Molecular marker combination related to height character of cockscomb as well as detection reagent and application of molecular marker combination
By identifying 10 SNP sites significantly associated with comb height in chickens within the intron region of the CTCF gene, and designing molecular marker combinations and their detection reagents, the problem of early screening for comb height traits was solved, the breeding efficiency of high-quality laying hens was improved, and farming profits were guaranteed.
Patent Information
- Application Number
- CN202610113281.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-28
- Publication Date
- 2026-03-03
- Estimated Expiration
- 2046-01-28
AI Technical Summary
The lack of effective molecular markers in existing technologies for the study of comb height traits in chickens makes the breeding process of high-quality chickens cumbersome and time-consuming, and makes it difficult to measure sexual maturity through early growth traits.
A combination of molecular markers associated with comb height was developed, including 10 SNP sites. Corresponding primer pairs A and B were designed for PCR amplification and sequencing. The intron region of the CTCF gene was used for early screening of comb height.
This approach enables early screening of chickens with high comb height, improves the efficiency of breeding high-quality laying hens, avoids weight loss caused by early maturity selection, and ensures breeding profits.
Smart Images

Figure CN121592784A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular genetics, specifically to a combination of molecular markers associated with the trait of comb height in chickens, as well as its detection reagents and applications. Background Technology
[0002] Early sexual maturity is one of the important selective traits for breeding high-quality chickens. In actual breeding work, directly selecting the age of first egg production is a complicated and time-consuming process. How to measure sexual maturity through early growth traits of chickens is one of the topics that breeders are constantly exploring.
[0003] Comb height is an important phenotypic characteristic of chicken flocks and has many practical applications in production. Comb height is generally positively correlated with sexual maturity, and a well-developed tall comb often indicates strong reproductive capacity. When selecting individuals with tall combs, it is possible to indirectly promote the genetic progress of body weight, balancing "appearance standards" with "growth rate," avoiding the weight loss problem caused by early maturity selection, and ensuring breeding profits.
[0004] Currently, there are relatively few studies on candidate genes and molecular markers related to the trait of comb height in chickens. Therefore, finding new molecular markers related to the trait of comb height is of great significance for breeding high-quality chickens. Summary of the Invention
[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a combination of molecular markers related to the trait of rooster comb height, as well as its detection reagents and applications.
[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a combination of molecular markers associated with the comb height trait of chickens, including a first molecular marker and a second molecular marker; The nucleotide sequence of the first molecular marker is shown in SEQ ID NO.1, containing SNP1, SNP2, SNP3, SNP4, and SNP5 sites. The 54th base of the sequence shown in SEQ ID NO.1 is the SNP1 site, and its base is C or T; the 303rd base of the sequence shown in SEQ ID NO.1 is the SNP2 site, and its base is C or T; the 307th base of the sequence shown in SEQ ID NO.1 is the SNP3 site, and its base is G or A; the 401st base of the sequence shown in SEQ ID NO.1 is the SNP4 site, and its base is T or C; the 700th base of the sequence shown in SEQ ID NO.1 is the SNP5 site, and its base is G or A. The nucleotide sequence of the second molecular marker is shown in SEQ ID NO.2, containing SNP6, SNP7, SNP8, SNP9, and SNP10 sites; the 87th base of the sequence shown in SEQ ID NO.2 is the SNP6 site, and its base is A or T; the 104th base of the sequence shown in SEQ ID NO.2 is the SNP7 site, and its base is C or T; the 112th base of the sequence shown in SEQ ID NO.2 is the SNP8 site, and its base is A or C; the 120th base of the sequence shown in SEQ ID NO.2 is the SNP9 site, and its base is G or T; the 128th base of the sequence shown in SEQ ID NO.2 is the SNP10 site, and its base is C or A.
[0007] The specific nucleotides marked as the first molecule are as follows: ATTAAAGCTGTAATAGATGTTTTGTCAAGTAGTAGGTTTGACTTTATTTTCTTTC / T(SNP1)AGTGTTTTTCAGTGCCAGTGTTCTGGATGGCAAGAAGGAAATGAGAGCAGCTGGAGATGGTTGTAGCACTCGTAACCAGTGGATATGGGATTTAATGCAGCAGGCAAATGAAAGCTCTGTTTCCAGCATG AGAAAATTCCTTGATAAACCAAAATTCCCAATTTCTCAGGTGTGCCAGACTTCCTACCATCAGCAGGTGTGATAGCTCTATGAAAACAGCCTGTCTCGAGCTGTTCTCATCAAGTAGCAC / T(SNP2)GACG / A(SNP3)TTTGATAGGCTTATCTTCAGTAGAAGAAAAAGTTCCCTCTTTCACCTATTCT TAATTCAACACAACTTTAAGCCTTTGCATGTGTTTTATTTAT / C(SNP4)GATTGGATGCTTAAGCAAATCTGCCCCTATTCATCTTTTACATTTCTCTGAGCAATTAGCAACAAATGGATGAGAGTCTCCTATGAGATTTTAGTCTTTGTGTATGTAATCTGAGCCCTGGTTGAACTCTCAACTCTTTGT ACCACTTTCCTTGTATGAGGATTTACTGGGTTCTAGTGCCACACTGTGGAGAACAGGAATTGACATACACTGGAATTGAGAGCATGAGGCTTTGGGAGGAGGTAGCACATGCACCCAGTTCATATTCTGGTTTTGTTGCCTGTGTTTTTCTGTTGATG / A(SNP5)AACCCAGGAAGTGTAGTGATTATGG.
[0008] Note: The nucleotides in bold shaded areas in the sequence are SNP sites, represented by "n" in the sequence listing.
[0009] The specific nucleotides for the second molecular marker are as follows: ataactgaagtgagttctgagcgtaagaactgaagtcttcgttcttagtcctttttcctcctgaaaaagctttgcagttctcaagcA / T(SNP6)taatgcttcatgtcagC / T(SNP7)tctttgcA / C(SNP8)tgtga caG / T(SNP9)tatgttaC / A(SNP10)ttttgtgtctctagcgtgtataaccaaagacagactctgatgctactgatctaaacgaagtggaatcctaaagaagctcagtagagagtgaaattatggtagatcttggctgt.
[0010] Note: The nucleotides in bold shaded areas in the sequence are SNP sites, represented by "n" in the sequence listing.
[0011] This invention is in chicken CTCF Ten SNP loci significantly associated with comb height were identified in the first intron region of the gene (Gene ID: 396274). Based on these 10 SNP loci, this invention developed a combination of molecular markers associated with comb height for the breeding of precocious laying hens.
[0012] In a second aspect, the present invention provides a detection reagent for the above-described molecular marker combination, comprising: primer pair A for detecting a first molecular marker and primer pair B for detecting a second molecular marker; The nucleotide sequences of primer pair A are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. Details are as follows: CTCF -1-F:5'-ATTAAAGCTGTAATAGATGT -3'; (SEQ ID NO.3) CTCF -1-R:5'- CCATAATCACTACACTTCCT -3'. (SEQ ID NO.4) The nucleotide sequences of primer pair B are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively. Details are as follows: CTCF -2-F:5'-ataactgaagtgagttctga -3'; (SEQ ID NO.5) CTCF -2-R:5'- acagccaagatctaccataa -3'. (SEQ ID NO.6) Preferably, the detection reagent is a PCR sequencing kit or a KASP typing kit.
[0013] A third aspect of the present invention provides the application of the above-mentioned molecular marker combination in the breeding of laying hens with different comb heights.
[0014] In a fourth aspect, the present invention provides the application of the above-described detection reagent in chicken genetic breeding.
[0015] In the above applications, the chicken genetic breeding refers to the selection and breeding of laying hens with high comb height or the selection and breeding of laying hens with precocious sexual maturity.
[0016] Furthermore, the comb height is the comb height at the start of egg production (CH) or the comb height at 130 days of age (CH130).
[0017] In the above applications, the method for breeding laying hens with high comb height is as follows: Using the genomic DNA of the laying hens to be tested as a template, primer A was amplified by PCR using primers shown in SEQ ID NO.3 and SEQ ID NO.4 to obtain amplification product A; primer B was amplified by PCR using primers shown in SEQ ID NO.5 and SEQ ID NO.6 to obtain amplification product B; the amplification products were sequenced, and the comb height trait of the laying hens was identified based on the sequencing results.
[0018] Specifically, if the sequencing results of amplification product A correspond to the TT genotype at base 54, TT genotype at base 303, AA genotype at base 307, CC genotype at base 401, and AA genotype at base 700 in the sequence shown in SEQ ID NO.1; and if the sequencing results of amplification product B correspond to the TT genotype at base 87, TT genotype at base 104, CC genotype at base 112, TT genotype at base 120, and AA genotype at base 128 in the sequence shown in SEQ ID NO.2, then it is identified as having the trait of high comb height.
[0019] The beneficial effects of this invention are: This invention is the first of its kind in CTCF Ten SNP loci significantly associated with comb height at the start of laying and comb height at 130 days of age were identified in the introns of the gene. Based on these SNP loci, this invention designed a combination of molecular markers and their detection reagents associated with the comb height trait, which can be used for early screening of laying hens with high comb height, and is of great significance for the breeding and selection of high-quality laying hens with precocious sexual maturity. Attached Figure Description
[0020] Figure 1Manhattan figure: Genome-wide association analysis of crown height trait in MLM model at 130 days of age.
[0021] Figure 2 Manhattan diagram: Genome-wide association analysis of the high-crown-producing trait MLM model.
[0022] Figure 3 Linkage disequilibrium analysis of 10 SNPs. Detailed Implementation
[0023] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0024] Terminology Explanation: The measurement method for "130-day crown height" and "first crown height" in this invention is: the vertical distance from the base of the crown to the top of the highest crown tooth.
[0025] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.
[0026] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions.
[0027] Example 1: Screening, identification, and association analysis of SNP molecular markers associated with rooster comb height. 1. Test method: 1634 Langya hens were used as experimental subjects. All hens were housed individually, and the comb height at 130 days of age (CH130) and the comb height at the start of laying (CH) were measured and recorded. After recording, blood was collected from the subwing vein, anticoagulated with EDTA, and stored at -20°C for subsequent genomic DNA extraction, low-depth resequencing, SNP genotyping, and genome-wide association analysis (GWAS).
[0028] GWAS analysis was performed on CH130 and CH in Langya chickens using the MLM model in GATK / 4.2.6.1; association analysis between SNP genotypes and comb height phenotypic values was performed using R4.3.1. Linkage disequilibrium analysis was conducted on the screened and identified SNP loci in the Langya chicken population using Haploview software.
[0029] 2. Test Results: (1) Genome-wide association analysis results of comb height trait in Langya chicken population: The GWAS analysis results of CH130 (CH130) and crown height (CH) of Langya chicken are as follows: Figure 1 and Figure 2 As shown: 1759 SNPs significantly associated with the CH trait were screened in the 11.22Mb-11.24Mb region of chromosome 11 (P=7.75E-07), among which 10 SNPs also showed a suggestive significant association with the CH130 trait (P=1.15E-05). These 10 SNPs are all located in... CTCF The first intron of the gene (Gene ID: 396274) is shown in Table 1.
[0030] Table 1: Locations and nucleotide mutations of 10 SNPs in the Langya chicken population Note: The position within an intron is calculated starting from the transcription start site. The physical location was determined based on the GRCg6a (GCF 000002315.6) genome as a reference.
[0031] (2) Results of association analysis between SNP genotypes and crown height phenotypic values: The association analysis results of the genotypes of 10 SNP loci with crown height at 130 days of age (CH130) and crown height at the start of labor (CH) are shown in Table 2.
[0032] Table 2: Association analysis of 10 SNP genotypes and comb height trait in Langya chicken population The association analysis results show that the p-values for all SNP loci and trait associations are less than 2.00E-06, indicating highly significant results. Specifically, the homozygous TT, TT, AA, CC, AA, TT, TT, CC, TT, AA at loci 11_1122261, 11_1122510, 11_1122514, 11_1122608, 11_1122907, 11_1124521, 11_1124538, 11_1124546, 11_1124554, and 11_1124562 correspond to larger CH130 and CH phenotypic values, respectively.
[0033] (3) Results of linkage disequilibrium analysis of SNP sites Linkage disequilibrium analysis was performed on the 10 identified SNP loci in a Langya chicken population using Haploview software. The results are as follows: Figure 3As shown, the 10 SNP sites are strongly linked to each other, indicating that these 10 SNP sites belong to the same linkage block and jointly mark the same gene region associated with crown height.
[0034] Example 2: Joint analysis of ten SNP haplotypes 1. Haplotype analysis of 10 SNPs in the Langya chicken population: Haplotypes of 10 SNPs in the Langya chicken population of Example 1 were analyzed. Haplotypes were estimated from 10 polymorphic sites, and haplotypes with a gene frequency of less than 1% were deleted. The results are shown in Table 3.
[0035] Table 3: Haplotype frequency analysis of 10 SNPs in the Langya chicken population Note: The nucleic acids at the SNP sites in the table are sorted in the order of SNP1, SNP2...SNP10.
[0036] 2. Haplotype analysis of 10 SNPs in other chicken breeds: Genomic SNP information from 197 Sunzhi chicken hens from Zaozhuang, 26 Hundred-Day Chicken hens from Jining, 30 Yimeng chicken hens, 45 Luhua chickens from Wenshang, and 36 black chickens from Laiwu was used to detect SNP haplotype frequencies. The results are shown in Table 4.
[0037] Table 4: Frequency distribution of each haplotype in the remaining 5 populations The results showed that three main haplotypes were constructed in the Langya chicken population: H1 (TTACATTCTA), H2 (CCGTGACAGC), and H3 (CTACGACAGC). H1 and H2 were also dominant haplotypes in Jining Hundred-Day Chicken, Zaozhuang Sunzhi Chicken, Luhua Chicken, Yimeng Chicken, and Laiwu Black Chicken. Furthermore, the proportion of H1, H2, and H3 haplotypes in the gene frequencies of Jining Hundred-Day Chicken and Zaozhuang Sunzhi Chicken exceeded 90%, while the proportion of H1 and H2 haplotypes in the gene frequencies of Wenshang Luhua Chicken, Yimeng Chicken, and Laiwu Black Chicken exceeded 50%.
[0038] Example 3: Association analysis between ten SNP diploid types and crown height trait 1. Double-type construction: Diploid types were constructed based on the haplotypes in the Langya chicken population from Example 2, as shown in Table 5: Table 5: Diplotype frequency analysis of 10 SNPs in the Langya chicken population Note: The nucleic acids at the SNP sites in the table are sorted in the order of SNP1, SNP2...SNP10.
[0039] Table 5 shows that H1H1 (TTACATTCTA / TTACATTCTA) and H1H2 (TTACATTCTA / CCGTGACAGC) are dominant diploid types in the Langya chicken population.
[0040] 2. Association analysis between diploid genotype and comb height trait Association analysis was performed between the diploid type and the crown height at 130 days of age (CH130) and crown height at the start of labor (CH). The results are shown in Table 6.
[0041] Table 6: Association analysis of SNP diploid types and comb height traits in Langya chicken population Note: The values in the table are the least squares mean ± standard error of CH130 and CH. P <0.05 indicates a significant difference.
[0042] Table 6 shows that haplotypes H1 and H3 significantly enhance the high comb trait of Langya chickens. Therefore, haplotypes H1 and H3 were selected as molecular markers associated with high comb height.
[0043] Example 4: Design and application verification of molecular marker combinatorial design related to rooster comb height trait. 1. Design of molecular marker primer combinations related to rooster comb height trait: Based on the 10 SNP sites that were significantly associated with the comb height trait identified in Example 1, this example designed a combination of molecular markers associated with the comb height trait, including a first molecular marker and a second molecular marker. The nucleotide sequence of the first molecular marker is shown in SEQ ID NO.1, containing SNP1, SNP2, SNP3, SNP4, and SNP5 sites. The 54th base of the sequence shown in SEQ ID NO.1 is the SNP1 site, and its base is C or T; the 303rd base of the sequence shown in SEQ ID NO.1 is the SNP2 site, and its base is C or T; the 307th base of the sequence shown in SEQ ID NO.1 is the SNP3 site, and its base is G or A; the 401st base of the sequence shown in SEQ ID NO.1 is the SNP4 site, and its base is T or C; the 700th base of the sequence shown in SEQ ID NO.1 is the SNP5 site, and its base is G or A. The nucleotide sequence of the second molecular marker is shown in SEQ ID NO.2, containing SNP6, SNP7, SNP8, SNP9, and SNP10 sites; the 87th base of the sequence shown in SEQ ID NO.2 is the SNP6 site, and its base is A or T; the 104th base of the sequence shown in SEQ ID NO.2 is the SNP7 site, and its base is C or T; the 112th base of the sequence shown in SEQ ID NO.2 is the SNP8 site, and its base is A or C; the 120th base of the sequence shown in SEQ ID NO.2 is the SNP9 site, and its base is G or T; the 128th base of the sequence shown in SEQ ID NO.2 is the SNP10 site, and its base is C or A.
[0044] Based on the above molecular marker combination, detection primer pairs were designed, including: primer pair A for detecting the first molecular marker and primer pair B for detecting the second molecular marker; The nucleotide sequences of primer pair A are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. Details are as follows: CTCF -1-F:5'-ATTAAAGCTGTAATAGATGT -3'; (SEQ ID NO.3) CTCF -1-R:5'- CCATAATCACTACACTTCCT -3'. (SEQ ID NO.4) The nucleotide sequences of primer pair B are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively. Details are as follows: CTCF -2-F:5'-ataactgaagtgagttctga -3'; (SEQ ID NO.5) CTCF -2-R:5'- acagccaagatctaccataa -3'. (SEQ ID NO. 6).
[0045] 2. Application Validation: Another 200 Langya chickens with comb height (CH130) and comb height at the start of egg production (CH) at 130 days of age were selected as experimental subjects. Genomic DNA was extracted from these subjects and amplified using primer pairs A and B as described above. The amplified products were sequenced and analyzed. Based on the base detection results at 10 SNP sites in the molecular marker primer combination, the comb height trait was predicted. Specifically: Chickens with genotypes TT, TT, AA, CC, AA, TT, TT, CC, TT, AA at SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, and SNP10 loci, respectively, have comb height (CH130) at 130 days of age and comb height at the start of laying (CH) that are higher than chickens with genotypes CC or TC, CC or TC, AG or GG, TC or TT, AG or GG, AA or AT, CC or TC, AA or AC, GG or GT, AC or CC at the corresponding loci.
[0046] The prediction results based on molecular markers were compared with the actual comb height (CH130) and initial comb height (CH) records of the corresponding chickens at 130 days of age, and the results were consistent. This demonstrates that the molecular marker combination of the present invention can be used for the prediction of comb height traits in chickens.
[0047] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.
Claims
1. A molecular marker combination associated with the trait of comb height in chickens, characterized in that, Including first molecular markers and second molecular markers; The nucleotide sequence of the first molecular marker is shown in SEQ ID NO.1; the nucleotide sequence of the second molecular marker is shown in SEQ ID NO.
2.
2. The molecular marker combination related to comb height trait according to claim 1, characterized in that, The first molecular marker includes SNP1, SNP2, SNP3, SNP4 and SNP5 sites. The 54th base of the sequence shown in SEQ ID NO.1 is the SNP1 site, and its base is C or T; the 303rd base is the SNP2 site, and its base is C or T; the 307th base is the SNP3 site, and its base is G or A. The 401st base is SNP4, and its base is T or C; the 700th base is SNP5, and its base is G or A. The second molecular marker includes SNP6, SNP7, SNP8, SNP9, and SNP10 sites; the 87th base of the sequence shown in SEQ ID NO.2 is the SNP6 site, and its base is A or T; the 104th base is the SNP7 site, and its base is C or T; the 112th base is the SNP8 site, and its base is A or C; the 120th base is the SNP9 site, and its base is G or T; the 128th base is the SNP10 site, and its base is C or A.
3. A detection reagent, characterized in that, It comprises: primer pair A for detecting a first molecular marker of the molecular marker combination of claim 1 and primer pair B for detecting a second molecular marker; The nucleotide sequences of primer pair A are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively; the nucleotide sequences of primer pair B are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.
4. The detection reagent according to claim 3, characterized in that, The detection reagent is a PCR sequencing kit or a KASP typing kit.
5. The application of the molecular marker combination described in claim 1 or 2 in the breeding of laying hens with different comb heights.
6. The application of the detection reagent according to claim 3 or 4 in chicken genetic breeding, characterized in that, The chicken genetic breeding refers to the selection and breeding of laying hens with high comb height or laying hens with precocious sexual maturity.
7. The application according to claim 6, characterized in that, The comb height is the height at the start of egg production or the height at 130 days of age.
8. The application according to claim 6, characterized in that, The method for breeding laying hens with high comb height is as follows: Using the genomic DNA of the laying hens to be tested as a template, primer A was amplified by PCR using primers shown in SEQ ID NO.3 and SEQ ID NO.4 to obtain amplification product A; primer B was amplified by PCR using primers shown in SEQ ID NO.5 and SEQ ID NO.6 to obtain amplification product B; the amplification products were sequenced, and the comb height trait of the laying hens was identified based on the sequencing results.
9. The application according to claim 8, characterized in that, If the sequencing results of amplification product A correspond to the TT genotype at base 54, TT genotype at base 303, AA genotype at base 307, CC genotype at base 401, and AA genotype at base 700 in the sequence shown in SEQ ID NO. 1; and if the sequencing results of amplification product B correspond to the TT genotype at base 87, TT genotype at base 104, CC genotype at base 112, TT genotype at base 120, and AA genotype at base 128 in the sequence shown in SEQ ID NO. 2, then it is identified as having the trait of high comb height.
Citation Information
Patent Citations
SNP molecular marker related to cockscomb developmental character and detection method thereof
CN108866208A
GTF2A1 gene intron region SNP (Single Nucleotide Polymorphism) molecular marker related to egg laying of chicken and application thereof
CN118638931A
Application of SNP (Single Nucleotide Polymorphism) molecular marker combination in height-assisted breeding of cockscombs
CN119307625A
PPP3R1 gene molecular marker primer related to size character of cockscomb and application of PPP3R1 gene molecular marker primer
CN119307627A
STON2 gene intron SNP (Single Nucleotide Polymorphism) molecular marker related to egg laying traits of chickens and application of STON2 gene intron SNP molecular marker
CN120648816A
Cited By
Molecular marker related to hen pitch length character and detection reagent and application thereof
CN121780725A