Single-stranded probe and application thereof

Abstract

The invention relates to the technical field of molecular biology, in particular to a single-stranded probe and application thereof. The invention provides a nucleic acid probe which is a single-stranded oligonucleotide, the single-stranded oligonucleotide comprises a spacer sequence, at least one side of the spacer sequence is modified with an asymmetric base sequence of 1-50 nt, and the asymmetric base sequence comprises a majority of bases; the number of the majority of bases accounts for more than 80% of the total length of the asymmetric bases; the nucleic acid probe contains a fluorophore and a quenching group; the majority bases have the following conditions: a) when the number of the asymmetric bases is less than two, a1) one base with the highest proportion of the complementary bases is the majority base; a2) two non-complementary bases are majority bases; a3) only one basic group is contained, and the basic group is a majority basic group; and b) when the number of the asymmetric bases is more than two, the two non-complementary bases with the highest proportion are majority bases. Due to the asymmetric base sequence of the single-stranded probe, the sensitivity of the probe is remarkably improved compared with that of a common single-stranded probe.

Description

Technical Field

[0001] This application relates to the field of molecular biology technology, and in particular to a single-stranded probe and its applications. Background Technology

[0002] Ribonucleases (RNases) are a class of enzymes that catalyze the degradation of RNA into smaller fragments, encompassing dozens of different types. Common RNases include RNase A, RNase B, RNase C, RNase T, and RNase P. Among them, RNase A is the most widely used. It specifically degrades the C and U residues of single-stranded RNA, catalyzing the cleavage of the phosphodiester bond between the 5'-ribose of the nucleotide and the 3'-ribose of the adjacent pyrimidine nucleotide, forming oligonucleotides with 2',3'-cyclic phosphate derivatives.

[0003] RNases are widespread, primarily produced by bacteria, microorganisms, and even by laboratory personnel themselves. They can directly enter the experimental system through gloves, pipettes, or droplets, affecting experimental results. Some experimental materials themselves also contain endogenous RNase contamination. This contamination is difficult to detect, hard to avoid, and has a significant impact; even trace amounts of RNase (pg level or above) can cause a large-scale degradation of RNA in a sample within a short period. To date, their extremely high heat resistance and reactivity mean that conventional laboratories lack effective means to prevent their generation, and there is no suitable method to safely and reliably remove RNases present in contaminated raw materials. Therefore, for those skilled in the art, pre-detection of RNases in experimental samples has become a key factor in determining the success of experiments.

[0004] The main methods for detecting RNase include (1) radioactive isotope method (Egly JM and Kempf J. Detection and estimation of very low ribonuclease activites in biological fluids. FEBS Letters, 1976, 63: 250-254), which has a sensitivity of 0.01 pg / ml, but requires the use of raw materials that may cause personal injury, so it is not suitable as a routine method; (2) electrochemical method (Ni JC and Lin H. Homogeneous Electrochemil μMinescence Biosensor for the Detection of RNase A Activity and Its Inhibitor. Anal. Chem., 2019, 91, 14751-14756), which has extremely high detection sensitivity, but has high requirements for raw material synthesis, experimental operation and testing equipment, and is not easy to implement quality control in ordinary laboratories; (3) spectrophotometric method (Witmer MR, Falcomer CM, Weiner MP, Kay MS, Begley TP, Ganem B,ScheragaCM HA.U-3'-BCIP:a chromogenic substrate for the detection of RNase A in recombinant DNA expression systems.Nucleic Acids Res.,1991,11:1-4), simple to operate, but with poor detection sensitivity; (4)Fluorescence method (JY Dua,YZ Dong,H Liu,Ll Gong,S Lu,CY Yang,YLi.Thioflavin T as lμMinescence biosensors for nucleic acid study and RNase A activity detection.Microchemical Journal,2019,147:842–847), this sensing system has high specificity and selectivity, but requires that the analyte does not contain metal ions, which greatly limits its widespread application.

[0005] In summary, RNase detection is a crucial part of quality control, but existing technologies still have shortcomings. To overcome the common drawbacks of current RNase detection methods, such as experimental complexity, low sensitivity, and high instrument requirements, and to help technicians in this field easily, quickly, and accurately determine the RNase contamination status of test samples and the environment, it is necessary to propose a new RNase detection method. Summary of the Invention

[0006] In view of the shortcomings of the prior art described above, the purpose of this application is to provide a single-chain probe and its application to solve the problems in the prior art.

[0007] To achieve the above and other related objectives, the first aspect of this application provides a nucleic acid probe, which is a single-stranded oligonucleotide. The single-stranded oligonucleotide includes a spacer sequence, and at least one side of the spacer sequence is modified with an asymmetric base sequence of 1-50 nt. The asymmetric base sequence includes a majority of bases; the majority of bases accounts for more than 80% of the total length of the asymmetric bases; the nucleic acid probe contains a fluorescent group and a quencher group; and the majority of bases exhibit the following characteristics:

[0008] a) When there are two or fewer asymmetric bases

[0009] a1) The type of base with the highest number of complementary bases is the majority base;

[0010] a2) The two non-complementary bases are the majority bases;

[0011] a3) Contains only one type of base, which is the majority base;

[0012] b) When there are more than two asymmetric bases, the two non-complementary bases with the highest proportion are the majority bases.

[0013] In any embodiment of this application, the length of the nucleic acid probe is 10 to 100 nt.

[0014] In any embodiment of this application, the length of the interval sequence is 1 to 16 nt.

[0015] In any embodiment of this application, when both sides of the spacer sequence are modified with asymmetric bases, the asymmetric bases on both sides are not complementary.

[0016] In any embodiment of this application, when the asymmetric base sequence is a single base, the base is purine; preferably adenine.

[0017] In any embodiment of this application, the number of the majority bases accounts for 100% of the total length of the asymmetric bases.

[0018] In any embodiment of this application, when the asymmetric base includes two or more bases, the number of the two non-complementary bases with the highest proportion accounts for at least 80% of the total length of the asymmetric base sequence.

[0019] In any embodiment of this application, the fluorescent group and the quenching group are not simultaneously located at the end of a single-stranded oligonucleotide; preferably, the fluorescent group and the quenching group are not simultaneously located on the same asymmetric base; more preferably, the fluorescent group and the quenching group are located at opposite ends of a spacer sequence.

[0020] In any embodiment of this application, the fluorescent group and the quenching group are at least 2 bases apart.

[0021] In any embodiment of this application, any base of the nucleic acid probe is a natural, modified, or non-natural nucleoside base.

[0022] In any embodiment of this application, optionally, the nucleic acid probe contains modified ribose, and the modification includes one or more combinations of 2'-O-methylation, 2'-methoxyethylation, 2'-F modification, 2'-deoxy modification, 2'-amino modification, unlocked nucleic acid, 2'O and 4'C linked by a methylene bridge (locked nucleic acid), 2'-O-propyne modification, 3'-deoxy modification, and 2',3' dideoxy modification.

[0023] In any embodiment of this application, optionally, the nucleic acid probe contains phosphodiester bond modification for linking nucleotides, the phosphodiester bond modification including thiolation or boronization modification of non-bridging oxygen atoms in the phosphate backbone.

[0024] In any embodiment of this application, the single-stranded oligonucleotide is RNA.

[0025] In any embodiment of this application, the sequence of the nucleic acid probe includes the nucleic acid sequences shown in SEQ ID NO:2-5, 7, 10, 12, 14, 15.

[0026] In any embodiment of this application, the fluorescent group is selected from FAM, HEX, TET, ROX, TAMRA, JOE, Cy3 or Cy5; preferably, the fluorescent group is FAM;

[0027] In any embodiment of this application, the quenching group is selected from BHQ, TRAMA, FAM or Dabcyl; preferably, the quenching group is BHQ.

[0028] The second aspect of this application provides the use of the aforementioned nucleic acid probe as an RNase substrate.

[0029] In any embodiment of this application, the RNase includes one or more combinations of RNase A, RNase H, RNase T and RNase I.

[0030] The third aspect of this application provides the use of the aforementioned nucleic acid probe in the preparation of products for detecting ribonuclease.

[0031] The fourth aspect of this application provides a method for detecting ribonuclease, wherein the aforementioned nucleic acid probe is added to the sample to be tested for reaction, and the ribonuclease in the sample to be tested is qualitatively or quantitatively detected based on the fluorescence value in the reactant.

[0032] In any embodiment of this application, the ribonuclease includes one or more combinations of RNase A, RNase T, RNase I, and RNase H.

[0033] In any embodiment of this application, the working concentration of the RNase substrate is 0.01–10 pmol / μL.

[0034] In any embodiment of this application, the reaction also includes a reaction buffer and enzyme-free water; preferably, the reaction buffer includes 10-100 mM Tris and 0-0.1 M MgCl2.

[0035] In any embodiment of this application, the method for determining the fluorescence value includes detection by a fluorescence spectrophotometer, real-time quantitative PCR, electrophoresis, HPLC, electrochemistry, or visual observation under specific illumination.

[0036] The fifth aspect of this application provides a ribonuclease detection kit, comprising the aforementioned nucleic acid probe, reaction buffer, and enzyme-free water; preferably, the detection kit further comprises RNase standards.

[0037] In any embodiment of this application, the working concentration of the RNase substrate is 0.01–10 pmol / μL.

[0038] In any embodiment of this application, the reaction buffer comprises 10–100 mM Tris and 0–0.1 M MgCl2.

[0039] In any embodiment of this application, the RNase in the RNase standard is selected from RNase A, RNase T, RNase I or RNase H.

[0040] The sixth aspect of this application provides the application of the aforementioned detection method or the aforementioned detection kit in ribonuclease detection.

[0041] Compared with the prior art, the beneficial effects of this application are as follows:

[0042] 1. The single-chain probe of this application has an asymmetric base sequence of 1 to 50 nt. This design significantly improves the detection sensitivity of the probe compared with ordinary single-chain probes with the same sequence.

[0043] 2. The detection method of this application has high sensitivity. As an RNase reaction substrate, it has ultra-high sensitivity than ordinary single-chain fluorescent probes and can detect RNase A as low as 0.1 pg / ml.

[0044] 3. The detection method of this application has a fast response speed, and the results can be obtained within one hour. It can be observed in real time, has low equipment requirements, and is more suitable for routine laboratory quality control.

[0045] 4. The probe of this application has broad spectrum and can detect a variety of ribonucleases.

[0046] 5. This application has a wide range of applications and can be used to test experimental raw materials, environmental samples, etc.

[0047] 6. This application is safe, and the materials used do not contain harmful ingredients. Attached Figure Description

[0048] Figure 1 This is a structural diagram of the single-chain probe of this application.

[0049] Figure 2 This is a detection diagram of different sequence probes in Embodiment 1 of this application.

[0050] Figure 3 This is a detection diagram of different sequence probes in Embodiment 2 of this application.

[0051] Figure 4 This is a detection diagram of different sequence probes in Embodiment 3 of this application.

[0052] Figure 5 This is a detection diagram of different sequence probes in Embodiment 4 of this application.

[0053] Figure 6 This is a detection diagram of different sequence probes in Embodiment 5 of this application. Detailed Implementation

[0054] To make the inventive objectives, technical solutions, and beneficial effects of this application clearer, the following description, in conjunction with embodiments, further illustrates this application. It should be understood that the embodiments described are for illustrative purposes only and are not intended to limit the scope of the application. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and those skilled in the art can easily understand other advantages and effects of this application from the content disclosed in this description.

[0055] The inventors of this application, through extensive research and exploration, discovered a single-chain probe and its applications, and completed this application based on this discovery.

[0056] The first aspect of this application provides a nucleic acid probe, which is a single-stranded oligonucleotide. The single-stranded oligonucleotide includes a spacer sequence, and at least one side of the spacer sequence is modified with an asymmetric base of 1-50 nt. The asymmetric base sequence includes a majority of bases; the majority of bases accounts for more than 80% of the total length of the asymmetric bases; the nucleic acid probe contains a fluorescent group and a quencher group; the majority of bases exhibit the following characteristics:

[0057] a) When there are two or fewer asymmetric bases

[0058] a1) The type of base with the highest number of complementary bases is the majority base;

[0059] a2) The two non-complementary bases are the majority bases;

[0060] a3) Contains only one type of base, which is the majority base;

[0061] b) When there are more than two asymmetric bases, the two non-complementary bases with the highest proportion are the majority bases.

[0062] In some embodiments, optionally, the asymmetric bases herein also include minority bases, which are defined as bases other than the majority bases. The asymmetric bases of this application may consist entirely of majority bases, or may consist of both majority and minority bases.

[0063] Unless otherwise specified, the single-stranded probes in this article are nucleic acid probes.

[0064] Unless otherwise specified, the term "a type" in this application, referring to "one type of base" or "two types of bases," means that bases with the same complementary pairing relationship are considered one type. For example, both U and T can pair with A, therefore U and T can be considered to have the same complementary pairing relationship, and U and T are one type. Furthermore, modified bases and native bases are also considered one type; for example, pseudouracil and uracil are the same type. Those skilled in the art should understand that C, G, A, and U are four types of bases.

[0065] like Figure 1 As shown, in the single-stranded probe of this application, the asymmetric base sequence can be located on either side or both sides of the spacer sequence, and it is not complementary to the spacer sequence. When both sides of the spacer sequence are modified with asymmetric bases, the asymmetric bases on both sides are not complementary, that is, the asymmetric base sequence on one side will not be complementary to the asymmetric base sequence on the other side. Furthermore, the asymmetric bases on the same side are not complementary to each other.

[0066] In some preferred embodiments, when the asymmetric base sequence is a single base, the base is purine; preferably adenine. This application's research has found that extending the asymmetric bases at both ends of the probe with an arbitrary sequence without altering the position of the fluorescent group helps improve detection sensitivity, and that when the added sequence is an A base, the optimization effect on the probe is better than adding other bases.

[0067] In some preferred embodiments, the majority bases account for 100% of the total length of the asymmetric bases.

[0068] In some preferred embodiments, when the asymmetric bases include two or more bases, the two most prevalent non-complementary bases account for at least 80% of the total length of the asymmetric base sequence; specifically, this can be 80–82%, 82–85%, 85–90%, or 90–100%, etc. These design principles significantly improve the detection sensitivity of the probe compared to ordinary single-stranded probes with the same sequence.

[0069] The nucleic acid probes provided in this application have a length of 10–100 nt; specifically, they can be 10–20 nt, 20–30 nt, 30–40 nt, 40–50 nt, 50–60 nt, 60–70 nt, 70–80 nt, 80–90 nt, or 90–100 nt, etc.

[0070] The nucleic acid probes provided in this application have a spacer sequence length of 1–16 nt; specifically, it can be 1–5 nt, 5–10 nt, or 10–16 nt, etc. The spacer sequence can be any sequence with fewer than 16 bases. When the length of the spacer sequence reaches 16 bases or more, extending the asymmetric bases at both ends of the probe no longer effectively improves the detection sensitivity of the probe. There are no special requirements for the bases of the spacer sequence; the following examples are merely illustrations.

[0071] In the nucleic acid probe provided in this application, the fluorescent group and the quencher group are not simultaneously located at the end of a single-stranded oligonucleotide; preferably, the fluorescent group and the quencher group are not simultaneously located on the same asymmetric base; more preferably, the fluorescent group and the quencher group are located at opposite ends of a spacer sequence. The fluorescent group and the quencher group are at least 2 bases apart.

[0072] The nucleic acid probe provided in this application has a fluorescent group modified at the 5' end of the spacer sequence. A quencher group is modified at the 3' end of the spacer sequence. The fluorescent group is selected from FAM, HEX, TET, ROX, TAMRA, JOE, Cy3, or Cy5; preferably, the fluorescent group is FAM. The quencher group is selected from BHQ, TRAMA, FAM, or Dabcyl; preferably, the quencher group is BHQ.

[0073] In this application, the fluorescent group and quenching group can adopt commonly used technical solutions in the art, and are not particularly limited herein. Different fluorescent groups and quenching groups directly determine the subsequent detection methods, which can be carried out according to commonly used technical methods in the art. Furthermore, the fluorescent group is preferably FAM, with a maximum excitation wavelength of 495nm and a maximum emission wavelength of 520nm; the quenching group of the fluorescent probe is preferably BHQ.

[0074] In the nucleic acid probes provided in this application, any one base of the nucleic acid probe is a natural, modified, or non-natural nucleoside base.

[0075] Optionally, the nucleic acid probe provided in this application contains modified ribose. The modification methods include one or more combinations of 2'-O-methylation, 2'-methoxyethylation, 2'-F modification, 2'-deoxy modification, 2'-amino modification, unlocked nucleic acid, 2'O and 4'C linked by a methylene bridge (locked nucleic acid), 2'-O-propargylation, 3'-deoxy modification, and 2',3' dideoxy modification. The nucleic acid probe contains phosphodiester bond modifications linking nucleotides, including thiolation or boronylation of non-bridging oxygen atoms in the phosphate backbone. The probe provided in this application has high design flexibility and can be designed and adjusted to achieve different purposes. For example, DNA chimeric fragments can be added to improve the detection sensitivity for specific ribonucleases, and modified groups such as dioxymethylation can be used to further improve probe stability.

[0076] The single-stranded oligonucleotide in the nucleic acid probe provided in this application is RNA.

[0077] In the nucleic acid probes provided in this application, the "bases" can be natural bases such as adenine (A), guanine (G), thymine (T), uracil (U), and cytosine (C), or they can be non-natural bases, such as modified bases, as described above.

[0078] The nucleic acid probes provided in this application include nucleic acid sequences such as SEQ ID NO:2-5, 7, 10, 12, 14, and 15.

[0079] The second aspect of this application provides the use of the aforementioned nucleic acid probe as an RNase substrate.

[0080] In some embodiments, RNase includes one or more combinations of RNase A, RNase T, RNase H, and RNase I. The nucleic acid probe of this application, as an RNase reaction substrate, exhibits ultra-high sensitivity compared to ordinary single-stranded fluorescent probes, capable of detecting RNase as low as 0.1 pg / ml.

[0081] The third aspect of this application provides the use of the aforementioned nucleic acid probe in the preparation of products for detecting ribonuclease.

[0082] The fourth aspect of this application provides a method for detecting ribonuclease, in which the aforementioned RNase substrate is added to the sample to be tested for reaction, and the ribonuclease in the sample is qualitatively or quantitatively detected based on the fluorescence value of the reactants. This method, due to the use of the RNase substrate specifically designed in this application, is relatively simple to implement, has good sensitivity and accuracy, and can complete the detection in about one hour, while also being suitable for high-throughput detection.

[0083] In the detection method provided in this application, the ribonuclease includes one or more combinations of RNase A, RNase T, RNase I and RNase H.

[0084] In the detection method provided in this application, the working concentration of the RNase substrate is 0.01–10 pmol / μL; specifically, it can be 0.01–0.5 pmol / μL, 0.5–11 pmol / μL, or 1–10 pmol / μL, etc.

[0085] The detection method provided in this application also includes a reaction buffer and enzyme-free water during the reaction. The reaction buffer consists of 10–100 mM Tris and 0–0.1 M MgCl2. The reaction buffer described here is a 10× formulation; in actual use, it needs to be diluted to a 1× working concentration first.

[0086] In the detection method provided in this application, during qualitative detection, if the fluorescence value of the sample after the reaction changes by more than 1.1 times compared with the fluorescence value before the reaction, the sample is determined to contain ribonuclease; otherwise, the sample does not contain ribonuclease.

[0087] The detection method provided in this application includes, during quantitative detection, the construction of a standard curve. The fluorescence value of the sample to be tested is compared with the standard curve to obtain the content of ribonuclease in the sample. The standard curve is obtained based on the concentrations of different concentrations of ribonuclease standards and their corresponding fluorescence values.

[0088] The detection methods provided in this application include fluorescence value determination by fluorescence spectrophotometer, real-time quantitative PCR, electrophoresis, HPLC, electrochemistry, or visual observation under specific illumination.

[0089] The fifth aspect of this application provides a ribonuclease detection kit, comprising the aforementioned nucleic acid probe, reaction buffer, and enzyme-free water; preferably, the detection kit further comprises RNase standards.

[0090] In the detection kit provided in this application, the working concentration of the RNase substrate is 0.01–10 pmol / μL; specifically, it can be 0.01–0.5 pmol / μL, 0.5–11 pmol / μL, or 1–10 pmol / μL, etc.

[0091] The detection kit provided in this application contains a reaction buffer comprising 10–100 mM Tris and 0–0.1 M MgCl2.

[0092] In the detection kit provided in this application, the RNase in the RNase standard is selected from RNase A, RNase T, RNase I or RNase H.

[0093] The sixth aspect of this application provides the application of the aforementioned detection method or the aforementioned detection kit in ribonuclease detection. In some embodiments, the aforementioned detection method or the aforementioned detection kit can specifically be used to detect the content or relative content of ribonuclease in a sample to be tested; or it can be used to compare the content or relative content of RNase in two or more samples to be tested. The detection method of this application has high sensitivity, fast reaction speed, and real-time observation capability, making it suitable for routine laboratory quality control. It has the ability to detect multiple ribonucleases and can easily, quickly, and accurately determine the RNase contamination status of the sample to be tested and the environment.

[0094] The present application will be further illustrated by the following examples, but these examples do not limit the scope of the present application.

[0095] Unless otherwise specified, all materials and reagents used in the examples were obtained commercially. For conditions not specifically stated in the examples, follow standard conditions or the manufacturer's recommendations.

[0096] Unless otherwise stated, the technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods or materials similar to or equivalent to those described herein may also be used in this invention.

[0097] The following examples demonstrate, through comparative experiments, that adding asymmetric bases next to the spacer sequence can improve the detection sensitivity of RNases. This optimization method is effective for any spacer sequence, but when the spacer sequence reaches a certain length (>20 nt), adding asymmetric bases no longer improves the detection effect of the probe. Furthermore, the effect of the asymmetric base sequence on the detection effect was compared; adding any asymmetric base sequence and length can improve the detection effect of the original probe, but adding an A base yields the best results.

[0098] All probes responded to RNase A and showed an increase in fluorescence value. The following comparisons are made according to different experimental purposes.

[0099] Example 1: The effect of asymmetric base sequence on detection sensitivity

[0100] 1. Material preparation

[0101] The probes shown in Table 1 were synthesized. All probes had FAM groups at the 5' end and BHQ groups at the 3' end. The underlined lines indicate the positions of the fluorescent or quenching groups.

[0102] Table 1. RNA probe sequences

[0103]

[0104] 2. System configuration

[0105] All the probes were diluted with enzyme-free water to a working concentration of 1 pmol / ul; 10X reaction buffer was prepared with 20 mM Tris and 20 mM MgCl2, and the pH was adjusted to 7.5; RNase A (Thermo Scientific) was diluted with enzyme-free water.

[0106] #EN0531; 10 mg / ml) to 0.01, 0.05, 0.1, 1 ng / ml were used as test samples; enzyme-free water was used as a negative control.

[0107] Prepare the following reaction system in a black ELISA plate:

[0108] Components Added amount Final concentration RNA probes 5ul 0.5 pmol / ul 10X reaction buffer 10ul 1× RNase A 10ul 0.01-1 ng / ml Enzyme-free water Adjust the volume to 100ul

[0109] Because RNase A reacts with the probe very quickly, the entire system preparation was carried out on ice to avoid the reaction from being too fast.

[0110] 3. Reaction detection

[0111] Fluorescence values ​​were detected using a SpectraMax iD5 multi-functional microplate reader. In fact, any instrument capable of observing fluorescence changes can be used for this step. The excitation wavelength was set to 485 nm and the emission wavelength to 520 nm according to the probe's fluorescent tag. The reaction was carried out at 25°C for 1 hour, with data read every minute.

[0112] 4. Data Analysis

[0113] Fluorescence data for all probes were collected, and a line graph was plotted with fluorescence value on the ordinate and reaction time on the x-axis. The results are shown in [Figure number missing]. Figure 2 The numbers in the legend represent the total amount of RNase added to the corresponding system. Comparing probes SEQ ID NO:2-3, SEQ ID NO:5, SEQ ID NO:10-11, and SEQ ID NO:15, these probes have the same spacer sequence but different asymmetric base sequences. The asymmetric base sequences at both ends of SEQ ID NO:2 and SEQ ID NO:3 are both single bases, specifically a single base A and a single base U, respectively. The asymmetric base sequence of SEQ ID NO:5 contains two bases: a base G at the 5' end and a base A at the 3' end. The asymmetric base sequences at both the 5' and 3' ends of SEQ ID NO:10 contain two non-complementary bases. Without changing the position of the fluorophore, except for SEQ ID NO:11, the detection sensitivity of probes with extended spacer sequences was significantly improved. This indicates that the asymmetric base sequence can be varied, and the optimization effect is better when the added sequence is an A base. The sequence of asymmetric bases cannot be arbitrary. In the asymmetric base sequence of SEQ ID NO:11 (“ACUGACA”, “ACAUCAG”), the highest proportion of non-complementary bases accounts for 71.41% of the total length of the asymmetric base sequence, while in the asymmetric base sequence of SEQ ID NO:10 (“ACACACA”), the highest proportion of non-complementary bases accounts for 100% of the total length of the asymmetric base sequence. In comparison, SEQ ID NO:11 is more likely to pair with other bases, leading to a decrease in enzyme digestion efficiency. Therefore, there is no observable improvement in the detection sensitivity of this probe design. In the asymmetric base sequence of SEQ ID NO:15 (“ACACGCA”, “ACAGACA”), the highest proportion of non-complementary bases accounts for 85.71% of the total length of the asymmetric base sequence. The asymmetric base sequence shown in SEQ ID NO:15 has a similar sequence structure to that shown in SEQ ID NO:10, forming a single-stranded sequence that is conducive to enzyme digestion. Therefore, the detection sensitivity remains at a high level and is higher than that of using a single spacer sequence (SEQ ID NO:10). NO:1) significantly improves the effectiveness of probes.

[0114] Example 2: The effect of asymmetric base sequence length on detection sensitivity

[0115] 1. Material preparation

[0116] The probes shown in Table 2 were synthesized. All probes have FAM groups at the 5' end and BHQ groups at the 3' end. The underlined lines indicate the positions of fluorescent or quenching groups.

[0117] Table 2. RNA probe sequences

[0118]

[0119] 1. System configuration

[0120] All the probes were diluted with enzyme-free water to a working concentration of 1 pmol / ul; 10X reaction buffer was prepared with 20 mM Tris and 20 mM MgCl2, and the pH was adjusted to 7.5; RNase A (Thermo Scientific) was diluted with enzyme-free water.

[0121] #EN0531; 10 mg / ml) to 0.01, 0.05, 0.1, 1 ng / ml were used as test samples; enzyme-free water was used as a negative control.

[0122] Prepare the following reaction system in a black ELISA plate:

[0123] Components Added amount Final concentration RNA probes 5ul 0.5 pmol / ul 10X reaction buffer 10ul 1× RNase A 10ul 0.01-1 ng / ml Enzyme-free water Adjust the volume to 100ul

[0124] Because RNase A reacts with the probe very quickly, the entire system preparation was carried out on ice to avoid the reaction from being too fast.

[0125] 2. Reaction detection

[0126] Fluorescence values ​​were detected using a SpectraMax iD5 multi-functional microplate reader. In fact, any instrument capable of observing fluorescence changes can be used for this step. The excitation wavelength was set to 485 nm and the emission wavelength to 520 nm according to the probe's fluorescent tag. The reaction was carried out at 25°C for 1 hour, with data read every minute.

[0127] 3. Data Analysis

[0128] Comparing probes SEQ ID NO:1, 2, and 4, the same spacer sequence has asymmetric bases A added to both ends, but their lengths are 7 nt and 39 nt, respectively. From the corresponding... Figure 3 It can be seen that adding asymmetric bases can effectively improve sensitivity, while the length of the added bases has little effect on the detection effect.

[0129] Example 3: The effect of asymmetric base sequence position on detection sensitivity

[0130] 1. Material preparation

[0131] The probes shown in Table 3 were synthesized. All probes had FAM groups at the 5' end and BHQ groups at the 3' end. The underlined lines indicate the positions of the fluorescent or quenching groups.

[0132] Table 3. RNA probe sequences

[0133]

[0134] 1. System configuration

[0135] All the probes were diluted with enzyme-free water to a working concentration of 1 pmol / ul; 10X reaction buffer was prepared with 20 mM Tris and 20 mM MgCl2, and the pH was adjusted to 7.5; RNase A (Thermo Scientific) was diluted with enzyme-free water.

[0136] #EN0531; 10 mg / ml) to 0.01, 0.05, 0.1, 1 ng / ml were used as test samples; enzyme-free water was used as a negative control.

[0137] Prepare the following reaction system in a black ELISA plate:

[0138] Components Added amount Final concentration RNA probes 5ul 0.5 pmol / ul 10X reaction buffer 10ul 1× RNase A 10ul 0.01-1 ng / ml Enzyme-free water Adjust the volume to 100ul

[0139] Because RNase A reacts with the probe very quickly, the entire system preparation was carried out on ice to avoid the reaction from being too fast.

[0140] 2. Reaction detection

[0141] Fluorescence values ​​were detected using a SpectraMax iD5 multi-functional microplate reader. In fact, any instrument capable of observing fluorescence changes can be used for this step. The excitation wavelength was set to 485 nm and the emission wavelength to 520 nm according to the probe's fluorescent tag. The reaction was carried out at 25°C for 1 hour, with data read every minute.

[0142] 3. Data Analysis

[0143] In Examples 1 and 2, the case of asymmetric base addition on both sides of the spacer sequence has been discussed. Figure 4 It is evident that when an asymmetric base is added to one end of SEQ ID NO:6 (SEQ ID NO:7), this optimization strategy is also effective in improving sensitivity. This indicates that adding an asymmetric base to either side of the spacer sequence is beneficial; the asymmetric base can be simply designed as a single base.

[0144] Example 4: The effect of interval sequences on detection sensitivity

[0145] 1. Material preparation

[0146] The probes shown in Table 4 were synthesized. All probes had FAM groups at the 5' end and BHQ groups at the 3' end. The underlined lines indicate the positions of the fluorescent or quenching groups.

[0147] Table 4. RNA probe sequences

[0148]

[0149] 1. System configuration

[0150] All the probes were diluted with enzyme-free water to a working concentration of 1 pmol / ul; 10X reaction buffer was prepared with 20 mM Tris and 20 mM MgCl2, and the pH was adjusted to 7.5; RNase A (Thermo Scientific) was diluted with enzyme-free water.

[0151] #EN0531; 10 mg / ml) to 0.01, 0.05, 0.1, 1 ng / ml were used as test samples; enzyme-free water was used as a negative control.

[0152] Prepare the following reaction system in a black ELISA plate:

[0153] Components Added amount Final concentration RNA probes 5ul 0.5 pmol / ul 10X reaction buffer 10ul 1× RNase A 10ul 0.01-1 ng / ml Enzyme-free water Adjust the volume to 100ul

[0154] Because RNase A reacts with the probe very quickly, the entire system preparation was carried out on ice to avoid the reaction from being too fast.

[0155] 2. Reaction detection

[0156] Fluorescence values ​​were detected using a SpectraMax iD5 multi-functional microplate reader. In fact, any instrument capable of observing fluorescence changes can be used for this step. The excitation wavelength was set to 485 nm and the emission wavelength to 520 nm according to the probe's fluorescent tag. The reaction was carried out at 25°C for 1 hour, with data read every minute.

[0157] 3. Data Analysis

[0158] In Examples 1-3, the position and sequence of the asymmetric base sequence were clarified, and different spacer sequences were used to demonstrate that the addition of asymmetric bases had beneficial effects. However, this addition strategy is also subject to certain limitations in some cases. Comparing SEQ ID NO:1 and SEQ ID NO:8, their lengths and sequences are different; they serve as spacer sequences for SEQ ID NO:2 and SEQ ID NO:9, respectively. Figure 5It can be simply observed that adding asymmetric bases can improve the detection effect, while adding spacer sequences has almost no optimization effect, indicating that the length of the spacer sequence directly affects the improvement effect. When the sequence length between fluorescent groups reaches more than 16 bases, the increase is already small.

[0159] Example 5: The effect of fluorescent group position on detection sensitivity

[0160] 1. Material preparation

[0161] The probes shown in Table 5 were synthesized. All probes have FAM groups at the 5' end and BHQ groups at the 3' end. The underlined lines indicate the positions of fluorescent or quenching groups.

[0162] Table 5. RNA probe sequences

[0163] Sequence List Number specific sequence length SEQ ID NO:2 AAAAAAACUGCAUAAAAAAA 20 SEQ ID NO:12 AAAAAAACUGCAUAAAAAAA 20 SEQ ID NO:13 AAAAAAACUGCAUAAAAAAA 20 SEQ ID NO:14 AAAAAAACUGCAUAAAAAAA 20

[0164] 2. System configuration

[0165] All the probes were diluted with enzyme-free water to a working concentration of 1 pmol / ul; 10X reaction buffer was prepared with 20 mM Tris and 20 mM MgCl2, and the pH was adjusted to 7.5; RNase A (Thermo Scientific) was diluted with enzyme-free water.

[0166] #EN0531; 10 mg / ml) to 0.01, 0.05, 0.1, 1 ng / ml were used as test samples; enzyme-free water was used as a negative control.

[0167] Prepare the following reaction system in a black ELISA plate:

[0168]

[0169]

[0170] Because RNase A reacts with the probe very quickly, the entire system preparation was carried out on ice to avoid the reaction from being too fast.

[0171] 3. Reaction detection

[0172] Fluorescence values ​​were detected using a SpectraMax iD5 multi-functional microplate reader. In fact, any instrument capable of observing fluorescence changes can be used for this step. The excitation wavelength was set to 485 nm and the emission wavelength to 520 nm according to the probe's fluorescent tag. The reaction was carried out at 25°C for 1 hour, with data read every minute.

[0173] 4. Data Analysis

[0174] Since detection is based on the separation of fluorescent and quenching groups, the position of the groups on the probe has a significant impact on the detection effect. There are four possible distributions of the groups: both located on the spacer sequence, on asymmetric base sequences on different sides, on asymmetric base sequences on the same side, or one group on the spacer sequence and the other on an asymmetric base sequence. To illustrate suitable group positions, probe sequences SEQ ID NO:2, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14 are compared. They can all be understood as a combination of the spacer sequence "CUGCAU" and the asymmetric base sequences on both sides consisting of a single base A. The main difference lies in the positions of the fluorescent and quenching groups: in SEQ ID NO:2, both groups are located on the spacer sequence; in SEQ ID NO:12, the fluorescent group is located on the spacer sequence, and the quenching group is located on an asymmetric base sequence; in SEQ ID NO:13, both groups are located on the same asymmetric base sequence; and in SEQ ID NO:14, both groups are located on asymmetric base sequences on different sides. From the detection results... Figure 6 The results show that the fluorescent group and the quencher group are located on the spacer sequence at the same time, which may be because the effective RNase cleavage sites are the most in this case. In contrast, when the fluorescent group and the quencher group are both located on the asymmetric base sequence, the effective RNase cleavage sites are usually the fewest or even non-existent, resulting in the lowest detection sensitivity. The detection effect is moderate in the other two cases, but still better than SEQ ID NO:1.

[0175] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit this application. Any person skilled in the art can modify or alter the above embodiments without departing from the spirit and scope of this application. Therefore, all equivalent modifications or alterations made by those skilled in the art without departing from the spirit and technical concept disclosed in this invention should still be covered by the claims of this application.

Claims

1. A nucleic acid probe, which is a single-stranded oligonucleotide comprising a spacer sequence, at least one side of the spacer sequence being modified with an asymmetric base sequence of 1-50 nt, the asymmetric base sequence comprising a majority base; the number of the majority base accounting for more than 80% of the total length of the asymmetric base; the nucleic acid probe comprising a fluorescent group and a quencher group; the majority base being present in the following cases: a) when the asymmetric base is two or less, a1) the majority base is the one with the highest number of complementary bases; a2) the majority base is the two non-complementary bases; a3) the majority base is the only base; b) when the asymmetric base is more than two, the majority base is the two non-complementary bases with the highest number. The nucleic acid probe has a length of 10-100 nt; and / or, the spacer sequence has a length of 1-16 nt; and / or, when the spacer sequence is modified with asymmetric bases on both sides, the asymmetric bases on both sides are non-complementary; and / or, when the asymmetric base sequence is one base, the base is a purine; preferably, the base is adenine; and / or, the number of the majority base accounts for 100% of the total length of the asymmetric base; and / or, when the asymmetric base comprises two or more bases, the two non-complementary bases with the highest number account for at least 80% of the total length of the asymmetric base sequence; and / or, the fluorescent group and the quencher group are not located at the same end of the single-stranded oligonucleotide; preferably, the fluorescent group and the quencher group are not located on the same side of the asymmetric base; more preferably, the fluorescent group and the quencher group are located at the two ends of the spacer sequence, respectively; and / or, the fluorescent group and the quencher group are at least 2 bases apart; and / or, each base of the nucleic acid probe is a natural, modified or unnatural nucleoside base; and / or, optionally, the nucleic acid probe comprises modified ribose, the modification comprising one or more of 2'-O-methylation modification, 2'-methoxyethyl modification, 2'-F modification, 2'-deoxy modification, 2'-amino modification, acyclic derivatization, 2'O and 4'C linked by a methylene bridge, 2'-O-propargyl modification, 3'-deoxy modification, and 2', 3' dideoxy modification; and / or, optionally, the nucleic acid probe comprises a modification of the phosphodiester bond connecting the nucleotides, the modification comprising a sulfur modification or a boranation modification of non-bridge oxygen atoms in the phosphate backbone; and / or, the single-stranded oligonucleotide is RNA. The nucleic acid probe comprises a nucleic acid sequence as shown in SEQ ID NO: 2-5, 7, 10, 12, 14, 15. The fluorescent group is selected from FAM, HEX, TET, ROX, TAMRA, JOE, Cy3 or Cy5; preferably, the fluorescent group is FAM; and / or, the quencher group is selected from BHQ, TRAMA, FAM or Dabcyl; preferably, the quencher group is BHQ. 5.Use of the nucleic acid probe according to any one of claims 1-4 as an RNase substrate. ​ 2. The nucleic acid probe of claim 1, wherein, ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ 3. The nucleic acid probe according to any one of claims 1 to 2, wherein ​ 4. The nucleic acid probe of claim 1, wherein ​ ​ ​ 6. Use according to claim 5, characterized in that, The RNase includes a combination of one or more of RNase A, RNase H, RNase T and RNase I.

7. Use of the nucleic acid probe according to any one of claims 1-4 in the preparation of a product for detecting ribonuclease.

8. A method for detecting ribonuclease, wherein the nucleic acid probe according to any one of claims 1-4 is added to a sample to be tested and reacted, and the ribonuclease in the sample to be tested is qualitatively or quantitatively detected according to the fluorescence value in the reaction product.

9. The detection method of claim 8, wherein, The RNase includes a combination of one or more of RNase A, RNase T, RNase I and RNase H; And / or, the working concentration of the nucleic acid probe is 0.01-10 pmol / μL; And / or, the reaction further includes a reaction buffer and enzyme-free water; preferably, the reaction buffer includes 10-100 mM Tris and 0-0.1 M MgCl2.

10. The method of claim 8, wherein the detecting is performed by a method selected from the group consisting of mass spectrometry, nuclear magnetic resonance, and chromatography. The method for measuring the fluorescence value includes detection by a fluorescence spectrophotometer, real-time quantitative PCR, electrophoresis, HPLC, electrochemistry or naked eye observation under specific light.

11. A detection kit for ribonuclease, comprising the nucleic acid probe according to any one of claims 1-4, a reaction buffer and enzyme-free water; preferably, the detection kit further includes a RNase standard.

12. The test kit of claim 11, wherein The working concentration of the RNase substrate is 0.01-10 pmol / μL; And / or, the reaction buffer includes 10-100 mM Tris and 0-0.1 M MgCl2; And / or, the RNase in the RNase standard is selected from RNase A, RNase T, RNase I or RNase H.

13. Use of the detection method according to any one of claims 8-10 or the detection kit according to any one of claims 11-12 in the detection of ribonuclease.

Images