation of an antibody or the targeted conjugation of an antigen. In a preferred embodiment, the immunological assay is the detection of cancer antigen CA15-3.

[0085] In a fifth aspect, the present invention provides an antigen detection method, the method comprising the following steps:

[0086] (1) Add immune complexes to the test sample containing the antigen.

[0087] in,

[0088] The immune complex comprises a fusion protein of a first peptide of the peptide composition of the first aspect of the present invention and a first antibody, and a second peptide of the peptide composition of the first aspect of the present invention conjugated to a marker.

[0089] or

[0090] The immune complex comprises a fusion protein of a second peptide of the peptide composition of the first aspect of the present invention and a first antibody, and a first peptide of the peptide composition of the first aspect of the present invention coupled with a marker.

[0091] The first antibody is an antibody against the antigen;

[0092] (2) Add buffer solution to wash and remove unbound substances;

[0093] (3) The chemiluminescence reaction is excited by the triggering liquid, and the concentration of the antigen is determined according to the luminescence intensity.

[0094] In this method, the number of the first peptide and / or second peptide in the immune complex is not particularly limited and can be 1, 2, 3 or more. In one embodiment, the fusion protein of the immune complex may comprise a first antibody and two first peptides (i.e., "first antibody"-"first peptide"-"first peptide"), and two second peptides conjugated to a label (i.e., "second peptide"-"second peptide"-"label"). In a specific embodiment, the fusion protein of the immune complex may comprise a first antibody and two first peptides (SEQ ID NO:3 and SEQ ID NO:5) (i.e., "first antibody"-"SEQ ID NO:3"-"SEQ ID NO:5"), and two second peptides conjugated to a label (i.e., "SEQ ID NO:20"-"SEQ ID NO:24"-"label"). In another specific embodiment, the fusion protein of the immune complex may include a first antibody and two first peptides (SEQ ID NO:5 and SEQ ID NO:5) (i.e., “first antibody”-“SEQ ID NO:5”-“SEQ ID NO:5”), and two second peptides conjugated to a marker (i.e., “SEQ ID NO:20”-“SEQ ID NO:20”-“marker”).

[0095] In one embodiment, the marker is alkaline phosphatase or acridine ester. In one specific embodiment, the PTL protein is chemically coupled to the marker alkaline phosphatase (AP) using a maleimide heterobifunctional cross-linking agent to obtain a PTL-AP conjugate. In another specific embodiment, the PTL protein is chemically coupled to the marker acridine ester (AE) using an N-hydroxysuccinimide (NHS) ester chemical coupling method to obtain a PTL-AE conjugate. Those skilled in the art will understand that PTS-AP / AE conjugates can be obtained using the above methods.

[0096] In one embodiment, the triggering liquid is hydrogen peroxide, used to excite the chemiluminescent reaction.

[0097] In one embodiment, the antigen is cancer antigen CA15-3.

[0098] In one embodiment, the antigen detection method of the present invention may further use a second antibody, employing a double-antibody sandwich chemiluminescent immunoassay to detect the antigen. In a specific embodiment, in step (1), magnetic beads coated with a second antibody complex are added, with the first antibody and the second antibody targeting different epitopes of the antigen to be detected.

[0099] In one specific implementation, step (1) can be: adding magnetic beads coated with a second antibody complex and adding an immune complex to the sample to be tested, and then performing the test; adding magnetic beads coated with a second antibody complex and an immune complex to the sample to be tested simultaneously, and then performing the test; adding the sample to be tested to a mixture of magnetic beads coated with a second antibody complex and an immune complex, and then performing the test; or adding an immune complex and magnetic beads coated with a second antibody complex to the sample to be tested, and then performing the test.

[0100] Example

[0101] The present invention and its technical effects will be clearly and completely described below with reference to embodiments and accompanying drawings, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0102] Example 1

[0103] 1) Construction of expression vector

[0104] The nucleic acid sequences encoding PTS1-7 (SEQ ID NO:27-33, corresponding to the amino acid sequences shown in SEQ ID NO:1-7) were obtained through gene synthesis. Using conventional molecular biology methods of enzyme digestion and ligation, the PTS nucleic acid fragment and the anti-CA15-3 antibody nucleic acid fragment were sequentially inserted into the multiple cloning site of the eukaryotic expression vector pCDNA3.1 to construct the recombinant plasmid pCDNA-Ab-PTS, which can simultaneously express the anti-CA15-3 antibody and the PTS fusion protein. The nucleic acid sequences of the VH and VL regions of the anti-CA15-3 antibody used in this embodiment are shown in SEQ ID NO:53 and SEQ ID NO:54, respectively.

[0105] The nucleic acid sequences encoding PTL1-3 (SEQ ID NO:45-47, corresponding to the amino acid sequences shown in SEQ ID NO:19-21) were obtained by gene synthesis. The PTL nucleic acid fragments were then inserted into the multiple cloning site of the prokaryotic expression vector pET28a(+) using the same enzyme digestion and ligation method to construct the recombinant plasmid pET28-PTL expressing PTL.

[0106] 2) Protein expression and purification

[0107] Expression and purification of Ab1-PTS protein: The pCDNA-Ab1-PTS recombinant plasmid was transfected into HEK293T cells in logarithmic growth phase using the calcium phosphate method. Cell culture supernatant was collected 48-72 hours after transfection. High-purity Ab-PTS fusion protein was obtained from the supernatant using affinity chromatography.

[0108] Expression and purification of PTL protein: The pET28-PTL recombinant plasmid was transformed into Escherichia coli BL21(DE3) competent cells. After expression was induced by IPTG (isopropyl-β-D-thiogalactoside), high-purity PTL protein was obtained by affinity chromatography.

[0109] 3) Chemical coupling of markers

[0110] The purified PTL protein was chemically coupled with the labeled acridine ester (AE) using the N-hydroxysuccinimide (NHS) ester chemical coupling method to obtain the PTL-AE conjugate.

[0111] 4) Preparation of R2 reagent

[0112] Take 15 μL of Ab1-PTS protein solution with a concentration of 1 mg / mL and 5 μL of PTL-AE conjugate solution with a concentration of 1 mg / mL, and mix them in a 1.5 mL centrifuge tube at a molar ratio of 1:2.

[0113] The mixture was subjected to shaking at 200 rpm for 1 hour at room temperature (25°C) to allow the PTS fragment of the Ab1-PTS protein to bind fully and specifically to the PTL portion of the PTL-AE conjugate, forming a stable Ab1-PTS:PTL-AE immune complex.

[0114] The obtained immune complex was diluted 250-fold with PBS buffer to obtain the R2 reagent (AE-labeled antibody complex working solution). The prepared R2 reagent was aliquoted and stored at -20°C, avoiding repeated freeze-thaw cycles.

[0115] Take 1 mg of CA15-3 antibody Ab2 (heavy chain biological antibody HP108-6H), coat it with magnetic beads (0.2 mg / mL JSRMS160 / CA), and obtain reagent R1, which is the magnetic bead-coated antibody complex.

[0116] Ab1 was then directly labeled with acridine ester to obtain acridine ester-labeled Ab1 antibody. The concentration of the acridine ester-labeled antibody in the working solution was 0.3 μg / mL, which served as a control.

[0117] This embodiment employs a double-antibody sandwich chemiluminescent immunoassay. Reagents R1 and R2 form a "solid-phase antibody-antigen-luminescently labeled antibody" complex with the CA15-3 antigen in the sample (where Ab1 and Ab2 target different epitopes of CA15-3). After washing to remove unbound substances, a chemiluminescent reaction is triggered by a triggering solution, and the luminescence intensity is proportional to the concentration of CA15-3 antigen.

[0118] Example 2

[0119] 1) Sample pretreatment: Take 15 μL of human serum / plasma sample and dilute it 10 times with the matching diluent PBS.

[0120] 2) Construction of reaction system: The pre-diluted sample, the antibody-coated magnetic microparticle suspension (R1), and the acrid ester-labeled antibody solution (R2) were mixed at a volume ratio of 15:15:50 and incubated at 37°C for 15 minutes to form a complex.

[0121] 3) Separation and washing: The complex is fixed by applying a magnetic field and then washed three times with phosphate washing solution (pH 7.4) to remove unbound substances.

[0122] 4) Signal detection: Add hydrogen peroxide trigger solution (R3) and sodium hydroxide stop solution in sequence, and measure the relative luminescence intensity (RLU) on the chemiluminescence analyzer. The instrument will automatically call up the pre-stored calibration curve to calculate the concentration value.

[0123] The calibration method in this embodiment is as follows: each batch of reagents is equipped with CAL1 (low value) and CAL2 (high value) calibrators, and the calibration curve is fitted with a 4-parameter logistic equation (r≥0.9900).

[0124] The results are shown in Table 1. PTL1 and PTS1 are both wild-type sequences (WT), and their ligation efficiency is used as the standard, denoted as 1 fold, to measure the ligation efficiency of each mutant. The numbers in Table 1 represent the ligation efficiency of each combination relative to the wild type (the larger the value, the higher the efficiency). For example, the ligation efficiency of the PTL2+PTS3 combination is 90 times that of PTL1+PTS1.

[0125] Table 1

[0126] Example 3

[0127] Based on the results in Table 1, PTS1 / 2 / 4 / 7 and PTL1 / 3 were eliminated, while PTL2, PTS3, PTS5, and PTS6 were retained for a new round of mutations, resulting in PTL4-5 and PTS8-13. The nucleic acid sequences of PTS8-13 are shown in SEQ ID NO:34-39 (the corresponding amino acid sequences are shown in SEQ ID NO:8-13), and the nucleic acid sequences of PTL4-5 are shown in SEQ ID NO:48-49 (the corresponding amino acid sequences are shown in SEQ ID NO:22-23). ​​The ligation efficiency was tested using the same method as in Examples 1-2, and the results are shown in Table 2, where the numbers represent the ligation efficiency of each combination relative to the wild type.

[0128] Table 2

[0129] Example 4

[0130] Based on the results in Table 2, it can be seen that the ligation efficiency of PTL4 and PTL5 with PTS is low, therefore PTL4 and PTL5 are eliminated. The ligation efficiency of the PTS8+PTL2 combination is high, but its background value (without sample addition) is very high, so PTS8 is also eliminated. Finally, PTS6 / 8 / 9 / 12, as well as PTL4 and PTL5, are eliminated, while PTL2, PTS10, PTS11, and PTS13 are retained for a new round of mutations, resulting in PTL6-8 and PTS14-18. The nucleic acid sequences of PTS14-18 are shown in SEQ ID NO:40-44 (the corresponding amino acid sequences are shown in SEQ ID NO:14-18), and the nucleic acid sequences of PTL6-8 are shown in SEQ ID NO:50-52 (the corresponding amino acid sequences are shown in SEQ ID NO:24-26). The ligation efficiency was tested using the same method as in Examples 1-2, and the test results are shown in Table 3, where the numbers represent the multiples of the ligation efficiency of each combination relative to the wild type.

[0131] Table 3

[0132] According to the results in Table 3, PTS14 is slightly worse than other PTSs. Among the PTSs, PTS3, PTS5, PTS10, PTS11, PTS13, PTS15, PTS16, PTS17, and PTS18 have excellent performance; PTL6 / 7 are the best, followed by PTL2.

[0133] Example 5

[0134] Using the same method as in Examples 1-2, this example uses 18 different PTL+PTS combinations of PTS3, PTS5, PTS10, PTS11, PTS13, PTS15, PTS16, PTS17, PTS18 and PTL6 and PTL7 obtained in Example 4 to detect the CA15-3 antigen in 20 samples, and compares the test results with the results of the direct AE control.

[0135] In this embodiment, the signal enhancement factor (mean) of each PTL+PTS combination relative to the control is calculated as follows:

[0136] 1) For each PTL+PTS combination and direct control, CA15-3 antigen was measured in 20 samples simultaneously.

[0137] 2) Two measurement results were obtained for each sample: Group A (PTL+PTS combined measurement value) and Group B (control measurement value).

[0138] 3) Calculate the signal value multiple for each sample: (Measurement value of group A / Measurement value of group B) × 100%.

[0139] 4) Calculate the arithmetic mean of the signal value multiples of all 20 samples to obtain the average signal value multiple of the PTL+PTS combination relative to the control. The results are shown in Table 4.

[0140] Table 4

[0141] The results in Table 4 show that the signal values ​​measured by the above 18 PTL+PTS combinations were significantly improved compared with the control.

[0142] In addition, this embodiment further evaluated the signal-to-noise ratio (SNR) performance of 18 different PTL+PTS combinations and direct AE control based on the comparison of signal values. This indicator can more comprehensively reflect the detection system's ability to distinguish between effective signals and background noise.

[0143] The specific calculation methods for the signal-to-noise ratio of each PTL+PTS combination and the control are as follows:

[0144] 1) Calculate the signal-to-noise ratio (SNR) for a single measurement: For each PTL+PTS combination and direct AE control, calculate the SNR for each sample. The signal-to-noise ratio (SNR) is defined as the ratio of the signal value to the background value (without samples).

[0145] 2) Calculate the average signal-to-noise ratio of the PTL+PTS combination: For each PTL+PTS combination, calculate the arithmetic mean of the signal-to-noise ratio (SNR) values ​​obtained from 20 samples. The result is the average signal-to-noise ratio of the PTL+PTS combination.

[0146] 3) Calculate the average signal-to-noise ratio of the control: For the direct-connected AE control, calculate the arithmetic mean of the signal-to-noise ratio (SNR) values ​​of its 20 samples. The result is the average signal-to-noise ratio of the control.

[0147] The results are as follows Figure 3 As shown, the peptide composition of the present invention can improve the signal-to-noise ratio (SNR) in the antigen detection process. The SNR of the peptide composition of the present invention is stable in the range of 34 to 55, with an average of about 47.5 and a median of 47. This represents a performance improvement of 2.4 to 3.9 times (an average improvement of about 3.4 times) compared to a baseline level of only 14 for the control. Furthermore, the SNR data points of the peptide composition of the present invention are concentrated in the high-value region, indicating that the peptide composition of the present invention not only significantly improves the signal intensity but also effectively suppresses background noise, resulting in a detection system with extremely high sensitivity and excellent stability, as well as a lower limit of detection (LoD) and higher detection precision, providing a solid guarantee for the accurate and reliable detection of clinical samples.

[0148] The above provides a detailed description of a peptide composition and its applications provided by the present invention. Specific embodiments are used to illustrate the principles and implementation methods of the present invention. The descriptions of the above embodiments are only for the purpose of helping to understand the method and core ideas of the present invention. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of the present invention. Therefore, the content of this specification should not be construed as a limitation of the present invention.

[0149] The sequences used in this invention:

[0150] SEQ ID NO:1

[0151] TADAPIVMVDYDKPLI

[0152] SEQ ID NO:2

[0153] RADAPIVMVDYDKPLR

[0154] SEQ ID NO:3

[0155] RAGAPIVMVDLYKPLR

[0156] SEQ ID NO:4

[0157] RADADIVMVDYDKRLR

[0158] SEQ ID NO:5

[0159] KARADATIVMVDYDKRLR

[0160] SEQ ID NO:6

[0161] RADATIVMVDYDKRAR

[0162] SEQ ID NO:7

[0163] RADATIDMVDYDKRLR

[0164] SEQ ID NO:8

[0165] RAGATIVMVDLYKRAR

[0166] SEQ ID NO:9

[0167] RASVTIVMVDYDKRAR

[0168] SEQ ID NO:10

[0169] KARAGASIVMVDYDKRAR

[0170] SEQ ID NO:11

[0171] RAGATIVMTYSKRAR

[0172] SEQ ID NO:12

[0173] KARAAVTIVMVDYSKRAK

[0174] SEQ ID NO:13

[0175] KRADAQIVMVDYDKRAR

[0176] SEQ ID NO:14

[0177] RAGATIVMVDLYKPLR

[0178] SEQ ID NO:15

[0179] RAGATIVMVDYSKPLR

[0180] SEQ ID NO:16

[0181] RAGAPIVMTDAYKRAR

[0182] SEQ ID NO:17

[0183] RAGPPIVMTDAYKRLR

[0184] SEQ ID NO:18

[0185] RAGAHIVMTDYSKRAR

[0186] SEQ ID NO:19

[0187] VDTLSGLSGEQGQSGDTTIEEDSATHIKFSKRDIDGKELAGATIELRDSSGKTISTWVSDGHVKDFYLMPGKYTFVETAAPEGYALATAIRVTIEASGQVLVNGKAVTADAPI

[0188] SEQ ID NO:20

[0189] VDTLSGLSGEQGPSGDTTSEEDSATHIKFSKRDEDGKELAGATIELRDSSGKTISTWVSDGHVKDFYLMPGKYTFVETAAPEGYELATPIEVTIEADGQVLVDGEAVTEDAPS

[0190] SEQ ID NO:21

[0191] VDTLSGLSGEQGQSGDTTIEDSATHIKFSKRDEDGKELAGATIELRDSSGKTISTWVSDGHVKDFYLEPGKYTFVETAAPEGYELATAIEFTIEDEGEVLVDGEAVTEDAPS

[0192] SEQ ID NO:22

[0193] VDTLSGLSGEQGPSGDTTSEEDSATHIKFSKRDEDGKELASATIELRDSSGKTISTWVSDGHVKDFYLMPGKYTFQETAAPEAYELATPIEITIEADGQVLVDGEAVTEDAPS

[0194] SEQ ID NO:23

[0195] VDTLSGLSGEQGPSGDTTSEEDSATEIKFSKRDEDGKELASATIELRDSSGKTISTWVSDGHVKDFYLMPGKYTFQETAAPEAYELATPIEITIEADGQVLVDGEAVTEDAPS

[0196] SEQ ID NO:24

[0197] VDTLSGLSGEQGPSGDTTSEEDSATHIKFSKRDEDGKELAGATIELRDSSGKTISTWVSDGHVKDFYLYPGKYTFVETAAPEGYELATPIEVTIEADGQVLVDGEAVTEDAPS

[0198] SEQ ID NO:25

[0199] VDTLSGLSGEQGPSGDTTSEEDSATHIKFSKRDEDGRELAGATIELRDSSGKTISTWVSDGHVKDFYLYPGKYTFVETAAPEGYELATPIEFTIEADGQVLVDGEAVTEDAPS

[0200] SEQ ID NO:26

[0201] VDTLSGLSGEQGPSGDTTSEEDSATHIKFSKRDEDGRELAGATIELRDSSGKTISTWVSDGHVKDFYLYPGKYTFVETAAPEGYELATPIEFTIEDEGEVLVDGEAVTEDAPS

[0202] SEQ ID NO:27

[0203] ACCGCCGACGCCCCCATCGTGATGGTGGACTACGACAAGCCCCTGATC

[0204] SEQ ID NO:28

[0205] AGGGCCGACGCCCCCATCGTGATGGTGGACTACGACAAGCCCCTGAGG

[0206] SEQ ID NO:29

[0207] AGGGCCGGCGCCCCCATCGTGATGGTGGACCTGTACAAGCCCCTGAGG

[0208] SEQ ID NO:30

[0209] AGGGCCGACGCCGACATCGTGATGGTGGACTACGACAAGAGGCTGAGG

[0210] SEQ ID NO:31

[0211] AAGGCCAGGGCCGACGCCCACATCGTGATGGTGGACTACGACAAGAGACTGAGG

[0212] SEQ ID NO:32

[0213] AGGGCCGACGCCACCATCGTGATGGTGGACTACGACAAGCGGGCTAGG

[0214] SEQ ID NO:33

[0215] AGGGCCGACGCCACCATCGACATGGTGGACTACGACAAGAGACTGAGG

[0216] SEQ ID NO:34

[0217] AGGGCCGGCGCCACCATCGTGATGGTGGACCTGTACAAGCGGGCTAGG

[0218] SEQ ID NO:35

[0219] AGGGCCAGCGTGACCATCGTGATGGTGGACTACGACAAGCGGGCTAGG

[0220] SEQ ID NO:36

[0221] AAGGCCAGGGCCGGCGCCAGCATCGTGATGGTGGACTACGACAAGCGGGCTAGG

[0222] SEQ ID NO:37

[0223] AGGGCCGGCGCCACCATCGTGATGACCGACTACAGCAAGCGGGCTAGG

[0224] SEQ ID NO:38

[0225] AAGGCCAGGGCCGCCGTGACCATCGTGATGGTGGACTACAGCAAGCGGGCTAAG

[0226] SEQ ID NO:39

[0227] AAGAGGGCCGACGCCCAGATCGTGATGGTGGACTACGACAAGCGGCTAGG

[0228] SEQ ID NO:40

[0229] AGGGCCGGCGCCaCCATCGTGATGGTGGACCTGTACAAGCCCCTGAGG

[0230] SEQ ID NO:41

[0231] AGGGCCGGCGCCACCATCGTGATGgtgGACTACAGCAAGCCCCTGAGG

[0232] SEQ ID NO:42

[0233] AGGGCCGGCGCCCCCATCGTGATGaccGACgccTACAAGCGGGCTAGG

[0234] SEQ ID NO:43

[0235] AGGGCCGGCcctCCCATCGTGATGaccGACgccTACAAGCGGctgAGG

[0236] SEQ ID NO:44

[0237] AGGGCCGGCGCCCaCATCGTGATGaccGACTACAGCAAGCGGGCTAGG

[0238] SEQ ID NO:45

[0239] GTGGACACCCTGAGCGGCCTGTCCGGCGAGCAGGGGCAGAGCGGCGACACCACAATCGAGGAGGACAGCGCCACCCACATCAAGTTCAGCAAAAGGGACATTGATGGGAAGGAGCTGGCTGGGGCTACAATTGAGCTGAGGGACAGCAGCGGCAAGACCATCAGCACCTGGGTGTCTGACGGCCACGTGAAGGACTTCTACCTGATGCCCGGCAAGTACACCTTCGTGGAGACAGCTGCCCCCGAGGGCTACGCCCTGGCCACCGCCATTAGGGTGACCATCGAGGCCAGCGGCCAGGTCCTGGTGAACGGCAAGGCCGTGACCGCCGACGCCCCCATCTAA

[0240] SEQ ID NO:46

[0241] GTGGACACCCTGAGCGGCCTGTCCGGCGAGCAGGGGCCCAGCGGCGACACCACAAGCGAGGAGGACAGCGCCACCCACATCAAGTTCAGCAAAAGGGACGAGGATGGGAAGGAGCTGGCTGGGGCTACAATTGAGCTGAGGGACAGCAGCGGCAAGACCATCAGCACCTGGGTGTCTGACGGCCACGTGAAGGACTTCTACCTGATGCCCGGCAAGTACACCTTCGTGGAGACAGCTGCCCCCGAGGGCTACGAACTGGCCACCCCCATTGAGGTGACCATCGAGGCCGATGGCCAGGTCCTGGTGGACGGCGAGGCCGTGACCGAGGACGCCCCCAGCTAA

[0242] SEQ ID NO:47

[0243] GTGGACACCCTGAGCGGCCTGTCCGGCGAGCAGGGGCAGAGCGGCGACACCACAATCGAGGAGGACAGCGCCACCCACATCAAGTTCAGCAAAAGGGACGAGGATGGGAAGGAGCTGGCTGGGGCTACAATTGAGCTGAGGGACAGCAGCGGCAAGACCATCAGCACCTGGGTGTCTGACGGCCACGTGAAGGACTTCTACCTGGAGCCCGGCAAGTACACCTTCGTGGAGACAGCTGCCCCCGAGGGCTACGAACTGGCCACCGCCATTGAGTTCACCATCGAGGACGAGGGCGAGGTCCTGGTGGACGGCGAGGCCGTGACCGAGGACGCCCCCAGCTAA

[0244] SEQ ID NO:48

[0245] GTGGACACCCTGAGCGGCCTGTCCGGCGAGCAGGGGCCCAGCGGCGACACCACAAGCGAGGAGGACAGCGCCACCCACATCAAGTTCAGCAAAAGGGACGAGGATGGGAAGGAGCTGGCTAGCGCTACAATTGAGCTGAGGGACAGCAGCGGCAAGACCATCAGCACCTGGGTGTCTGACGGCCACGTGAAGGACTTCTACCTGATGCCCGGCAAGTACACCTTCCAGGAGACAGCTGCCCCCGAGGCATACGAACTGGCCACCCCCATTGAGATTACCATCGAGGCCGATGGCCAGGTCCTGGTGGACGGCGAGGCCGTGACCGAGGACGCCCCCAGCTAA

[0246] SEQ ID NO:49

[0247] GTGGACACCCTGAGCGGCCTGTCCGGCGAGCAGGGGCCCAGCGGCGACACCACAAGCGAGGAGGACAGCGCCACCGAAATCAAGTTCAGCAAAAGGGACGAGGATGGGAAGGAGCTGGCTAGCGCTACAATTGAGCTGAGGGACAGCAGCGGCAAGACCATCAGCACCTGGGTGTCTGACGGCCACGTGAAGGACTTCTACCTGATGCCCGGCAAGTACACCTTCCAGGAGACAGCTGCCCCCGAGGCATACGAACTGGCCACCCCCATTGAGATTACCATCGAGGCCGATGGCCAGGTCCTGGTGGACGGCGAGGCCGTGACCGAGGACGCCCCCAGCTAA

[0248] SEQ ID NO:50

[0249] GTGGACACCCTGAGCGGCCTGTCCGGCGAGCAGGGGCCCAGCGGCGACACCACAAGCGAGGAGGACAGCGCCACCCACATCAAGTTCAGCAAAAGGGACGAGGATGGGAAGGAGCTGGCTGGGGCTACAATTGAGCTGAGGGACAGCAGCGGCAAGACCATCAGCACCTGGGTGTCTGACGGCCACGTGAAGGACTTCTACCTGTACCCCGGCAAGTACACCTTCGTGGAGACAGCTGCCCCCGAGGGCTACGAACTGGCCACCCCCATTGAGGTGACCATCGAGGCCGATGGCCAGGTCCTGGTGGACGGCGAGGCCGTGACCGAGGACGCCCCCAGCTAA

[0250] SEQ ID NO:51

[0251] GTGGACACCCTGAGCGGCCTGTCCGGCGAGCAGGGGCCCAGCGGCGACACCACAAGCGAGGAGGACAGCGCCACCCACATCAAGTTCAGCAAAAGGGACGAGGATGGGcgtGAGCTGGCTGGGGCTACAATTGAGCTGAGGGACAGCAGCGGCAAGACCATCAGCACCTGGGTGTCTGACGGCCACGTGAAGGACTTCTACCTGTACCCCGGCAAGTACACCTTCGTGGAGACAGCTGCCCCCGAGGGCTACGAACTGGCCACCCCCATTGAGTTTACCATCGAGGCCGATGGCCAGGTCCTGGTGGACGGCGAGGCCGTGACCGAGGACGCCCCCAGCTAA

[0252] SEQ ID NO:52

[0253] GTGGACACCCTGAGCGGCCTGTCCGGCGAGCAGGGGCCCAGCGGCGACACCACAAGCGAGGAGGACAGCGCCACCCACATCAAGTTCAGCAAAAGGGACGAGGATGGGCGTGAGCTGGCTGGGGCTACAATTGAGCTGAGGGACAGCAGCGGCAAGACCATCAGCACCTGGGTGTCTGACGGCCACGTGAAGGACTTCTACCTGTACCCCGGCAAGTACACCTTCGTGGAGACAGCTGCCCCCGAGGGCTACGAACTGGCCACCCCCATTGAGTTTACCATCGAGGACGAGGGCGAGGTCCTGGTGGACGGCGAGGCCGTGACCGAGGACGCCCCCAGCTAA

[0254] SEQ ID NO:53

[0255] CAGGTGCAGCTGAAAGAGTCCGGACCTGGCCTGGTGGCCCCCTCCCAGTCCCTGAGCATCACCTGCACCGTGAGCGGCTATACCTTCAGCTATTATGGCCTGCATTGGTTCCGGCAGCCTCCTGGCGAGGGACTCGAGTGGCTGGGCGTCATCCTGCCCGGCACCGGCAGCACTCACTACAATTCCGCCCTGATGAGCAGGCTGTCTATCAGAAAGGACAATAGCAAGTCTCAGGGCTTCCTGCAGATGAACAGCCTGCAGGCCGATGACACCGCCATTTACTACTGCGCCAGAGACTATGGCAACTACTTTGACTACTGGGGCCAGGGCACATCTGTGACTGTGTCATCCTGA

[0256] SEQ ID NO:54

[0257] AACACCGTGATGACCCAGTCCCCTAAGTCCATGAGCGTGTCTGTGGGGGAGCGGGTGACACTGAGCTGTAAGAGCTCCGAGAGCCTGCTGAACACCTCTATCCAGAAGAACTACCTGGCCTGGTACCAGCAGAAGCCCGAGCAGAGCCCCAAACTGCTGATCTACAGCGCTTCTACTAGAGTTAGCGGCGTGCCCGACAGGTTTACCGGCAGCGGGAGCACCACTGAGTTCACACTGACAATCAGCAGCGTGCAGGCAGAGGACCTGGCCGACTATCACTGTCAGCAGCACTTCAACACCCCCCTGACATTCGGCGGCGGCACCAAGCTGGAGATCAAGTGA

[0258] SEQ ID NO:55

[0259] VDTLSGLSGEQGQSGDTTIEEDSATHIKFSKRDIDGKELAGATIELRDSSGKTISTWVSDGHVKDFYLMPGKYTFVETAAPEGYALATAIRVTIEASGQVLVNGKAVTADAPI

Claims

1. A peptide composition comprising a first peptide and a second peptide, The amino acid sequence of the first peptide is X0-X1-RA-X2-X3-X4-IVM-X5-D-X6-X7-K-X8-X9-R, where, X0 is missing or is K. X1 is missing or selected from K or A. X2 is selected from G and D. X3 is selected from A and P. X4 is selected from P, H, S, T, and Q. X5 is selected from V and T. X6 is selected from Y, A, and L. X7 is selected from Y, D, and S. X8 is selected from P and R. X9 is selected from L and A; The amino acid sequence of the second peptide is shown in SEQ ID NO:20, SEQ ID NO:24 or SEQ ID NO:

25.

2. The peptide composition according to claim 1, wherein, The amino acid sequence of the first peptide is shown in SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 or SEQ ID NO:

18.

3. A nucleic acid molecular composition comprising a first nucleic acid molecule and a second nucleic acid molecule, wherein the first nucleic acid molecule encodes a first peptide of the peptide composition according to claim 1 or 2, and the second nucleic acid molecule encodes a second peptide of the peptide composition according to claim 1 or 2.

4. A kit comprising: (1) The peptide composition according to claim 1 or 2; or (2) The nucleic acid molecular composition and optional expression vector according to claim 3.

5. The kit according to claim 4, wherein, The expression vector is a eukaryotic expression vector and / or a prokaryotic expression vector; preferably, the expression vector is the eukaryotic expression vector pCDNA3.1 and the prokaryotic expression vector pET28a(+).

6. The kit according to claim 5, wherein, The kit also contains DNA ligases, such as T4 DNA ligase, T7 DNA ligase, and E. coli DNA ligase.

7. Use of the peptide composition of claim 1 or 2, the nucleic acid molecular composition of claim 3, or the kit of any one of claims 4-6 in immunological detection (e.g., targeted conjugation of antibodies, targeted conjugation of antigens, preferably detection of CA15-3).

8. An antigen detection method, the method comprising the following steps: (1) Add immune complexes to the test sample containing the antigen. in, The immune complex comprises a fusion protein of a first peptide of the peptide composition of claim 1 or 2 and a first antibody, and a second peptide of the peptide composition of claim 1 or 2 conjugated to a marker. or The immune complex comprises a fusion protein of a second peptide of the peptide composition of claim 1 or 2 and a first antibody, and a first peptide of the peptide composition of claim 1 or 2 conjugated to a marker. The first antibody is an antibody against the antigen; (2) Add buffer solution to wash and remove unbound substances; (3) The chemiluminescence reaction is excited by a triggering liquid (e.g., hydrogen peroxide), and the concentration of the antigen is determined based on the luminescence intensity.

9. The method according to claim 8, wherein, The marker is alkaline phosphatase or acridine ester.

10. The method according to claim 8 or 9, wherein, The antigen is CA15-3.