Method for processing biological tissue for fluorescence in situ hybridization and use thereof

Abstract

The application belongs to the technical field of biomedicine, and particularly relates to a biological tissue processing method for fluorescence in situ hybridization and application. The method comprises the following steps: contacting a biological tissue containing target nucleic acid with a nucleic acid probe to form a nucleic acid hybridization complex; and contacting the biological tissue with a reagent containing a cationic polymer; wherein the cationic polymer is at least one selected from a positively charged polypeptide, a protein or a polyamino acid, an amine polymer and a cationic polysaccharide. The application can enhance the stability of the hybridization signal after nucleic acid fluorescence in situ hybridization, and is beneficial to signal preservation in subsequent multi-modal staining, tissue transparentization processing and long-time preservation of the sample.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology. Specifically, this invention relates to a method and application for processing biological tissues for fluorescence in situ hybridization, particularly suitable for nucleic acid fluorescence detection or nucleic acid fluorescence imaging of biological tissues. Background Technology

[0002] Nucleic acid in situ hybridization (FISH) technology, with its ability to visualize and locate specific nucleic acid sequences while preserving the spatial structure of tissues or cells, has become an indispensable core tool in molecular pathology diagnosis, developmental biology research, and neuroscience exploration. By using specific nucleic acid probes, FISH technology can reveal the presence, expression levels, and spatial distribution characteristics of genes in situ within cells or tissues.

[0003] Current advancements in life science research have placed stringent demands on the detection of nucleic acid signals. Against this backdrop, multimodal staining techniques, three-dimensional histology techniques, and single-molecule analysis techniques have developed rapidly.

[0004] In multimodal staining techniques, tissue samples undergo multiple staining processes, such as prolonged antibody incubation and elution, which are often time-consuming and make it difficult to achieve a strictly enzyme-free environment. In three-dimensional histology studies, three-dimensional permeation staining of tissue samples requires complex modulation of antigen-antibody binding, and the clearing of tissue samples requires treatment with clearing reagents to achieve deep imaging, inevitably introducing some harsh chemical denaturation conditions. Before high-resolution imaging, samples are usually embedded in mounting media with specific refractive indices and compositions. The various reagents and harsh conditions used in these post-processing steps can easily lead to the dissociation, degradation, or elution of the formed nucleic acid probe-target hybridization complex, resulting in signal attenuation or even complete loss.

[0005] Currently, existing technologies mainly focus on sequence optimization and amplification methods during the hybridization process, but lack processing methods for modulating the hybridization complex after hybridization to make it more suitable for subsequent detection needs, especially lacking schemes to enhance the stability of hybridization signals.

[0006] Therefore, developing a method to effectively improve the stability and compatibility of nucleic acid hybridization signals, so as to achieve long-term stability of hybridization signals and tolerance to tissue processing, is of great significance for realizing three-dimensional, multimodal, and high-precision detection and promoting the development of molecular pathology, life sciences and clinical diagnostics. Summary of the Invention

[0007] This invention provides a method for stabilizing nucleic acid fluorescence in situ hybridization signals, which can achieve long-term stability of the fluorescence in situ hybridization signals and tolerance to tissue processing operations.

[0008] On one hand, this invention proposes a method for processing biological tissues for fluorescence in situ hybridization, comprising: (1) Contact the biological tissue containing the target nucleic acid with the nucleic acid probe to form a nucleic acid hybridization complex containing fluorescent dye; (2) Contact the biological tissue with a reagent containing a cationic polymer; The cationic polymer is selected from at least one of positively charged polypeptides, proteins or polyamino acids, amine polymers, and cationic polysaccharides.

[0009] In some embodiments, the nucleic acid probe comprises a fluorescent dye, or the nucleic acid probe comprises a ligand capable of binding to a fluorescent dye-containing label.

[0010] For example, in some embodiments, the nucleic acid probe is conjugated with biotin. After a tissue sample containing the target nucleic acid comes into contact with the nucleic acid probe, avidin containing a fluorescent dye is added, thereby forming a nucleic acid hybridization complex containing a fluorescent dye. Alternatively, in other embodiments, the nucleic acid probe is conjugated with digoxigenin. After a tissue sample containing the target nucleic acid comes into contact with the nucleic acid probe, a digoxigenin antibody containing a fluorescent dye is added, thereby forming a nucleic acid hybridization complex containing a fluorescent dye.

[0011] The fluorescent dye can be any suitable fluorescent dye in the art. In some embodiments, the fluorescent dye is selected from at least one of cyanine dyes, indocyanine dyes, rhodamine and its derivatives, and squaraine dyes.

[0012] In some embodiments, the positively charged polypeptide, protein, or polyamino acid is selected from at least one of protamine, histone, poly-L-lysine (PLL), poly-L-arginine, and poly-L-ornithine; preferably, the amine polymer is selected from at least one of polyethyleneimine (PEI), polyhexamethylene biguanide, polyhexamethylene guanidine, polydiallyl dimethylammonium salt, polyallylamine, polyamide-amine dendritic macromolecule (PAMAM), polygluconamine, and cationic polyacrylamide; the cationic polysaccharide is selected from at least one of chitosan and its quaternary ammonium salt derivatives.

[0013] In some embodiments, the mass concentration of the cationic polymer in the reagent is at least 0.01%, for example, it can be 0.01%-10%, preferably 0.01%-1%, for example 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8% or 0.9%, more preferably 0.01-0.5%.

[0014] In some embodiments, the contact time between the tissue sample and the reagent containing the cationic polymer is 10-60 min, such as 15 min, 20 min, 25 min, 30 min, 35 min, 40 min, 45 min, 50 min or 55 min, preferably 20-40 min.

[0015] In some embodiments, the target nucleic acid and the nucleic acid probe are DNA or RNA.

[0016] In some embodiments, the method for forming the nucleic acid hybridization complex is fluorescence in situ hybridization (FISH), single-molecule fluorescence in situ hybridization (smFISH), fluorescence in situ hybridization combined with hybridization chain reaction (HCR-FISH), fluorescence in situ hybridization combined with rolling circle amplification (RCA-FISH), SABER-FISH, clampFISH, or Π-FISH.

[0017] In some embodiments, the reagent containing the cationic polymer further comprises a solvent, which may be water or an organic solvent.

[0018] In some embodiments, the cationic polymer-containing reagent further comprises one or more of a buffer salt, a phase transfer aid, and a preservative.

[0019] In some embodiments, the buffer salt is selected from one or more of phosphates, Tris-HCl, bicarbonates, borates, MES, and HEPES; the phase transfer aid may be selected from one or more of quaternary ammonium salts (e.g., tetrabutylammonium bromide), crown ethers (e.g., 18-crown ether-6 and 15-crown ether-5), and cryptanes; and the preservative is selected from one or more of sodium azide and proclin 300.

[0020] The contact described in this invention refers to immersing biological tissue in a suitable solution (e.g., a solution containing nucleic acid probes or a reagent containing cationic polymers).

[0021] On the other hand, the present invention also proposes a kit for nucleic acid fluorescence detection or nucleic acid fluorescence imaging, comprising a target nucleic acid specific recognition probe and the reagent containing the cationic polymer.

[0022] In some embodiments, the cationic polymer-containing reagent further comprises one or more of a buffer salt, a phase transfer aid, and a preservative.

[0023] In some embodiments, the buffer salt is selected from one or more of phosphates, Tris-HCl, bicarbonates, borates, MES, and HEPES; the phase transfer aid may be selected from one or more of quaternary ammonium salts (e.g., tetrabutylammonium bromide), crown ethers (e.g., 18-crown ether-6 and 15-crown ether-5), and cryptanes; and the preservative is selected from one or more of sodium azide and proclin 300.

[0024] In another aspect, the present invention also proposes the application of the kit in nucleic acid fluorescence detection or nucleic acid fluorescence imaging.

[0025] In this application, cationic polymers can enhance the stability of nucleic acid fluorescence signals and improve resistance to nuclease degradation and tolerance to biological tissue treatment.

[0026] Compared with the prior art, the present invention has the following main technical advantages: This invention, after the nucleic acid probe hybridizes with the target nucleic acid, treats tissue samples using a combination of reagents containing cationic polymers. This significantly improves the thermal stability, resistance to nuclease degradation, and tolerance to tissue treatments (such as high-concentration detergents and clearing processes) of the hybridization complex while completely maintaining the in-situ information of the target nucleic acid. Because this invention improves the thermal stability of the hybridization complex, subsequent biological treatments can be carried out at higher temperatures and under more stringent biochemical conditions, thereby improving processing efficiency and detection accuracy.

[0027] Therefore, this invention can enhance the stability of hybridization signals after nucleic acid fluorescence in situ hybridization, which is beneficial for signal preservation in scenarios such as subsequent multimodal staining, tissue clearing treatment, and long-term preservation of samples. Attached Figure Description

[0028] The following figures are intended only to illustrate and explain the present invention and do not limit the scope of the invention. Wherein: Figure 1 This indicates the effect of PBS treatment at different temperature gradients on the HCR fluorescence signal of SST-mRNA; Figure 2 This represents a statistical comparison of the signal intensity of PBS under different temperature treatments with the room temperature (RT) control. Figure 3 This indicates the effect of different formulations on the SST-mRNA HCR fluorescence signal at 65℃. Figure 4 This represents a statistical comparison of the signal intensity of different formulations with that of PBS at 65°C. Figure 5 This shows SST-mRNA HCR fluorescence imaging images treated with other formulations at 65℃. Figure 6 This represents a statistical comparison of the signal intensity of other formulations with that of PBS at 65°C. Figure 7 Images showing SST-mRNA HCR fluorescence imaging of PEI and protamine sulfate preparations at different concentration gradients; Figure 8 The statistical results of signal intensity for different concentrations of PEI, protamine sulfate, and the PBS control group are presented. Figure 9 Fluorescent imaging images showing PEI's resistance to enzymes and harsh chemicals; Figure 10 The effect of different chemical substances on HCR signal intensity (compared with the RT-control group); Figure 11 This indicates the protective effect of PEI against the damage of HCR reactions caused by different chemical substances; The length of the scale bar marker in each micrograph is set to 100 μm. Detailed Implementation

[0029] The present invention will be further described below with reference to embodiments. The description of the embodiments below is only for the purpose of helping to understand the present invention. It should be noted that those skilled in the art can make several improvements and modifications to the present invention without departing from the principle of the present invention, and these improvements and modifications also fall within the protection scope of the claims of the present invention.

[0030] In this specification, the reference to "one embodiment" means that the specific features, structures, parameters, steps, etc., described in that embodiment are included in at least one embodiment according to the present invention. Therefore, in this specification, the use of terms such as "according to one embodiment of the present invention" or "in one embodiment" does not specifically refer to the same embodiment, and the use of terms such as "in another embodiment," "different embodiments of the present invention," or "other embodiments of the present invention" does not specifically mean that the mentioned features can only be included in specific different embodiments. Those skilled in the art should understand that the specific features, structures, parameters, steps, etc., disclosed in one or more embodiments of this specification can be combined in any suitable manner.

[0031] Example 1: High-Temperature Degradation Model of mRNA Based on Temperature Gradient Screening and Validation of Stable Fluorescence Signal by Cationic Polymer This embodiment aims to explore the degradation temperature of somatostatin (SST) mRNA hybridization chain reaction (HCR) fluorescence signal in mouse brain tissue. By isothermal intervention in a PBS system at gradient temperatures of 37 ℃, 45 ℃, 55 ℃, and 65 ℃ for 0.5 h, and comparing with baseline samples at room temperature, the damage temperature that significantly attenuates and diffuses the HCR-specific fluorescence was screened. Then, under this determined high-temperature condition, the stabilizing effects of treatment with three functional agents—0.5% PEI (Aladdin, catalog number: E107080), 0.5% protamine sulfate (Aladdin, catalog number: P123670), and 0.5% chitosan quaternary ammonium salt (Maclean, catalog number: 850126)—on the HCR in situ hybridization amplified fluorescence signal were compared.

[0032] Experimental samples: Several 24-week-old C57BL / 6J mice were selected, and their brain tissue was dissected after cardiac perfusion. Coronal sections of brain tissue with a thickness of 100 μm were prepared for later use.

[0033] Experimental reagents: Hybridization Buffer I: 10 mL of formamide (Aladdin, catalog number: F120616-250mL), 10 mL of 20×SSC stock solution (Sangon Biotech, catalog number: B548109-0200), 300 μL of 1M citric acid stock solution (pH 6.0), 200 μL of 10% Tween-20 stock solution (Aladdin, catalog number: T108669), 100 μL of 5 mg / mL heparin stock solution (Aladdin, catalog number: H758140), 6 mL of 50% dextran sulfate stock solution (Yuanye Biotech, catalog number: S14047), 800 μL of 50×Denhardt's stock solution (Aladdin, catalog number: D120788), with the remainder being DEPC. Add purified water (Sangon Biotech, catalog number: B501005-0500, hereinafter the same) to a total of 40 mL.

[0034] Hybridization buffer II: 10 mL of 20×SSC stock solution, 200 μL of 10% Tween-20 stock solution, 6 mL of 50% dextran sulfate stock solution, and the remainder is DEPC pure water to make up to 40 mL.

[0035] Washing buffer: 5×SSCT (10ml 20xSSC plus 400ul 10%Tween-20, bring to a final volume of 40mL).

[0036] The HCR-specific recognition probes and HCR fluorescent amplification probes for SST mRNA detection are shown in Table 1.

[0037] Table 1. SST mRNA-specific recognition probe sequences and HCR fluorescent amplification probes SEQ ID NO SST mRNA specific recognition probe sequence 1 CCAGTTCCTGTTTCCCGGTGGCAGCTAGAAGAGTCTTCCTTTACG 2 AATCCTCGGGCTCCAGGGCATCATTTAGAAGAGTCTTCCTTTACG 3 AGAAGAAGTTCTTGCAGCCAGCTTTTAGAAGAGTCTTCCTTTACG 4 GGAAGAGATATGGGGTTTGGGGGAGTAGAAGAGTCTTCCTTTACG 5 ACAGTCTTCAATTTCTAATGCAGGGTAGAAGAGTCTTCCTTTACG 6 GAGGAGGGCAGCAAACGGAACCAGAGACTTCTGCAGAAACTGACG 7 GAGGAGGGCAGCAAACGGAACTGTCTGGTTGGGCTCGGACAGCAG 8 GAGGAGGGCAGCAAACGGAAGTTCCCGGGGTGCCATTGCTGGGTT 9 GAGGAGGGCAGCAAACGGAAGGATCAGAGGTCTGGCTAGGACAAC 10 GAGGAGGGCAGCAAACGGAAAAGTTGAGCATCGGGGGCCAGGAGT HCR fluorescent amplification probe (containing Cy5 fluorescent dye) 11 CGTAAAGGAAGACTCTTCCCGTTTGCTGCCCTCCTCGCATTCTTTCTTGAGGAGGGCAGCAAACGGGAAGAG 12 GAGGAGGGCAGCAAACGGGAAGAGTCTTCCTTTACGCTCTTCCCGTTTGCTGCCCTCCTCAAGAAAGAATGC Experimental instruments and analysis software: constant temperature controlled incubator, laser confocal scanning microscope, Imaris fluorescence image analysis software.

[0038] Experimental methods: 1. Preprocessing of brain tissue sections Take a 100 μm coronal section of mouse brain tissue after preparation, and rinse it three times with PBS buffer at room temperature, with each rinse lasting 5 min, to fully remove residual impurities in the tissue.

[0039] 2. HCR in situ hybridization staining Add hybridization buffer I containing SST mRNA-specific detection probes to completely immerse the slides in the probe hybridization system; incubate at 37°C in the dark for 12 h; after incubation, rinse three times with washing buffer at room temperature for 5 min each time; then add hybridization buffer II containing HCR fluorescent amplification probes and incubate at room temperature in the dark for 12 h; after incubation, rinse three times with washing buffer at room temperature for 5 min each time, and then rinse twice with PBS buffer at room temperature for 5 min each time to complete the HCR standard staining procedure.

[0040] 3. Grouping and Temperature Intervention 3.1 Brain tissue sections that have undergone HCR standard staining were randomly grouped and treated with a single system of pure PBS buffer. The intervention temperatures were set at 37 ℃, 45 ℃, 55 ℃, and 65 ℃, respectively. Meanwhile, sections that did not undergo high-temperature intervention were retained as a room temperature control group (RT-Control). Each group of sections was placed in a constant temperature incubator with the corresponding temperature gradient and treated for 30 min. 3.2 After the treatment, the cells were rinsed twice with PBS buffer at room temperature for 5 min each time, and HCR-specific fluorescence images of SST-mRNA in each group were collected.

[0041] 3.3 The PBS group showed a statistically significant difference compared to the room temperature blank control group. Combined with the morphological characteristics of signal contour diffusion and local fluorescence loss, it was determined that the target HCR fluorescence signal had been significantly degraded. 65 ℃ was determined to be the damage temperature that could cause a significant attenuation of the HCR fluorescence signal, and this was used as the temperature condition for subsequent formulation efficacy verification.

[0042] 3.4 Based on the determined critical injury temperature of 65 ℃, brain tissue sections that had undergone standard HCR staining were placed in different preparations for fluorescence imaging comparison. The experiments included: a PBS high-temperature injury control group, a 0.5% PEI preparation experimental group, a 0.5% protamine preparation experimental group, and a 0.5% chitosan quaternary ammonium salt preparation experimental group, all treated simultaneously at 65 ℃.

[0043] The experiment revealed that after treatment at 65 °C for 10 min, the 0.5% PEI preparation group, the 0.5% protamine preparation group, and the 0.5% chitosan quaternary ammonium salt preparation group exhibited higher HCR fluorescence signal intensity than the PBS high-temperature damage control group, and the difference in fluorescence signal intensity gradually increased with the extension of treatment time. After treatment at 65 °C for 30 min, the difference in fluorescence signal intensity between each experimental group and the PBS high-temperature damage control group was quite significant and relatively stable. When the treatment time was extended to 60 min, the difference in fluorescence signal intensity between each experimental group and the PBS high-temperature damage control group changed little. Therefore, considering the treatment efficiency and experimental time, the subsequent high-temperature treatment time in this invention was selected as 30 min.

[0044] After the temperature intervention was completed, the brain tissue sections of each group were rinsed twice with PBS buffer to thoroughly remove residual preparations and impurities from the surface of the sections and terminate the temperature intervention reaction.

[0045] With fixed laser confocal microscopy imaging parameters, in situ fluorescence imaging was performed on brain tissue sections from all groups. Imaris image analysis software was used to analyze the imaging results for each group; the analysis indicators included: HCR fluorescence signal distribution morphology and average fluorescence intensity. Data aggregation and statistical analysis between groups were completed.

[0046] This example tested the fluorescence intensity of PBS under different temperature conditions, with room temperature (RT) as a control. The results are as follows: 1) such as Figure 1 and Figure 2 As shown, the mean signal intensity of PBS at 37℃, 45℃, and 55℃ were 30, 38.5, and 33, respectively, while the mean signal intensity of the room temperature control group was 34.5. There was no significant difference in signal intensity between the above temperature groups and the room temperature control group. However, at a high temperature of 65℃, the mean signal intensity of PBS decreased significantly to approximately 10, showing a highly statistically significant difference compared to the room temperature control group (P < 0.0001). This result suggests that high temperature (65℃) is a damaging temperature that can cause a significant attenuation of HCR fluorescence signal.

[0047] 2) such as Figure 3 and Figure 4As shown, under high-temperature treatment at 65℃, compared with PBS, PEI, protamine sulfate, and chitosan ammonium salt, three types of protective agents, can significantly maintain the fluorescence signal intensity and effectively inhibit the signal decline caused by high temperature. The differences between groups are statistically significant.

[0048] It is evident that the PEI preparation, protamine preparation, and chitosan quaternary ammonium salt described in this invention can significantly enhance and stably maintain the HCR in situ hybridization fluorescence signal in brain tissue, and all exhibit excellent signal attenuation resistance at high temperatures (65°C).

[0049] Example 2: Fluorescence stability verification test of other cationic polymers Based on the treatment system described in Example 1 above, the test formulations were further expanded, and six candidate substances were selected for broad-spectrum compatibility verification: poly-L-arginine (Jizhi Biochemical, catalog number: P23843-1g), ε-polylysine hydrochloride (Yuanye Biotechnology, catalog number: S25425-1g), polyacrylamide (Maclean, catalog number: P875616-100g), polygluconate (Aladdin, catalog number: P1501912-1ml), polyallylamine hydrochloride (Aladdin, catalog number: P194734-5g), and polydiallyl dimethyl ammonium chloride (Aladdin, catalog number: P109719-100ml).

[0050] The processing conditions were uniformly set as follows: processing temperature 65℃, constant temperature incubation time 30min, and the same statistical process as the sample pretreatment, fluorescence imaging acquisition and signal quantification conditions in Example 1.

[0051] like Figure 5 and Figure 6 As shown, the results of fluorescence imaging observation and fluorescence signal intensity analysis indicate that after the above-mentioned heat treatment, the six test preparations showed no significant quenching or diffusion of signals in the fluorescence imaging field of view compared with PBS, and their fluorescence signals were still significantly better than those of the PBS group.

[0052] In summary, the substances tested in this embodiment can effectively retain stable fluorescence signals under the treatment conditions of 65°C and 30 min.

[0053] Example 3: Gradient verification experiment on the fluorescence signal retention effect of cationic polymers of different concentrations Two target functional substances were selected and four mass concentration gradient systems were prepared at 0.01%, 0.05%, 0.1%, and 0.5%, respectively. The established heat treatment parameters (65℃, isothermal treatment for 30 min) and standard procedures for fluorescence imaging acquisition and signal quantitative statistics in the previous examples were strictly followed, and the system was compared with the PBS group in parallel.

[0054] Figure 7 and Figure 8This study demonstrates the effects of different concentrations of PEI and protamine on fluorescence signal intensity and compares them with the PBS group. With PBS as the control group, the experimental groups (0.01%, 0.05%, 0.1%, 0.5% PEI groups, 0.1%, 0.5% protamine groups) showed highly statistically significant differences compared to the control group (P < 0.0001). Although there were no significant statistical differences between the 0.01% protamine group and the 0.05% protamine group and the PBS group (P > 0.05, indicated as ns), the fluorescence signal intensity of the 0.01% and 0.05% protamine groups was higher than that of the PBS group. In summary, both substances effectively improved the fluorescence signal retention rate in a concentration-dependent manner.

[0055] Further research showed that cationic polymers could still improve fluorescence signal retention at higher concentrations (e.g., 1%, or even 10%), but the effect did not change significantly with increasing concentration. Therefore, a suitable cationic polymer concentration is recommended to be 0.01%-1%, preferably 0.01%-0.5%.

[0056] Example 4: Stability verification test of cationic polymers against enzymes and harsh chemicals To further verify the damaging effects of enzymes and different chemical interfering substances on HCR fluorescence signals, and the protective effect of 0.5% PEI on the HCR system, this embodiment systematically examines its resistance to enzymes and chemical substances.

[0057] (1) Experiments on the damage of enzymes and chemical substances to HCR One positive control group (RT-control) and five groups treated with enzymes or chemicals were set up: Positive control group (RT-control): The standard HCR system does not contain any added enzymes or chemical interfering substances; DNase I treatment group: After standard HCR, brain tissue sections were treated with DNase I at a concentration of 15 U / mL for 1 h; 10% FBS treatment group: After standard HCR, brain tissue sections were treated with 10% FBS (TransGen Biotech, catalog number: FS301) for 3 hours. 8% SDS treatment group: After standard HCR, brain tissue sections were treated with 8% SDS for 3 hours; 50% urea treatment group: After standard HCR, brain tissue sections were treated with 50% urea for 3 hours; DIDC treatment group: After standard HCR, brain tissue sections were treated with DIDC reagent (Qingzhun Medical, catalog number: TP-VIVIT-T2) for 3 hours.

[0058] (2) Protection experiment of PEI After standard HCR, the brain tissue slices were transferred into 0.5% PEI and incubated at 37°C in the dark for 30 min to allow the PEI to fully bind with the nucleic acid. Then, the brain tissue slices were treated with the five enzymes or chemical substances mentioned above in this example under the same conditions as in step (1).

[0059] (3) Detection method: After incubation, fluorescence imaging was performed using uniform parameters, and the fluorescence signal intensity within the field of view was statistically analyzed. See the acquired images below. Figure 9 .

[0060] like Figure 10 As shown, compared with the RT-control positive control group, the HCR signal intensity of each chemical treatment group (DNase I, 10% FBS, 8% SDS, 50% urea, DIDC) was significantly reduced, and the difference was statistically significant (P<0.0001), indicating that the above chemical substances can significantly damage the HCR reaction fluorescence signal.

[0061] like Figure 11 As shown, after pretreatment with 0.5% PEI, the fluorescence signal level was significantly restored and improved compared to the single-treatment group, and significantly better than the unprotected group. These results confirm that PEI can effectively resist the damage to the fluorescence system caused by the external environment, achieving significant signal restoration and stable preservation.

[0062] This invention demonstrates that cationic polymers such as polyethyleneimine (PEI) can effectively resist the degradation of nucleic acid chains by nucleases such as DNase I, and significantly inhibit the damage to fluorescence signals in the HCR reaction system. This property can improve the anti-enzyme stability of nucleic acid detection reagents, providing core technical support for the long-term storage of nucleic acid detection reagents.

[0063] To address the destructive effects of common denaturing and interfering reagents such as SDS and urea, the cationic polymer of this invention can effectively resist the damaging effects of these chemicals on HCR amplification reactions, achieving significant repair and stable retention of damaged fluorescence signals. This technology overcomes the technical bottleneck of traditional in situ nucleic acid detection techniques, which cannot withstand the harsh environment of tissue transparency. It enables signal amplification techniques such as HCR to be directly applied to the in situ detection of intact, transparent tissue samples, eliminating the need for complex sample pretreatment and signal repair processes. This significantly improves the sensitivity, accuracy, and ease of operation of in situ nucleic acid detection, providing a highly stable and highly interference-resistant core technology solution for fields such as pathological diagnosis and in situ molecular imaging of tissues, with broad prospects for clinical translation and industrial application.

[0064] Those skilled in the art will understand that, in order to improve the stability and other properties of cationic polymers, reagents containing cationic polymers may also include various auxiliaries, such as buffer salts, phase transfer aids, and preservatives. Buffer salts may be selected from one or more of phosphates, Tris-HCl, bicarbonates, borates, MES, and HEPES. Phase transfer aids may be selected from one or more of quaternary ammonium salts (e.g., tetrabutylammonium bromide), crown ethers (e.g., 18-crown ether-6 and 15-crown ether-5), and cryptanes. Phase transfer aids can promote the permeability of cationic polymers and other components in biological tissues, improving treatment efficiency. The preservatives are selected from one or more of sodium azide and Proclin 300. The properties of these auxiliaries are well known to those skilled in the art and will not be described further here.

[0065] The cationic polymers in this invention can be used alone or together with nucleic acid probes, hybridization buffers, and other components to prepare kits for nucleic acid detection or nucleic acid imaging. These components can be stored in several separate reagent bottles.

[0066] The method described in this invention is based on the interaction between nucleic acids, fluorescent dyes, and cationic polymers. Those skilled in the art will understand that this method is applicable to other situations involving nucleic acid fluorescence detection besides fluorescence in situ hybridization. In these applications, cationic polymers can enhance the stability of nucleic acid fluorescence signals and improve resistance to nuclease degradation and tolerance to biological tissue treatment.

[0067] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for processing biological tissues for fluorescence in situ hybridization, comprising: (1) Contact the biological tissue containing the target nucleic acid with the nucleic acid probe to form a nucleic acid hybridization complex containing fluorescent dye; (2) Contact the biological tissue with a reagent containing a cationic polymer; The cationic polymer is selected from at least one of positively charged polypeptides, proteins or polyamino acids, amine polymers, and cationic polysaccharides.

2. The method according to claim 1, wherein, The nucleic acid probe contains a fluorescent dye, or the nucleic acid probe contains a ligand capable of binding to a label containing a fluorescent dye.

3. The method according to claim 1, wherein, The positively charged polypeptide, protein, or polyamino acid is selected from at least one of protamine, histone, poly-L-lysine (PLL), poly-L-arginine, and poly-L-ornithine; the amine polymer is selected from at least one of polyethyleneimine (PEI), polyhexamethylene biguanide, polyhexamethylene guanidine, polydiallyl dimethylammonium salt, polyallylamine, polyamide-amine dendritic macromolecule (PAMAM), polygluconamine, and cationic polyacrylamide; the cationic polysaccharide is selected from at least one of chitosan and its quaternary ammonium salt derivatives.

4. The method according to claim 1, wherein, In reagents containing cationic polymers, the mass concentration of the cationic polymer is at least 0.01%.

5. The method according to claim 4, wherein, In reagents containing cationic polymers, the mass concentration of the cationic polymer is 0.01-1%.

6. The method according to claim 1, wherein, The contact time between the biological tissue and the reagent containing the cationic polymer is 10-60 min.

7. The method according to claim 6, wherein, The contact time between the biological tissue and the reagent containing the cationic polymer is 20-40 minutes.

8. The method according to claim 1, wherein, The target nucleic acid and nucleic acid probe are DNA or RNA.

9. The method according to claim 1, wherein, Methods for forming nucleic acid hybridization complexes include fluorescence in situ hybridization (FISH), single-molecule fluorescence in situ hybridization (smFISH), fluorescence in situ hybridization combined with hybridization chain reaction (HCR-FISH), fluorescence in situ hybridization combined with rolling circle amplification (RCA-FISH), SABER-FISH, clampFISH, or Π-FISH.

10. The method according to claim 1, wherein, The reagent containing the cationic polymer also includes one or more of the following: buffer salts, phase transfer aids, and preservatives.

11. The method of claim 10, wherein, The buffer salt is selected from one or more of phosphates, Tris-HCl, bicarbonates, borates, MES, and HEPES; the phase transfer aid is selected from one or more of quaternary ammonium salts, crown ethers, and cryptanes; and the preservative is selected from one or more of sodium azide and proclin 300.

12. A kit for nucleic acid fluorescence detection or nucleic acid fluorescence imaging, comprising a target nucleic acid-specific recognition probe and a reagent containing a cationic polymer, wherein the cationic polymer is selected from at least one of positively charged peptides, proteins or polyamino acids, amine polymers, and cationic polysaccharides.

13. The kit according to claim 12, wherein, The positively charged polypeptide, protein, or polyamino acid is selected from at least one of protamine, histone, poly-L-lysine (PLL), poly-L-arginine, and poly-L-ornithine; the amine polymer is selected from at least one of polyethyleneimine (PEI), polyhexamethylene biguanide, polyhexamethylene guanidine, polydiallyl dimethylammonium salt, polyallylamine, polyamide-amine dendritic macromolecule (PAMAM), polygluconamine, and cationic polyacrylamide; the cationic polysaccharide is selected from at least one of chitosan and its quaternary ammonium salt derivatives.

14. The kit according to claim 12, wherein, The reagent containing the cationic polymer also includes one or more of the following: buffer salts, phase transfer aids, and preservatives.

15. The kit according to claim 14, wherein, The buffer salt is selected from one or more of phosphates, Tris-HCl, bicarbonates, borates, MES, and HEPES; the phase transfer aid is selected from one or more of quaternary ammonium salts, crown ethers, and cryptanes; and the preservative is selected from one or more of sodium azide and proclin 300.

16. The use of the kit according to any one of claims 12-15 in nucleic acid fluorescence detection or fluorescence imaging.

Images