Production and application of ganoderic acid based on acetyltransferase GlAT

Abstract

The invention relates to production and application of ganoderic acid based on acetyltransferase GlAT, which comprises the following steps: transforming acetyltransferase GlAT in ganoderma lucidum into a corresponding saccharomyces cerevisiae strain for heterologous expression, and implementing heterologous biosynthesis of ganoderic acid TN (GA-TN), ganoderic acid X (GA-X) and ganoderic acid T-Q (GA-T-Q) through fermentation culture, furthermore, GlAT yeast microsomes are prepared to perform in-vitro enzymatic reaction, so that the production of ganoderic acid R (GA-R), ganoderic acid P (GA-P), ganoderic acid Mk (GA-Mk), ganoderic acid T (GA-T) and ganoderic acid T1 (GA-T1) is realized. According to the invention, acetyltransferase participating in ganoderic acid biosynthesis is excavated and identified and is subjected to heterologous expression in saccharomyces cerevisiae, and a plurality of ganoderic acid compounds are obtained through fermentation culture or microsome reaction.

Description

Technical Field

[0001] This invention relates to a technology in the field of bioengineering, specifically a method for heterologous production of compounds such as ganoderic acid TN (GA-TN) based on the acetyltransferase GluAT using synthetic biology techniques. Background Technology

[0002] Ganoderic acids are a class of highly oxidized lanosterane-type tetracyclic triterpenoids with rich biological activities. However, due to the difficulty in cultivating Ganoderma lucidum, its long growth cycle, relatively low content of metabolites, and the lack of mature gene manipulation methods, researchers' understanding of the biosynthetic pathways of ganoderic acids is limited and progress is slow, which greatly restricts their production and application. Summary of the Invention

[0003] This invention addresses the problem of the lack of key catalytic elements for downstream biosynthetic pathways in existing ganoderic acid production technologies. It proposes a method for the production and application of ganoderic acid based on the acetyltransferase GluAT. By identifying and heterologously expressing the acetyltransferase involved in the biosynthesis of ganoderic acid in Saccharomyces cerevisiae, various ganoderic acid compounds are obtained through fermentation culture or microsomal reaction.

[0004] This invention is achieved through the following technical solution:

[0005] This invention relates to a method for producing ganoderic acids based on the acetyltransferase GluAT. The method involves transforming the acetyltransferase GluAT from Ganoderma lucidum into a corresponding Saccharomyces cerevisiae strain for heterologous expression. After heterologous biosynthesis of ganoderic acids TN (GA-TN), X (GA-X), and TQ (GA-TQ) through fermentation, GluAT yeast microsomes are further prepared to facilitate in vitro enzymatic reactions, thereby producing ganoderic acids R (GA-R), P (GA-P), Mk (GA-Mk), T (GA-T), and T1 (GA-T1).

[0006] The acetyltransferase GluAT has the nucleotide sequence shown in Seq No. 1 and the amino acid sequence shown in Seq No. 2.

[0007] The aforementioned heterologous expression refers to the introduction of expression plasmids such as GluAT into a Saccharomyces cerevisiae strain using a standard lithium acetate conversion method.

[0008] The GluAT microsomes refer to the following: GluAT expression vector is introduced into the Saccharomyces cerevisiae strain YL-T3 via the standard lithium acetate conversion method. After fermentation and culture, yeast cells are collected, disrupted by high pressure, and then centrifuged at differential speed. The resulting precipitate is dissolved in buffer solution to obtain GluAT microsomes.

[0009] The standard lithium acetate conversion method described herein employs, but is not limited to, the techniques described by R Daniel Gietz et al. in "High-efficiency yeast transformation using the LiAc / SS carrier DNA / PEG method" (NatProtoc. 2007; 2(1):31-4.).

[0010] The expression vector is plasmid pRS426-HXT7p-FBA1t-G418r, which is implemented using, but not limited to, the techniques described by Xiaoting Lan et al. in "Efficient biosynthesis of antitumor ganoderic acid HLDOA using a dualtunable system for optimizing the expression of CYP5150L8 and a Ganoderma P450reductase" (Biotechnol Bioeng. 2019 Dec; 116(12):3301-3311.).

[0011] The culture medium (per liter) consists of 10 g / L yeast extract, 20 g / L beef peptone, 20 g / L glucose, and 40 g / L glycerol; an appropriate concentration of genimycin G418 and / or hygromycin Hyg is added to the culture medium.

[0012] The brewing yeasts mentioned include: GA-Jb and GA-Y production yeast SC62-CYP512W2-r, GA-Ja production yeast SC62-CsSDR-AKR1C4-CYP512W2-r, and yeast YL-T3.

[0013] The yeast YL-T3 mentioned above is obtained by genetically modifying the commercially available BY4742 strain. Specifically, it is an engineered strain (BY4742, Δtrp1, δDNA::P) obtained by overexpressing the upstream genes tHMG1, ERG20, ERG9, and ERG1 of the lanosterol biosynthesis pathway on the basis of the BY4742 strain. PGK1 -tHMG1-T ADH1 -P TEF1 -LYS2-T CYC1 ,TRP::HIS-P PGK1 -ERG20-T ADH1 -P TEF1 -ERG9-T CYC1 -P TDH3 -ERG1-T TPL1The construction method adopts, but is not limited to, the technology described by Zhubo Dai et al. in "Producing aglycons ofginsenosides in bakers' yeast" (Sci Rep.2014 Jan 15:4:3698.doi:10.1038 / srep03698.).

[0014] The GA-Jb and GA-Y yeast SC62-CYP512W2-r were obtained by transfecting the plasmid pRS425-HXT7p-CYP512W2-FBA1t-Hygr into the genetically engineered SC62 strain (YL-T3-rDNA::eGFPTRP1-CYP5150L8-iGLCPR).

[0015] The GA-Ja yeast SC62-CsSDR-AKR1C4-CYP512W2-r described above was obtained by transforming the genetically engineered SC62 strain (YL-T3-rDNA::eGFP-TRP1-CYP5150L8-iGLCPR) with the plasmid pRS425-TDH3p-CsSDR-ADH2t-TEF1p-AKR1C4-PGK1t-HXT7p-CYP512W2-FBA1t-Hygr. This method utilizes, but is not limited to, the techniques described by Wei Yuan et al. in "Biosynthesis of mushroom-derived type II ganoderic acids by engineered yeast". The technical implementation described in (Nat Commun.2022Dec 14;13(1):7740.doi:10.1038 / s41467-022-35500-1.)

[0016] The in vitro reaction includes any one of the following:

[0017] A) Ganoderma lucidum acid R (GA-R) was obtained by in vitro enzymatic reaction of GluAT yeast microsomes with ganoderic acid 3α-acetoxy-22β-hydroxylanosta-7,9(11),24-trien-26-oic acid (3α-acetoxy-22β-HLTOA);

[0018] B) Ganoderma lucidum P (GA-P) was obtained by in vitro enzymatic reaction of GlAT yeast microsomes with ganoderic acid 3α,15α,22β-trihydroxylanosta-7,9(11),24-trien-26-oic acid (TLTOA).

[0019] C) In vitro enzymatic reaction of GluAT yeast microsomes with ganoderic acid T2 (GA-T2) yielded ganoderic acid Mk (GA-Mk), ganoderic acid T (GA-T) and ganoderic acid T1 (GA-T1). Technical effect

[0020] This invention utilizes the gene GluAT, which catalyzes the hydroxyacetylation of the C15 and C22 hydroxyl groups of the ganoderic acid skeleton, to construct an engineered strain of Saccharomyces cerevisiae using synthetic biology techniques. Through fermentation culture, heterologous biosynthesis of compounds such as ganoderic acid TN (GA-TN) was achieved. Furthermore, GluAT microsomes were prepared for in vitro reactions to produce various compounds, including ganoderic acid R (GA-R). This provides a potential method to replace traditional artificial cultivation or liquid fermentation production methods and lays the foundation for further efficient biosynthesis of ganoderic acid compounds through metabolic engineering. Attached Figure Description

[0021] Figure 1 Schematic diagram of expression plasmid pRS426-HXT7p-FBA1t-G418r;

[0022] Figure 2 Schematic diagram of expression plasmid pRS426-HXT7p-GlAT-FBA1t-G418r;

[0023] Figure 3 HPLC chromatograms (a) and MS analysis (b) of fermentation products of Saccharomyces cerevisiae strain SC62-GlAT-r-CYP512W2-r and control strain SC62-CK-r-CYP512W2-r are shown in the figure; CK-r-W2-r represents SC62-CK-r-CYP512W2-r and GlAT-r-W2-r represents SC62-GlAT-r-CYP512W2-r.

[0024] Figure 4 HPLC chromatograms (a) and MS analysis (b) of fermentation products of Saccharomyces cerevisiae strain SC62-GlAT-r-CsSDR-AKR1C4-CYP512W2-r and control strain SC62-CK-r-CsSDR-AKR1C4-CYP512W2-r are shown in the figure; CK-r-Cs-C4-W2-r represents SC62-CK-r-CsSDR-AKR1C4-CYP512W2-r, and GlAT-r-Cs-C4-W2-r represents SC62-GlAT-r-CsSDR-AKR1C4-CYP512W2-r.

[0025] Figures 5-10 The catalytic product of GluAT, ganoderic acid TN (GA-TN) 1 H-NMR,13 C-NMR, DEPT-135, COSY, HSQC, and HMBC spectra;

[0026] Figure 11 HPLC chromatograms and MS analysis of the in vitro reaction products of GluAT microsomes and control microsomes with ganoderic acid 3α-acetoxy-22β-hydroxylanosta-7,9(11),24-trien-26-oic acid (3α-acetoxy-22β-HLTOA) were presented. In the figure, CK represents the control microsomes prepared by strain YL-T3-CK-r, GluAT represents the GluAT microsomes prepared by strain YL-T3-GlAT-r, and the blue line represents the standard.

[0027] Figure 12 HPLC chromatograms and MS analysis of the in vitro reaction products of GluAT microsomes and control microsomes with ganoderic acid 3α,15α,22β-trihydroxylanosta-7,9(11),24-trien-26-oic acid (TLTOA) were obtained. In the figure, CK represents the control microsomes prepared by strain YL-T3-CK-r, GluAT represents the GluAT microsomes prepared by strain YL-T3-GlAT-r, and the blue line represents the standard.

[0028] Figure 13 HPLC chromatograms and MS analysis of the in vitro reaction products of GluAT microsomes and control microsomes with ganoderic acid T2 (GA-T2) are shown in the figure. CK represents the control microsomes prepared by strain YL-T3-CK-r, GluAT represents the GluAT microsomes prepared by strain YL-T3-GlAT-r, and the blue line represents the standard. Detailed Implementation

[0029] This embodiment relates to a method for heterologous production of Ganoderma lucidum triterpenoids using synthetic biology techniques, including:

[0030] Step 1: Construct the GluAT expression vector, specifically including:

[0031] 1.1) Using the cDNA of Ganoderma lucidum CGMCC 5.616 as a template, the GLAT(jg1673.t1) coding sequence fragment containing a homologous arm was amplified.

[0032] The primer sequences used for the amplification are shown in Table 1:

[0033] Table 1: Primer sequence list used for amplifying the GLAT coding sequence fragment Primer name Serial Number Primer sequence (5'-3') jg1673-F Seq ID No.3 taattttaatcaaaaagtttatgaattactcggcatcatcggtc jg1673-R Seq ID No.4 attaatttgaattaacgttttcataaggacgccttcatcagattg

[0034] F and R represent the forward and reverse primers, respectively.

[0035] 1.2) The pRS426-HXT7p-FBA1t-G418r expression vector was linearized by PmeI restriction enzyme digestion, and then... The SoSoo Recombinant Cloning Kit allows you to recombine a linear vector with a GLAT-coding sequence fragment according to the manufacturer's instructions.

[0036] 1.3) The ligation product was transformed into DH5α competent cells using conventional chemical transformation methods and plated on LB agar plates (tryptone, 10 g / L; yeast extract, 5 g / L; NaCl, 10 g / L) containing 100 mg / L Amp resistance, and cultured overnight at 37°C. Positive clones were picked and inoculated into LB tubes containing 100 mg / L Amp resistance, and cultured overnight at 37°C and 220 rpm.

[0037] 1.4) After the bacterial culture reaches the stationary phase, plasmids are extracted from the above E. coli cells and sequenced using sequencing primers to verify that the correct recombinant plasmid pRS426-HXT7p-GlAT-FBA1t-G418r is obtained.

[0038] The sequencing primers are shown in Table 2:

[0039] Table 2: Sequencing primer sequence list for verifying the correctness of recombinant plasmid pRS426-HXT7p-GlAT-FBA1t-G418r Primer name Serial Number Primer sequence (5'-3') Seq-HXT7p-F Seq ID No. 5 caagaacaaacaagctc Seq-FBA1t-R Seq ID No.6 cttcagaagaaaagagc

[0040] Step 2, Functional identification of GLAT, specifically includes:

[0041] 2.1) The expression plasmid pRS426-HXT7p-GlAT-FBA1t-G418r and the control plasmid pRS426-HXT7p-FBA1t-G418r were transformed into GA-Jb and GA-Y yeast SC62-CYP512W2-r and GA-Ja production yeast SC62-CsSDR-AKR1C4-CYP512W2-r via the lithium acetate method. The transformed yeasts were plated on SC-His-Leu-Ura-Trp (SC-HLUT) solid medium (glucose, 20 g / L; SC-His-Leu-Ura-Trp, 7.9 g / L; agar powder, 2%) for screening. After culturing at 30℃ for 2-3 days, positive transformants were selected to obtain yeast strains expressing Glatt, SC62-GlAT-r-CYP512W2-r and SC62-GlAT-r-CsSDR-AKR1C4-CYP512W2-r, and control strains SC62-CK-r-CYP512W2-r and SC62-CK-r-CsSDR-AKR1C4-CYP512W2-r.

[0042] 2.2) Inoculate positive transformants into round-bottom test tubes containing 3 mL of SC-HLUT liquid medium and incubate for 24 h until OD. 600 The value is 2.5-4. Then, with an initial OD of 0.05... 600 Inoculate with 3 mL of YPD24 liquid medium (containing 200 mg / L LG418 and 200 mg / L Hyg). Fermentate at 30 °C and 220 rpm.

[0043] 2.3) After fermentation for 120 h, 1 mL of fermentation broth was extracted twice by vortexing with 800 μL of ethyl acetate. After centrifugation (12,000 g, 10 min), the supernatant ethyl acetate was collected, evaporated to dryness, and redissolved in methanol for HPLC and LC-MS analysis.

[0044] 2.4) HPLC detection of fermentation products: Agilent XDB-C18 analytical liquid chromatograph was used for detection. Column: Agilent XDB-C18 column (4.6 μm, 5 × 150 mm); Flow rate: 1 mL / min; Injection volume: 20 μL; Detection wavelengths: 210, 245, and 225 nm; Mobile phase A: ultrapure water; Mobile phase B: methanol (containing 0.1% acetic acid); Elution program: 0-30 min, 80-100% mobile phase B; 30-35 min, 100% mobile phase B.

[0045] 2.5) LC-MS Detection of Fermentation Products: UPLC-MS with Q-TOF mass spectrometry was used for detection. The mass spectrometry was performed in atmospheric pressure chemical ionization (APCI) positive ion mode. Column: Waters BEH C18 column (1.7 μm, 2.1 × 100 mm); flow rate: 0.4 mL / min; injection volume: 1 μL; detection wavelengths: 210, 245, and 225 nm. Mobile phase A: ultrapure water (containing 0.1% formic acid); mobile phase B: methanol (containing 0.1% formic acid); elution program: 0–10.5 min, 70–100% mobile phase B.

[0046] Compared with the control yeast strain SC62-CK-r-CYP512W2-r, yeast SC62-GlAT-r-CYP512W2-r produced a new peak during fermentation 1 ( Figure 3 a) The main fragment ion peaks detected included 435, 453, and 495, suggesting that it is an acetylated product of GA-Jb, with the fragment ion peaks corresponding to [M-HOAc-H2O+H]. + [M-HOAc+H] + and [M-H2O+H] + ( Figure 3 b).

[0047] Compared with the control strain SC62-CK-r-CsSDR-AKR1C4-CYP512W2-r, the fermentation product of yeast SC62-GlAT-r-CsSDR-AKR1C4-CYP512W2-r showed two new peaks in addition to the main peak 1. The mass spectrometric information and elution time of peak 2 were completely consistent with the ganoderic acid X (GA-X) standard. Figure 4 a) Heterogeneous synthesis of GA-X was achieved. The main fragment examples of peak 3 are at 433 and 451, presumably representing the acetylation product of GA-TR, ganoderic acid TQ (GA-TQ). The fragment ion peaks correspond to [M-HOAc-H2O+H], respectively. + [M-HOAc+H] + ( Figure 4 b). Based on the above results, it is speculated that GluAT can catalyze the acetylation of the C15 hydroxyl group of the Ganoderma lucidum triterpenoid skeleton.

[0048] Step 3, separation, purification, and identification of the GluAT-catalyzed products, specifically includes:

[0049] 3.1) Pick SC62-GlAT-r-CYP512W2-r colonies and incubate them in 3 mL of SC-HLUT liquid medium until OD. 600 It is 2.5-4, then with an initial OD of 0.05. 600Seed culture was inoculated into 50 mL of HLUT liquid medium for seed amplification. After approximately 24 hours, the seed culture was cultured at an initial OD value of 0.05. 600 Inoculate into 2L shake flasks containing 400mL YPD24 liquid medium (containing 200mg / L LG418 and 200mg / L Hyg) and ferment at 30℃ and 220rpm, for a total of 5L.

[0050] 3.2) After fermentation for 120 h, the fermentation broth was collected, and 4 L of ethyl acetate was added. The mixture was stirred with a magnetic stirrer for 1–2 h to extract the metabolites. The entire extraction process was repeated twice. After centrifugation, the supernatant ethyl acetate was collected and rotary evaporated under reduced pressure at 45 °C and -0.09 MPa to obtain a brown extract, which was then redissolved in 20 mL of methanol for further separation and purification.

[0051] 3.3) First round of semi-preparative liquid chromatography purification: Purification was performed using a preparative Agilent 1200LC system. Column: Kromasil 100-10-C18 column (20mm × 250mm); Flow rate: 10mL / min; Mobile phase A: ultrapure water, Mobile phase B: methanol; Purification conditions: 0-30min, 80-100% mobile phase B, 30-40min, 100% mobile phase B.

[0052] During the peak elution period of the target compound, fractions were collected in 5 mL centrifuge tubes at different times, and the fractions were analyzed by HPLC as described in step 2.4. The collected solutions containing the target compound and with high purity were combined, evaporated to dryness by rotary evaporation, and then dissolved in 10 mL of methanol for the second round of separation and purification.

[0053] 3.4) Second round of semi-preparative liquid chromatography purification: Purification was performed using a preparative Agilent 1200LC system. Column: Elite Hypersil ODS2 column (10 mm × 250 mm); Flow rate: 4 mL / min; Mobile phase A: ultrapure water, Mobile phase B: methanol; Purification conditions: 0-60 min, 80-100% mobile phase B, 30-40 min, 100% mobile phase B.

[0054] During the peak elution period of the target compound, fractions were collected in 2 mL centrifuge tubes at different times, and the fractions were analyzed by HPLC as described in step 2.4. The eluents containing the target compound and free of impurities were combined, evaporated to dryness under vacuum, and weighed to confirm the weight of the pure product. A total of 2.2 mg of pure compound 1 was finally obtained.

[0055] 3.5) Compound 1 was identified as ganoderic acid TN (GA-TN) by nuclear magnetic resonance spectroscopy (NMR). Its carbon and hydrogen spectra are shown in Table 3. 1 H-NMR, 13C-NMR, DEPT-135, COSY, HSQC, and HMBC spectra are as follows: Figures 5 to 10 As shown.

[0056] Table 3: Ganoderic acid TN (GA-TN) 13 C-NMR and 1 H-NMR data

[0057] Step 4: In vitro reactions confirmed that GluAT catalyzes the acetylation of C22 hydroxyl groups to produce various ganoderic acids, specifically including:

[0058] 4.1) Following a similar procedure to step 2.1, the acetyltransferase expression plasmid pRS426-HXT7p-GlAT-FBA1t-G418r and the empty plasmid pRS426-HXT7p-FBA1t-G418r were transformed into yeast YL-T3, respectively, to obtain yeast strain YL-T3-GlAT-r and control strain YL-T3-CK-r.

[0059] 4.2) Perform fermentation culture similar to step 2.2. Inoculate the seed culture into a 250 mL shake flask containing 50 mL of YPD24 liquid medium (containing 300 mg / L G418), for a total volume of 0.2 L. After fermentation for 60 h, collect the cells by centrifugation (4℃, 2,000 g, 5 min) and wash with 200 mL of TEK buffer (100 mM KCl, 50 mM Tris-HCl, and 1 mM EDTA, pH = 7.5). After centrifugation (4℃, 6,100 g, 3 min), resuspend the cell pellet in 50 mL of extraction buffer (20 mM β-mercaptoethanol, 1% BSA, 0.6 M sorbitol, 50 mM Tris-HCl, and 1 mM EDTA, pH = 7.5) and disrupt the cells using a high-pressure cell disruptor (4℃, 1,000 bar, 4-5 cycles). After centrifugation (4℃, 10,000g, 20 min), the supernatant was collected, and the supernatant was further ultracentrifuged (4℃, 100,000g, 1 h). The resulting precipitate was dissolved in 2 mL of TEG buffer (30% glycerol, 50 mM Tris-HCl and 1 mM EDTA, pH = 7.5) to obtain GluAT microsomes or control microsomes.

[0060] 4.3) The in vitro reaction of GluAT produces various ganoderic acids, specifically including:

[0061] 4.3.1) The microsomes obtained in step 4.2 were subjected to an in vitro enzymatic reaction with ganoderic acid 3α-acetoxy-22β-hydroxylanosta-7,9(11),24-trien-26-oic acid (3α-acetoxy-22β-HLTOA). Specifically, the reaction was carried out in 500 μL of 90 mM Tris-HCl (pH = 7.5), which contained 2 mg of microsomal protein, 2 mM acetyl-CoA, and 400-600 μM ganoderic acid 3α-acetoxy-22β-HLTOA. After reacting at 30 °C and 140 rpm for 24 h, the product was extracted with an equal volume of ethyl acetate and analyzed by HPLC and LC-MS, with specific operations similar to steps 2.3, 2.4, and 2.5. Compared with the control microsomes, a new peak was detected in the GluAT microsome reaction product ( Figure 11 Its retention time and mass spectrometry information are completely consistent with those of the ganoderic acid R (GA-R) standard. Figure 11 This indicates that the addition of an acetyl group to the C22 hydroxyl group in the GLAT-catalyzed substrate 3α-acetoxy-22β-HLTOA enables the biosynthesis of GA-R.

[0062] 4.3.2) The microsomes obtained in step 4.2 were reacted with ganoderic acid 3α,15α,22β-trihydroxylanosta-7,9(11),24-trien-26-oic acid (TLTOA) in vitro according to step 4.3.1. Compared with the control microsomes, three new peaks were detected in the GluAT microsome reaction product. Figure 12 The retention time and mass spectrometry information of compound 7 were consistent with those of ganoderic acid P (GA-P) standard, indicating that GA-P was produced by acetylation of C15 and C22 hydroxyl groups in TLTOA catalyzed by GluAT. Figure 12 Mass spectrometry data showed that compounds 5 and 6 corresponded to the products of TLTOA with the addition of an acetyl group. Figure 12 ).

[0063] 4.3.3) The microsomes obtained in step 4.2 were subjected to an in vitro enzymatic reaction with ganoderic acid T2 (GA-T2) as described in step 4.3.1. Compared with the control microsomes, three new peaks were detected in the GluAT microsome reaction product. Figure 13 The retention times and mass spectrometry information of compounds 9 and 10 were consistent with those of ganoderic acid Mk (GA-Mk) and ganoderic acid T (GA-T) standards, respectively. Figure 13The results indicate that GluAT catalyzes the acetylation of the C15 and C22 hydroxyl groups in GA-T2, achieving the biosynthesis of GA-Mk and GA-T. Based on mass spectrometry information, compound 8 is inferred to be ganoderic acid GA-T1 (GA-T1), which is the product of the acetylation of the C15 hydroxyl group of GA-T2.

[0064] Experiments have demonstrated that the acetyltransferase GluAT, which catalyzes the acetylation of C15 and C22 hydroxyl groups in the Ganoderma triterpenoid skeleton, was identified through gene mining. Heterologous expression of GluAT in yeast, followed by fermentation culture or microsomal reactions, yielded several Ganoderma triterpenoid compounds, including ganoderic acid TN (GA-TN) and ganoderic acid R (GA-R), further revealing part of the biosynthetic pathway of ganoderic acid.

[0065] The above-described specific implementations can be partially adjusted by those skilled in the art in different ways without departing from the principles and purpose of the present invention. The scope of protection of the present invention is defined by the claims and is not limited to the above-described specific implementations. All implementation schemes within the scope of the claims are bound by the present invention.

Claims

1. A method for producing ganoderic acid based on acetyltransferase GluAT, characterized in that, The acetyltransferase GluAT from Ganoderma lucidum was transformed into the corresponding Saccharomyces cerevisiae strain for heterologous expression. After heterologous biosynthesis of ganoderic acid TN (GA-TN), ganoderic acid X (GA-X), and ganoderic acid TQ (GA-TQ) was achieved through fermentation culture, the production of ganoderic acid R (GA-R), ganoderic acid P (GA-P), ganoderic acid Mk (GA-Mk), ganoderic acid T (GA-T), and ganoderic acid T1 (GA-T1) was further achieved by preparing GluAT yeast microsomes for in vitro enzymatic reactions. The acetyltransferase GluAT has the nucleotide sequence shown in Seq No. 1 and the amino acid sequence shown in Seq No.

2.

2. The method for producing ganoderic acid based on acetyltransferase GluAT according to claim 1, characterized in that, The aforementioned heterologous expression refers to the introduction of expression plasmids such as GluAT into a Saccharomyces cerevisiae strain using a standard lithium acetate conversion method.

3. The method for producing ganoderic acid based on acetyltransferase GluAT according to claim 1, characterized in that, The GluAT microsomes refer to the following: GluAT expression vector is introduced into the Saccharomyces cerevisiae strain YL-T3 via the standard lithium acetate conversion method. After fermentation and culture, yeast cells are collected, disrupted by high pressure, and then centrifuged at differential speed. The resulting precipitate is dissolved in buffer solution to obtain GluAT microsomes.

4. The method for producing ganoderic acid based on acetyltransferase GluAT according to claim 3, characterized in that, The expression vector is plasmid pRS426-HXT7p-FBA1t-G418r.

5. The method for producing ganoderic acid based on acetyltransferase GluAT according to claim 1 or 3, characterized in that, The fermentation culture used a culture medium (per liter) consisting of 10 g / L yeast extract, 20 g / L beef peptone, 20 g / L glucose, and 40 g / L glycerol; the culture medium was supplemented with genimycin G418 and / or hygromycin Hyg.

6. The method for producing ganoderic acid based on acetyltransferase GluAT according to claim 1, characterized in that, The brewing yeasts mentioned include: GA-Jb and GA-Y production yeast SC62-CYP512W2-r, GA-Ja production yeast SC62-CsSDR-AKR1C4-CYP512W2-r, and yeast YL-T3.

7. The method for producing ganoderic acid based on acetyltransferase GluAT according to claim 1, characterized in that, The in vitro reaction includes any one of the following: A) Ganoderma lucidum acid R (GA-R) was obtained by in vitro enzymatic reaction of GluAT yeast microsomes with ganoderic acid 3α-acetoxy-22β-hydroxylanosta-7,9(11),24-trien-26-oic acid (3α-acetoxy-22β-HLTOA); B) Ganoderma lucidum P (GA-P) was obtained by in vitro enzymatic reaction of GlAT yeast microsomes with ganoderic acid 3α,15α,22β-trihydroxylanosta-7,9(11),24-trien-26-oic acid (TLTOA). C) In vitro enzymatic reaction of GluAT yeast microsomes with ganoderic acid T2 (GA-T2) yielded ganoderic acid Mk (GA-Mk), ganoderic acid T (GA-T) and ganoderic acid T1 (GA-T1).

Images