Double-stranded ribonucleic acid for inhibiting DGAT2 expression, conjugate and application thereof

By designing specific double-stranded ribonucleic acid conjugates with delivery systems to inhibit DGAT2 gene expression, the problem of effectively inhibiting DGAT2 in existing technologies has been solved, enabling effective treatment of diseases such as NAFLD and NASH.

CN121628902APending Publication Date: 2026-03-10倍臻生物技术有限公司
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511291837.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-09-10
Filing Date
2025-09-10
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

Existing technologies are unable to effectively inhibit the expression of diacylglycerol acyltransferase 2 (DGAT2) gene, leading to the occurrence and development of metabolic diseases such as non-alcoholic fatty liver disease (NAFLD) and non-alcoholic lipohepatitis (NASH).

Method used

Specific double-stranded RNAs, including sense and antisense strands, were designed and synthesized to inhibit the expression of the DGAT2 gene by forming double-stranded regions and specifically binding to it. These double-stranded RNAs can be further conjugated to delivery systems to improve targeting and stability.

Benefits of technology

It significantly inhibits DGAT2 gene expression, reduces triglyceride accumulation, improves insulin sensitivity, and reduces hepatic steatosis. It has good stability and long-lasting effect, and significantly treats DGAT2 expression-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005590421460000111
    Figure BDA0005590421460000111
  • Figure BDA0005590421460000121
    Figure BDA0005590421460000121
  • Figure BDA0005590421460000122
    Figure BDA0005590421460000122
Patent Text Reader

Abstract

The invention discloses double-stranded ribonucleic acid for inhibiting the expression of a diacylglycerol acyltransferase 2 (DGAT2) gene, a conjugate of the double-stranded ribonucleic acid and application of the double-stranded ribonucleic acid and the conjugate in preparation of medicines for treating diseases related to the expression of the DGAT2 gene.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application claims priority to Chinese patent application 2024112663095, filed on September 10, 2024. This application incorporates the entirety of the aforementioned Chinese patent application. TECHNICAL FIELD

[0002] The present application relates to a double-stranded ribonucleic acid for inhibiting the expression of diacylglycerol acyltransferase 2 (DGAT2) gene, a conjugate thereof, and use thereof in the preparation of a medicament for treating a disease associated with the expression of DGAT2. BACKGROUND

[0003] RNA interference (RNAi) refers to a highly conserved phenomenon in evolution, which is induced by double-stranded RNA (dsRNA) and causes efficient and specific degradation of homologous mRNA. RNA interference technology is a biological process that inhibits the expression of a certain gene by destroying specific mRNA.

[0004] Non-alcoholic fatty liver disease (NAFLD) is characterized by the accumulation of triglycerides in the liver of patients, which can develop into a severe form of non-alcoholic steatohepatitis (NASH). Obesity and insulin resistance are common features of NAFLD patients. With the increasing prevalence of obesity and type 2 diabetes, the incidence of NAFLD has been increasing. NAFLD has different characteristics at different stages: only simple hepatic steatosis, and more severe NASH, in which steatosis is accompanied by intralobular inflammation and ballooning, as well as hepatocyte degeneration. NASH is a progressive disease that can lead to cirrhosis and hepatocellular carcinoma. The risk of progression to advanced liver disease depends on factors such as the severity of inflammation and fibrosis, as well as the presence of other diseases such as obesity, type 2 diabetes, and high cholesterol.

[0005] Diacylglycerol acyltransferase (DGAT) is an enzyme that plays a key role in the synthesis of triglycerides (TG). DGAT catalyzes the last step of TG synthesis by linking sn-1,2-diacylglycerol (DAG) with acyl-CoA. The two subtypes, DGAT1 and DGAT2, have different functions and tissue expression patterns, but they both have important functions in TG synthesis. DGAT1 is mainly present in the small intestine and white adipose tissue (WAT), while DGAT2 is mainly present in the liver and white adipose tissue (WAT).

[0006] Inhibition of DGAT2 inhibition can be a viable strategy to develop treatments for NAFLD / NASH and other metabolic syndromes. Targeting DGAT2 inhibition can provide therapeutic benefits by lowering triglycerides, improving insulin sensitivity, and reducing liver steatosis. SUMMARY

[0007] The present application provides a double-stranded ribonucleic acid for inhibiting expression of diacylglycerol acyltransferase 2 (DGAT2) in a cell, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the nucleotides in the double-stranded ribonucleic acid are each independently optionally modified.

[0008] The present application provides a double-stranded ribonucleic acid for inhibiting expression of diacylglycerol acyltransferase 2 (DGAT2) in a cell, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the nucleotides in the double-stranded ribonucleic acid are each independently optionally modified.

[0009] 5'-CGAAAAGCAAAUAGUCUAUGGUGUCC-3' (SEQ ID NO: 8), or

[0010] 5'-CGAAAAUUUCUUUUAAAUAACCCACA-3' (SEQ ID NO: 9), or

[0011] 5'-CGAAUGUAUUUCUGGAACUUCUUCUG-3' (SEQ ID NO: 10), or

[0012] 5'-CGAAUUAAAUAACCCACAGACACCCA-3' (SEQ ID NO: 11).

[0013] In some embodiments, the antisense strand comprises a sequence

[0014] 5'-(invAB)CGAAAAGCAAAUAGUCUAUGGUGUCC-3' (SEQ ID NO: 16), or

[0015] 5'-(invAB)CGAAAAUUUCUUUUAAAUAACCCACA-3' (SEQ ID NO: 17), or

[0016] 5'-(invAB)CGAAUGUAUUUCUGGAACUUCUUCUG-3' (SEQ ID NO: 18), or

[0017] 5’-ACACCAUAGACUAUUUGCUUU-3’ (SEQ ID NO: 1), and the antisense strand comprises the sequence

[0018] 5’-ACACCAUAGACUAUUUGCUUU-3’ (SEQ ID NO: 1), and the antisense strand comprises the sequence

[0019] In some embodiments, the double-stranded ribonucleic acid, wherein:

[0020] (i) the sense strand comprises the sequence

[0021] 5’-ACACCAUAGACUAUUUGCUUU-3’ (SEQ ID NO: 1), and the antisense strand comprises the sequence

[0022] 5’-ACACCAUAGACUAUUUGCUUU-3’ (SEQ ID NO: 1), and the antisense strand comprises the sequence

[0023] 5’-ACACCAUAGACUAUUUGCUUU-3’ (SEQ ID NO: 1), and the antisense strand comprises the sequence

[0024] (ii) the sense strand comprises the sequence

[0025] 5’-ACACCAUAGACUAUUUGCUUU-3’ (SEQ ID NO: 1), and the antisense strand comprises the sequence

[0026] 5’-ACACCAUAGACUAUUUGCUUU-3’ (SEQ ID NO: 1), and the antisense strand comprises the sequence

[0027] 5’-ACACCAUAGACUAUUUGCUUU-3’ (SEQ ID NO: 1), and the antisense strand comprises the sequence

[0028] (iii) the sense strand comprises the sequence

[0029] 5’-ACACCAUAGACUAUUUGCUUU-3’ (SEQ ID NO: 1), and the antisense strand comprises the sequence

[0030] 5’-ACACCAUAGACUAUUUGCUUU-3’ (SEQ ID NO: 1), and the antisense strand comprises the sequence

[0031] 5’-ACACCAUAGACUAUUUGCUUU-3’ (SEQ ID NO: 1), and the antisense strand comprises the sequence

[0032] (iv) the sense strand comprises the sequence

[0033] 5’-ACACCAUAGACUAUUUGCUUU-3’ (SEQ ID NO: 1), and the antisense strand comprises the sequence

[0034] 5’-ACACCAUAGACUAUUUGCUUU-3’ (SEQ ID NO: 1), and the antisense strand comprises the sequence

[0035] 5'-UGGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 7), and the antisense strand comprises the sequence

[0036] (v) the sense strand comprises the sequence

[0037] 5'-GGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 5), and the antisense strand comprises the sequence

[0038] (vi) the sense strand comprises the sequence

[0039] 5'-UGGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 7), and the antisense strand comprises the sequence

[0040] (vii) the sense strand comprises the sequence

[0041] 5'-GGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 5), and the antisense strand comprises the sequence

[0042] (viii) the sense strand comprises the sequence

[0043] 5'-UGGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 7), and the antisense strand comprises the sequence

[0044] (viii) the sense strand comprises the sequence

[0045] (viii) the sense strand comprises the sequence

[0046] (viii) the sense strand comprises the sequence

[0047] In some embodiments, the double-stranded ribonucleic acid described above, wherein,

[0048] (i) the sense strand comprises the sequence

[0049] 5'-UGGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 7), and the antisense strand comprises the sequence

[0050] (i) the sense strand comprises the sequence

[0051] 5'-UGGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 7), and the antisense strand comprises the sequence

[0052] 5'-(invAB)GAAGUUCCAGAAAUACAU-3'(SEQ ID NO:13), and

[0053] The antiskewing chain contains sequences.

[0054] 5'-(invAB)CGAAUGUAUUUCUGGAACUUCUUCUG-3'(SEQ ID NO:18); or (iii) the justice chain contains the sequence

[0055] 5'-GAAGAAGUUCCAGAAAUACAU-3' (SEQ ID NO: 2), and

[0056] The antiskewing chain contains sequences.

[0057] 5'-(invAB)CGAAUGUAUUUCUGGAACUUCUUCUG-3'(SEQ ID NO:18); or (iv) the justice chain contains the sequence

[0058] 5'-(invAB)CCAUAGACUAUUUGCUUU-3'(SEQ ID NO:12), and

[0059] The antiskewing chain contains sequences.

[0060] 5'-(invAB)CGAAAAGCAAAUAGUCUAUGGUGUCC-3'(SEQ ID NO:16); or (v) the justice chain contains the sequence

[0061] 5'-ACACCAUAGACUAUUUGCUUU-3'(SEQ ID NO:1), and

[0062] The antiskewing chain contains sequences.

[0063] 5'-(invAB)CGAAAAGCAAAUAGUCUAUGGUGUCC-3'(SEQ ID NO:16); or (vi) the justice chain contains the sequence

[0064] 5'-UGGGUUAUUUAAAAGAAAUUA-3'(SEQ ID NO:7), and

[0065] The antiskewing chain contains sequences.

[0066] 5'-(invAB)CGAAAAUUUCUUUUAAAUAACCCACA-3'(SEQ ID NO:17); or (vii) the justice chain contains the sequence

[0067] 5'-(invAB)GGGUUAUUUAAAAGAAAUUA-3'(SEQ ID NO:14), and

[0068] The antiskewing chain contains sequences.

[0069] 5'-(invAB)CGAAAAUUUCUUUUAAAUAACCCACA-3'(SEQ ID NO:17); or (viii) the justice chain contains the sequence

[0070] 5'-ACACCAUAGACUAUUUGCUUU-3'(SEQ ID NO:1), and

[0071] The antiskewing chain contains sequences.

[0072] 5'-(M06)CGAAAAGCAAAUAGUCUAUGGUGUCC-3' (SEQ ID NO:20). In some embodiments, the double-stranded ribonucleic acid contains:

[0073] (i) The justice chain contains sequences

[0074] 5'-(invAB)*g*u*cUfgUfGfGfguuauuUfaau-3' (SEQ ID NO: 24), and

[0075] The antiskewing chain contains sequences.

[0076] 5'-(invAB)*CfGfaa*UfuaaauaacccaCfaGfacacc*c*a-3'(SEQ ID NO:32), or (ii) the justice chain contains the sequence

[0077] 5'-(invAB)*g*a*aGfuUfCfCfagaaauAfcau-3'(SEQ ID NO:22), and

[0078] The antiskewing chain contains sequences.

[0079] 5'-(invAB)*CfGfaa*UfguauuucuggaAfcUfucuuc*u*g-3'(SEQ ID NO:31); or (iii) the justice chain contains the sequence

[0080] 5'-g*a*agaaGfuUfCfCfagaaauAfcau-3' (SEQ ID NO: 27), and

[0081] The antiskewing chain contains sequences.

[0082] 5'-(invAB)*CfGfaa*UfguauuucuggaAfcUfucuuc*u*g-3'(SEQ ID NO:31); or (iv) the justice chain contains the sequence

[0083] 5'-(invAB)*c*c*aUfaGfAfCfuauuugCfuuu-3'(SEQ ID NO:21), and

[0084] The antiskewing chain contains sequences.

[0085] 5'-(invAB)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3'(SEQ ID NO:29); or (v) the justice chain contains the sequence

[0086] 5'-a*c*accaUfaGfAfCfuauuugCfuuu-3' (SEQ ID NO: 25), and

[0087] The antiskewing chain contains sequences.

[0088] 5'-(invAB)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3'(SEQ ID NO:29); or (vi) the justice chain contains the sequence

[0089] 5'-u*g*gguuAfuUfUfAfaaagaaauua-3' (SEQ ID NO: 28), and

[0090] The antiskewing chain contains sequences.

[0091] 5'-(invAB)*CfGfaa*AfauuucuuuuaaAfuAfaccca*c*a-3'(SEQ ID NO:30); or (vii) the justice chain contains the sequence

[0092] 5'-(invAB)*g*gguuAfuUfUfAfaaagaaauua-3'(SEQ ID NO:23), and

[0093] The antiskewing chain contains sequences.

[0094] 5'-(invAB)*CfGfaa*AfauuucuuuuaaAfuAfaccca*c*a-3'(SEQ ID NO:30); or

[0095] (viii) The justice chain contains a sequence

[0096] 5'-a*c*accaUfaGfAfCfuauuugCfuuu-3' (SEQ ID NO: 25), and

[0097] The antiskewing chain contains sequences.

[0098] 5'-(M06)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3'(SEQ ID NO:33); or

[0099] (ix) The justice chain contains sequences

[0100] 5'-a*c*accaUfaGfAfCfuauuugcuuu-3' (SEQ ID NO: 26), and

[0101] The antiskewing chain contains sequences.

[0102] 5'-(M06)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3'(SEQ ID NO:33); or

[0103] (x) The justice chain contains a sequence

[0104] 5'-a*c*accaUfaGfAfCfuauuugcuuu-3' (SEQ ID NO: 26), and

[0105] The antiskewing chain contains sequences.

[0106] 5'-(invAB)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3' (SEQ ID NO: 29).

[0107] The present invention also provides a double-stranded ribonucleic acid conjugate for inhibiting the expression of diacylglycerol acyltransferase 2 (DGAT2) gene, comprising the double-stranded ribonucleic acid and delivery system as described above, wherein the double-stranded ribonucleic acid and delivery system are conjugated together.

[0108] The present invention also provides a double-stranded ribonucleic acid conjugate for inhibiting the expression of diacylglycerol acyltransferase 2 (DGAT2) gene, comprising the double-stranded ribonucleic acid as described above, and a ligand conjugated thereto, such as a delivery system.

[0109] In some embodiments, the above delivery system comprises 1, 2, 3, 4 or 5 GalNAc groups or derivatives thereof.

[0110] In some preferred embodiments, when the delivery system contains two or more GalNAc groups or their derivatives, the two or more GalNAc groups or their derivatives are linked to the double-stranded ribonucleic acid via branching bonds.

[0111] In some implementations, the delivery system is L96.

[0112] In some implementations, the aforementioned ribonucleic acid conjugate is selected from...

[0113] Z1:

[0114] Chain of Justice: 5'-(invAB)*g*u*cUfgUfGfGfguuauuUfaau[L96]-3',

[0115] Antonym chain: 5'-(invAB)*CfGfaa*UfuaaauaacccaCfaGfacacc*c*a-3'; or

[0116] Z2:

[0117] Chain of Justice: 5'-(invAB)*g*a*aGfuUfCfCfagaaauAfcau[L96]-3',

[0118] Antonym chain: 5'-(invAB)*CfGfaa*UfguauuucuggaAfcUfucuuc*u*g-3'; or

[0119] Z3:

[0120] Chain of Justice: 5'-g*a*agaaGfuUfCfCfagaaauAfcau[L96]-3',

[0121] Antonym chain: 5'-(invAB)*CfGfaa*UfguauuucuggaAfcUfucuuc*u*g-3'; or

[0122] Z4:

[0123] Chain of Justice: 5'-(invAB)*c*c*aUfaGfAfCfuauuugCfuuu[L96]-3',

[0124] Antonym chain: 5'-(invAB)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3'; or

[0125] Z5:

[0126] Chain of Justice: 5'-a*c*accaUfaGfAfCfuauuugCfuuu[L96]-3',

[0127] Antonym chain: 5'-(invAB)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3'; or

[0128] Z6:

[0129] Chain of Justice: 5'-u*g*gguuAfuUfUfAfaaagaaauua[L96]-3',

[0130] Antonym chain: 5'-(invAB)*CfGfaa*AfauuucuuuuaaAfuAfaccca*c*a-3'; or

[0131] Z7:

[0132] Chain of Justice: 5'-(invAB)*g*gguuAfuUfUfAfaaagaaauua[L96]-3',

[0133] Antonym chain: 5'-(invAB)*CfGfaa*AfauuucuuuuaaAfuAfaccca*c*a-3'; or

[0134] Z8:

[0135] Chain of Justice: 5'-a*c*accaUfaGfAfCfuauuugCfuuu[L96]-3',

[0136] Antonym chain: 5'-(M06)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3'; or

[0137] Z9:

[0138] Chain of Justice: 5'-a*c*accaUfaGfAfCfuauuugcuuu[L96]-3',

[0139] Antonym chain: 5'-(M06)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3'; or

[0140] Z10:

[0141] Chain of Justice: 5'-a*c*accaUfaGfAfCfuauuugcuuu[L96]-3',

[0142] Antonym chain: 5'-(invAB)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3'.

[0143] In some implementations, the above modifications are each independently selected from one, two, or three combinations of the following: 2'-OMe modification, 2'-F modification, 2'-deoxygenation modification, VP modification, 5'-MP modification, PS modification, PS2 modification, MP modification, MOP modification, invAb modification, invAB modification, and M06 modification.

[0144] The present invention also provides a pharmaceutically acceptable salt comprising a double-stranded ribonucleic acid according to the above description or a double-stranded ribonucleic acid conjugate according to the above description.

[0145] The present invention also provides a composition comprising the double-stranded ribonucleic acid and / or double-stranded ribonucleic acid conjugate as described above, and a pharmaceutically acceptable carrier.

[0146] The present invention also provides a pharmaceutical composition comprising a double-stranded ribonucleic acid according to the above description, a double-stranded ribonucleic acid conjugate according to the above description, and / or a pharmaceutically acceptable salt according to the above description, and a pharmaceutically acceptable carrier or excipient.

[0147] The present invention also provides the use of the double-stranded ribonucleic acid as described above, the double-stranded ribonucleic acid conjugate as described above, or the pharmaceutically acceptable salt as described above in the preparation of a medicament for treating diseases related to DGAT2 expression.

[0148] In some implementations, the diseases associated with DGAT2 expression are metabolic diseases (e.g., obesity, diabetes, insulin resistance, non-alcoholic fatty liver disease), cardiovascular diseases (e.g., atherosclerosis), skin barrier diseases (e.g., congenital ichthyosis-like erythroderma, dry skin, abnormal keratinization, potentially fatal skin barrier defects in the neonatal period), tumors, or neurodegenerative diseases associated with abnormal DGAT2 expression.

[0149] This invention includes implementation schemes derived from any combination of the above-mentioned variables or schemes.

[0150] As is known in the art, ribonucleotides have three free hydroxyl groups on their sugar ring, which can form three different nucleotides: 2'-ribonucleotide, 3'-ribonucleotide, and 5'-ribonucleotide. Deoxynucleotides have two free hydroxyl groups on their sugar ring, which can form two nucleotides: 3'-deoxyribonucleotide and 5'-deoxyribonucleotide. Therefore, all other embodiments obtained by those skilled in the art according to the embodiments of the present invention without inventive effort are considered part of the technical solutions of the present invention and fall within the protection scope of the present invention.

[0151] Beneficial effects

[0152] The double-stranded ribonucleic acid, its conjugates, and its pharmaceutical compositions provided by this invention have good stability, significant DGAT2 mRNA inhibitory activity and long-lasting effect, low off-target effects, and / or can significantly treat DGAT2 expression-related diseases and / or symptoms. Attached Figure Description

[0153] Figure 1 The results of quantitative PCR detection of DGAT2 gene expression in monkey liver in Example 5 are shown. Detailed Implementation

[0154] definition

[0155] Unless otherwise specified, the following terms and phrases used in this invention are intended to have the following meanings. A particular term or phrase should not be considered uncertain or unclear unless specifically defined, but should be understood in its ordinary sense. When trade names appear herein, they are intended to refer to the corresponding product or its active ingredient.

[0156] As used herein, the terms "optional," "optionally," or "optionally" are equivalent in meaning, indicating that the event or condition described thereafter may or may not occur, and the description includes both the possibility that the event or condition occurs and the possibility that it does not occur. For example, "optionally substituted alkyl" or "alkyl optionally substituted" includes "alkyl" (where the H on the alkyl group is not substituted / replaced by a non-H substituent) and "substituted alkyl" (where the H on the alkyl group is substituted / replaced by a non-H substituent). As used herein, those skilled in the art will understand that for any group comprising one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is spatially impractical, synthetically infeasible, and / or inherently unstable. For example, "optionally modified" includes both unmodified and modified, and further, "nucleotide optionally modified" includes both unmodified and modified nucleotides.

[0157] As used herein, when any variable (e.g., a substituent R, such as a nucleic acid being modified) appears more than once in the composition or structure of a compound, its definition is independent in each case. For example, if a group is substituted by 0-2 Rs, the group may optionally be substituted by at most two Rs, and the Rs in each case have independent options. As another example, when multiple nucleotides are modified, each nucleotide is independently and optionally modified, and the type and number of modifications to each nucleotide may be the same or different.

[0158] As used herein, unless otherwise stated, “comprising,” “including,” “at least,” “having,” “having,” “containing,” or equivalents are open-ended expressions that mean that in addition to the elements, components, or steps listed, other unspecified elements, components, or steps may be included.

[0159] As used herein, the term "nucleotide" refers to a pentose sugar (ribose or deoxyribose), a phosphate group, and a base (natural or non-natural), and is intended to include both unmodified (i.e., natural) nucleotides and modified nucleotides. In some embodiments, the nucleotide is an unmodified ribonucleotide. In some embodiments, the ribonucleotide is a 3'-ribonucleotide. In some embodiments, the ribonucleotide is a 5'-ribonucleotide. In some embodiments, the modified or unmodified nucleotide may optionally be further modified.

[0160] Natural nucleotides are composed of natural bases, natural ribose, and phosphate. The natural nucleotides used in this article refer to adenine ribonucleotides, adenine deoxyribonucleotides, guanine ribonucleotides, guanine deoxyribonucleotides, cytosine ribonucleotides, cytosine deoxyribonucleotides, uracil ribonucleotides, thymine ribonucleotides, or thymine deoxyribonucleotides. "Ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of its sugar moiety. "Deoxyribonucleoside" refers to a nucleotide having a hydrogen atom at the 2' position of its sugar moiety.

[0161] The natural bases of DNA and RNA include A (adenine), G (guanine), C (cytosine), U (uracil), and T (thymine).

[0162] Nucleotides can be substituted with their analogues, including both natural and non-natural analogues. Examples of guanosine analogues include, but are not limited to, 6-thioguanosine, 8-azaguanosine, 8-oxoguanosine, and 2-aminopurine nucleoside. Examples of adenosine analogues include, but are not limited to, cordycepin (3′-deoxyadenosine), n6-benzyladenosine, and 2-chloroadenosine. Examples of cytidine analogues include, but are not limited to, gemcitabine (2',2'-difluoro-2'-deoxycytidine), cytarabine (1-β-d-arabinoseurerylcytosine), and decitabine (5-aza-2'-deoxycytidine). Examples of uracil analogues include, but are not limited to, 5-fluorouracil, pseudouracil, 5-bromouracil, 4-thiouracil, and 5-azidouracil.

[0163] As used herein, “ribonucleic acid” (RNA) is the carrier of genetic information found in cells and some viruses and viroids. RNA is a long chain molecule formed by ribonucleotides linked by nucleotide bonds, including single-stranded RNA and double-stranded RNA. The natural nucleotide bond is the phosphodiester bond. In some embodiments, the ribose, bases, and nucleotide bonds in RNA may be modified independently and optionally.

[0164] As used herein, "double-stranded ribonucleic acid" is a complex consisting of two nucleic acid strands bonded together from natural or non-natural nucleotides, similar in structure and function to natural ribonucleic acid. These two nucleic acid strands contain antiparallel and substantially complementary sequences. "Substantially complementary" means that, while maintaining function, the antiparallel regions of the two nucleic acid strands may contain a certain number of base mismatches and non-matches. In some embodiments, the certain number refers to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the certain number refers to 1, 2, 3, 4, or 5. In some embodiments, the certain number refers to 1, 2, or 3.

[0165] As used herein, the term “oligonucleotide” refers to a nucleic acid molecule (RNA or DNA) that is, for example, less than 100, 200, 300, or 400 nucleotides in length.

[0166] As used herein, “bonding” refers to the connection between residues of two monomers (such as nucleotides) (such as nucleosides) via a single bond or a group (such as a phosphodiester bond, thiophosphate bond, or dithiophosphate bond). In some embodiments, the bonding refers to the connection between residues of two nucleotides via a phosphodiester bond, thiophosphate bond, or dithiophosphate bond.

[0167] As used herein, a "monomer" is a class of compounds that can be assembled into a ribonucleic acid chain and perform a certain function. As used herein, a "monomer" includes, but is not limited to, natural nucleotides, non-natural nucleotides (e.g., modified nucleotides, nucleotide analogs, inverted non-base deoxynucleotides, GNA, LNA, etc.), and M06.

[0168] As used herein, “inhibition” means that, when a given gene is expressed, its expression is reduced when the cell, cell population, or tissue is treated with the single / double-stranded RNA, single / double-stranded RNA conjugate, or a pharmaceutically acceptable salt or pharmaceutical composition comprising one or more of these, compared to cells, cell populations, or tissues that have not been treated in this way. The terms “inhibition,” “reduction,” “silencing,” “downregulation,” “suppression,” and other similar terms used herein are used interchangeably and include any level of inhibition. Preferably, inhibition includes statistically significant inhibition or clinically significant inhibition.

[0169] As used herein, “conjugation” refers to the covalent connection between two or more chemical parts, each with a specific function; correspondingly, “conjugated compound” refers to a compound formed by the covalent connection of these chemical parts. For example, “double-stranded ribonucleic acid conjugated compound” refers to a compound or complex formed by covalently linking one or more chemical parts with specific functions (such as a delivery system, ligand group, or conjugating group) to a double-stranded ribonucleic acid. In some embodiments, the delivery system, ligand group, or conjugating group may be attached to a phosphate group, a sugar ring (including the delivery system, ligand group, or conjugating group covalently linked to an atom at the 3' or 5' position of the nucleotide via a phosphodiester bond), a 2'-hydroxyl group, a 5'-hydroxyl group, or a base of any nucleotide of the double-stranded ribonucleic acid. In some embodiments, the delivery system, ligand group, or conjugating group may also be attached to the 2' position of the nucleotide, in which case the nucleotides are connected by a 2'-5' phosphodiester bond. In some embodiments, the delivery system, ligand group, or conjugate group may also be attached to the 3'-position of the nucleotide, in which case the nucleotides are linked by a 3'-5' phosphodiester bond.

[0170] As used herein, "complementary" or "anti-complementary" may be used interchangeably to refer to a structural relationship between two nucleotides (e.g., on two opposing nucleic acid chains or on opposing regions of a single nucleic acid chain) that allows the two nucleotides to form base pairs with each other (e.g., a purine nucleotide of a nucleic acid complementary to a pyrimidine nucleotide of an opposing nucleic acid may form a base pair together by forming hydrogen bonds with each other). In some embodiments of the invention, complementary nucleotides may form base pairs in a Watson-Crick manner or in any other manner that allows for the formation of a stable double helix. In some embodiments of the invention, the two nucleic acid chains may have multiple regions forming complementary double helixes. In some embodiments of the invention, in DNA, adenine (A) always pairs with thymine (T), and in RNA, adenine (A) pairs with uracil (U); guanine (G) always pairs with cytosine (C). In some embodiments of the invention, the complementary nucleotide may also comprise or consist entirely of base pairs formed from non-Watson-Crick base pairs and / or from non-natural and modified nucleotides, such non-Watson-Crick base pairs including, but not limited to, G:U swing base pairs or Hoogstein base pairs. In some embodiments of the invention, nucleotides containing hypoxanthine as their base may pair with nucleotide bases containing adenine, cytosine, or uracil. In some embodiments of the invention, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequence of the invention by nucleotides containing, for example, inosine (in this application, the capital "I" can represent a hypoxanthine base, inosine, or an inosine-containing nucleotide, depending on the context) (this replacement is abbreviated as I modification). In some embodiments of the present invention, adenine and cytosine anywhere in the oligonucleotide can be replaced by guanine and uracil, respectively, to form a GU swing base pair with the target mRNA.

[0171] The degree of complementarity between two oligonucleotides is called complementarity, which is measured by the percentage of bases in each strand that can form hydrogen bonds with each other, determined by established base pairing rules. Oligonucleotide sequences do not need to be "perfectly complementary" (i.e., "completely complementary") to their corresponding nucleic acid sequences. In some embodiments, a first nucleotide sequence is considered complementary to a second nucleotide sequence if the first nucleotide sequence exhibits at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence complementarity. In one exemplary embodiment, 18 of the 20 nucleobases of the first nucleotide sequence pair with corresponding regions of the second nucleotide sequence, achieving 90% complementarity. Non-complementary nucleobases, also known as "mismatches," may cluster or spread between complementary bases and do not need to be adjacent to each other or adjacent to complementary nucleobases.

[0172] The term "mismatch" as used in this article includes, but is not limited to:

[0173] 1) Two opposing (independent natural or non-natural) nucleotides (other than AT, AU or GC) pairing;

[0174] 2) No hydrogen bonds are formed between two opposing (independent natural or non-natural) nucleotides;

[0175] 3) A base is missing between two opposing (independent natural or non-natural) nucleotides.

[0176] In some embodiments, mismatches include wobbly base pairing and Hoogstein base pairing.

[0177] The term "fully complementary" refers to a hybrid formed by the first and second nucleotide sequences in a fully complementary region consisting only of Watson-Crick base pairs. "Fully complementary" oligonucleotides may include internal regions (e.g., at least 7, 8, 9, or 10 nucleotides) that are fully complementary to the target RNA. In some embodiments, the targeting region (e.g., the antisense strand or the second strand) provided herein is fully complementary to a portion of the target mRNA encoding the target gene. In some embodiments, the targeting region has at least 80%, 85%, 90%, or 95% complementarity (fully complementary) to a portion of the target mRNA encoding the target gene. In some embodiments, the targeting region has 100% complementarity (fully complementary) to a portion of the target mRNA encoding the target gene.

[0178] As used herein, the term "modified nucleotide" refers to a nucleotide having modified internucleotide bonds, and / or modified bases, and / or modified sugars. In some embodiments, the modified nucleotide comprises one, two, three, or more modifications. In some embodiments, the nucleotide comprises one modification. In some embodiments, the nucleotide comprises two modifications. In some embodiments, the nucleotide comprises three modifications.

[0179] As used herein, “modification” of nucleotides includes, but is not limited to: 2'-OMe (2'-O-methyl) modification, 2'-F (2'-deoxy-2'-fluorine) modification, 2'-O-MOE (2'-O-methoxyethyl) modification, 2'-deoxy (2'-d) modification, 5'-morpholine (5'-Mo) modification, unlocked nucleic acid (UNA) modification, glycol nucleic acid (GNA) modification, locked nucleic acid (LNA) modification, tricyclic DNA (tcDNA) modification, (S)-restricted ethyl bicyclic nucleic acid ((S)-cEt-BNA) modification, thiophosphate (PS) modification, dithiophosphate (PS2) modification, methylphosphonate (MP) modification, methoxypropylmethylphosphonate (MOP) modification, phosphoselenate modification, phosphodiselenate modification, phosphorylaminosulfate modification, phosphoryl amide salt modification, phosphoramidate modification, peptide nucleic acid (PNA) modification, 5'-(E)-vinyl phosphate ( Modifications include: VP modification, N6-methyladenosine (m6A) modification, 5-methylcytidine (m5C) modification, 3-methyluridine (m3U) modification, 5-methylureaside (m5U) modification, pseudoureaside modification, 2-thioureaside (s2U) modification, propynouracil (5-pU) modification, linking the 5' or 3' end of the nucleotide to an inverted abase-free nucleotide (invAB) modification, replacing the nucleotide with an inverted abase-free nucleotide (invAb) modification, replacing the nucleotide with 2,4-difluorotolyl ribonucleotide (rF) modification, replacing the nucleotide with (S)-glycerol nucleic acid modification, replacing the nucleotide with hypoxanthine nucleotide (I) modification, replacing the nucleotide base with xanthine, replacing the nucleotide base with 7-methylguanine, replacing the nucleotide base with 5,6-dihydrouracil, and linking the 5' or 3' end of the nucleotide to M06 (M06) modification, etc. In some embodiments, at least one nucleotide comprises one, two, three, or more modifications. In some embodiments, at least one nucleotide is unmodified. In some embodiments, at least one nucleotide comprises one modification. In some embodiments, at least one nucleotide comprises two modifications. In some embodiments, at least one nucleotide comprises three modifications. In some embodiments, all nucleotides are modified, and each nucleotide independently comprises one, two, or three modifications.

[0180] As used herein, in some embodiments, "G", "A", "C", "U", and "T" refer to guanine ribonucleotide, cytosine ribonucleotide, adenine ribonucleotide, thymine ribonucleotide, and uracil ribonucleotide, respectively. Exemplary structures are as follows:

[0181]

[0182] As used herein, some embodiments are synthesized using phosphorusamide solid-phase synthesis technology, wherein the structure is as follows: When “G”, “A”, “C”, “U”, and “T” are attached to the 5' end 1 position of the chain, the structure is...

[0183]

[0184] When “G”, “A”, “C”, “U” and “T” are connected at the 3' end of the chain, the structure is as follows:

[0185]

[0186] As used herein, the prefix "d" before a monomer (such as nucleotides A, U, C, G, and T) indicates that the monomer is 2'-deoxy modified. An example nucleotide structure with 2'-deoxy modification is shown below:

[0187]

[0188] As used herein, the "f" label following a monomer (such as nucleotides A, U, C, G, and T) indicates that the monomer is 2'-deoxy-2'-fluorine modified (2'-F modified). An example nucleotide structure with 2'-F modification is shown below:

[0189]

[0190] As used herein, the prefix "GNA-" before monomers (such as nucleotides A, U, C, G, and T) indicates that the monomer has been modified with ethylene glycol-based nucleic acids (GNA modification). As used herein, Tgn is the abbreviation for GNA-T, with the same meaning. An example of a GNA-modified nucleotide structure is shown below:

[0191]

[0192] As used herein, lowercase letters (a, u, c, g, t, etc.) indicate that the nucleotide represented by the corresponding uppercase letters (A, U, C, G, and T, etc.) is modified with 2'-O-methyl (2'-OMe). An example nucleotide structure modified with 2'-OMe is shown below:

[0193]

[0194] As used herein, invAB modification refers to the attachment of an inverted, baseless deoxynucleotide to a monomer (e.g., at the 5' or 3' end of the nucleotide). For example, The structure modified by invAB:

[0195] As used herein, invAb modification refers to the replacement of a monomer (such as a nucleotide) with an inverted, non-basic nucleotide (invAb). For example, The structure modified by invAb:

[0196] As used herein, VP modification refers to the modification of a monomer by (E)-vinyl phosphate (e.g., modification of the 5' position of a nucleotide by 5'-(E)-vinyl phosphate). For example, the structures of U, u, and dU after modification are as follows:

[0197]

[0198] As used in this article, M06 modification refers to the bonding of a linker at the 5' or 3' end of a monomer (such as a nucleotide). For example, Structure modified by M06: In some implementations, M06 is through It is bonded to a nucleotide.

[0199] As used in this article, marking "*" between monomers (such as nucleotides A, U, C, G, and T) indicates that the two monomers are linked by a thiophosphate bond (i.e., a thiophosphate diester bond), meaning they are modified by thiophosphate (PS).

[0200] As used in this article, the absence of an asterisk (*) between nucleotides (A, U, C, G, and T, etc.) indicates that the two nucleotides are linked by a phosphate ester bond (i.e., a phosphodiester bond).

[0201] For example, “5'-A(dU)gCf*(dT)-3'” means that the sequence starts from the 5' end, with adenine ribonucleotide at position 1, uracil deoxyribonucleotide at position 2, guanine ribonucleotide modified with 2'-methoxy at position 3, cytosine ribonucleotide modified with 2'-fluorine at position 4, and thymine deoxyribonucleotide linked to position 4 by a phosphate thioester bond at position 5.

[0202] For example, the structure shown as “5'-(M06)*A(dT)gCf*(invAB)-3'” is as follows:

[0203]

[0204] For example, the structure shown as “5'-(M06)*A(dT)gCf*[L96]-3'” is as follows:

[0205]

[0206] As used in this article, the structures of NAG37 monomer and L96 monomer are respectively

[0207]

[0208] [NAG37] and [L96] represent its residues, respectively. For example, the sequence [NAG37]AfGfu*[L96] has the following structure:

[0209]

[0210] As used herein, “small interfering RNA,” “siRNA,” or “iRNA” agents are interchangeable and can be used to trigger RNA interference (RNAi) mechanisms by specifically binding to the target mRNA sequence, leading to the degradation of the target mRNA and thereby inhibiting gene expression of single-stranded or double-stranded ribonucleic acid molecules (e.g., siRNA agents or their cleavage products can downregulate target genes by, for example, inducing RNAi with respect to the target RNA, wherein the target may include endogenous or pathogenic target RNA). In some embodiments, the siRNA is at least partially complementary to the coding sequence in the target gene expressed in cells. In some embodiments, after delivery of the siRNA to cells expressing the gene, the siRNA can inhibit or block gene expression in vitro or in vivo. Typically, the siRNA contains less than 60 The siRNA comprises a double-stranded region of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 complementary base pairs. In some embodiments, the sense and antisense strands of the siRNA are each independently 15-30 nucleotides long, forming a complementary double-stranded region of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 base pairs in length. In some embodiments, the sense and antisense strands of the siRNA are completely complementary and have a length of 15-30 base pairs. In some embodiments, the sense and antisense strands of the siRNA are completely complementary and have a length of 17, 18, 19, 20, 21, or 22 base pairs.

[0211] In some embodiments, the length of the ribonucleic acid chain is calculated in nt (nucleotides), where 1 nt (1 nucleotide) includes, but is not limited to, 1 natural nucleotide and 1 modified nucleotide.

[0212] As used in this article, when a sequence region has 0 nucleotides, it includes cases where the region does not exist but is directly connected to the two regions on its left and right.

[0213] As used herein, a “pharmaceuticalally acceptable carrier” may include, but is not limited to, excipients and / or other components. An “excipient” is a pharmaceutically acceptable solvent, suspending agent, or any other pharmaceutically inert medium used to deliver one or more nucleic acids to animals. Such agents are well known in the art.

[0214] As used herein, “subject” refers to any animal, such as a mammal or marsupial. Subjects of this invention include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, cattle, rats, or any kind of poultry.

[0215] As used herein, the term "treatment," "curing," or "treatment" refers to the management, elimination, reduction, or improvement of a disease and its associated symptoms, and also refers to methods for achieving beneficial or desired outcomes, including but not limited to therapeutic benefits. A "therapeutic benefit" means the eradication or improvement of the underlying disorder being treated. Furthermore, a therapeutic benefit is achieved by eradicating or improving one or more physiological symptoms associated with the underlying disorder, thereby observing improvement in the subject, although the subject may still be suffering from the underlying disorder. While the possibility of complete elimination of the disease or associated symptoms is not excluded, treating a disease does not require the complete elimination of the disease or associated symptoms. As used herein, the term "treatment" also includes "preventive treatment," which is applied before the onset of symptoms or disease manifestations to reduce the likelihood of disease occurrence or recurrence, or to reduce the likelihood of recurrence of a disease that is already under control. This applies to individuals who are not yet ill but are at risk or prone to recurrence, or individuals who are at risk or susceptible to disease recurrence. In the sense of this invention, "treatment" also includes prevention of recurrence or a preventive phase, as well as treatment of acute or chronic signs, symptoms, and / or functional impairments. Treatment may target symptoms, such as symptom suppression. Treatment can be administered in the short term, in the medium term, or as a long-term treatment, such as maintenance therapy.

[0216] As used herein, “effective dose” refers to a drug dose that produces the expected local or systemic therapeutic effect at a reasonable benefit / risk ratio, applicable to any treatment alone or in combination with further doses. In treating a specific disease, the desired local or systemic therapeutic effect typically involves the inhibition of disease progression. This includes slowing disease progression, particularly interrupting or reversing it. When used for disease prevention, the dose is sufficient to prevent or delay the onset of disease. An effective dose does not necessarily have a curative effect or completely prevent disease. The effective dose of the aforementioned drugs will depend on the condition being treated, the severity of the disease, the patient’s individual parameters (including age, physiological condition, body size, and weight), the duration of treatment, the type of concomitant treatment (if any), the specific route of administration, and similar factors. Therefore, the drug dose may vary depending on these parameters. If the initial dose is insufficient to elicit a patient’s response, a higher dose may be used (or a higher effective dose achieved through a different, more local route of administration). In some cases, the effective dose of a drug will also depend on factors such as its therapeutic index and solubility.

[0217] The compositions of the present invention may further include other auxiliary components conventionally present in pharmaceutical compositions at levels established in the art. Thus, for example, the composition may contain additional, compatible pharmaceutically active substances, such as antipruritics, astringents, local anesthetics, or anti-inflammatory agents, or may contain additional substances suitable for the physical formulation of various dosage forms of the compositions of the present invention, such as preservatives, antioxidants, and stabilizers. However, when added, such substances should not unduly interfere with the bioactivity of the components of the compositions of the present invention. The formulation may be sterilized, and if desired, may be mixed with adjuvants that will not harmfully interact with the nucleic acids of the formulation, such as preservatives, stabilizers, humectants, emulsifiers, salts or buffers that affect osmotic pressure, etc.

[0218] The compounds of the present invention can be prepared by a variety of synthetic methods known to those skilled in the art, including the specific embodiments listed below, embodiments formed by combining them with other chemical or biological synthetic methods, and equivalent substitutions known to those skilled in the art. Preferred embodiments include, but are not limited to, the embodiments of the present invention.

[0219] The following examples are provided to illustrate the present invention and are intended to better understand it, but are not intended to limit the scope of the invention. Modifications or variations made to the elements of the invention without departing from its spirit and essence are all within the scope of the invention. Unless otherwise specified, the reagents, kits, and biological materials used in this invention are commercially available. Unless otherwise specified, the kits are used according to the kit instructions.

[0220] Example 1: Synthesis of Double-Stranded Ribonucleic Acid

[0221] Oligonucleotides were synthesized using a phosphoramidite solid-phase synthesis technique. Synthesis was performed on a general-purpose controlled porous glass CPG. All 2'-modified RNA phosphoramidite and auxiliary reagents were commercially available. All phosphoramidite was dissolved in anhydrous acetonitrile and added to a molecular sieve, with coupling time of 1.0 min using 5-ethylthio-1H-tetrazole (ETT) as an activator. Phosphothiophosphate bonds were generated using a 50 mM solution of 3-((dimethylamino-methylene)amino)-3H-1,2,4-dithiazol-3-thione (DDTT) in anhydrous acetonitrile / pyridine (v / v = 1 / 1) for 1.8 min. All sequences were synthesized after the final removal of the DMT group.

[0222] Cleavage and deprotection of oligomers bound to CPG: After termination of solid-phase synthesis, the protecting group was removed by treatment with an acetonitrile solution containing 20% ​​(m / v) diethylamine for 30 minutes without cleaving the oligonucleotide from the CPG. Subsequently, the dried CPG was treated with concentrated ammonia at 40°C for 18 hours. After centrifugation, the supernatant was transferred to a new tube and the CPG was washed with ammonia. The combined solutions were concentrated to obtain a solid mixture.

[0223] Purification of single-stranded oligonucleotides: Oligomers were purified by HPLC using NanoQ anion exchange. Buffer A consisted of 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4, and 20% (v / v) acetonitrile; Buffer B consisted of 500 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4, and 20% (v / v) acetonitrile. The target product was isolated and desalted using a reverse-phase C18 column.

[0224] Annealing of single-stranded oligonucleotides to produce siRNA: Prepare a 200 μM solution of the single-stranded oligonucleotides to be annealed using sterile RNase-free H2O (RNA hydrolase-free). Set up the annealing reaction system as follows: Place 100 μL of the mixture (10 nmol) in a 95°C water bath for 10 minutes (for amounts ≥100 nmol, a high-temperature bath of 20 minutes is required) → immediately place in a 60°C water bath and allow to cool naturally → the annealed solution should not be stored at high temperatures. Combine equimolar amounts of the single-stranded oligonucleotide solution to form complementary strands.

[0225] Example 2: Inhibitory activity test of the double-stranded ribonucleic acid conjugate of the present invention against the target gene DGAT2 in mice.

[0226] Referring to Example 1, conjugates were prepared by solid-phase synthesis based on double-stranded ribonucleic acid, using L96 as the ligand.

[0227] Animals: Male C57BL / 6 mice, 6 weeks old, free from specific pathogens. The animal acclimatization period before the experiment was 7 days.

[0228] Solvent: Phosphate buffer (PBS).

[0229] Reagents and consumables: see Table 1.

[0230] In vivo experiments: Animal administration and sample collection methods are shown in Table 2.

[0231] Table 1 Main Reagents and Consumables

[0232] Reagent Consumable Name Brand Catalogue Number Trizol Invitrogen 15596018 Stainless Steel Beads Qiagen 69989 FastKing cDNA First-Strand Synthesis Kit (degen) Qiagen KR116-03 GAPDH Gene Expression Kit (Mm99999915_g1) Thermo 4351368

[0233] Table 2 Experimental Scheme

[0234]

[0235] Experimental day definition: Day 0 of the experiment was defined as the day mice were first administered the drug, Day -1 was the day before that, and Day 1 was the day after that, and so on. All mice were given a single dose of PBS (control compound or test compound) via SC on Day 0. On Day 7, blood was collected from the submandibular region of the mice to collect plasma. The mice were then euthanized, and blood was collected from the heart for later use. The liver was also collected for targeted liver mRNA level analysis.

[0236] Sample detection and analysis: RT-PCR was used to quantitatively detect the level of target mRNA in liver tissue.

[0237] The expression of the target gene in each sample was analyzed using the ΔΔCt method, a relative quantification method. This method measures the Ct difference (ΔCt) between the target gene (DGAT2) and the internal reference gene (GAPDH), and compares the ΔCt values ​​of the compound-treated samples with those of the control group.

[0238] The formula is:

[0239] ΔCt = Average Ct of the target gene - Average Ct of the reference gene.

[0240] ΔCt = ΔCt of the sample after compound treatment – ​​average ΔCt of the control group.

[0241] Gene expression level = 2 -ΔΔCT

[0242] Data analysis: Data are expressed as mean ± standard error for each group of mouse samples, n = 4 unless otherwise specified. Statistical analysis was performed using the Student's test.

[0243] Experimental results: see Table 3.

[0244] Table 3. Results of the inhibitory activity of the double-stranded RNA conjugate against the target gene DGAT2 in wild-type mice.

[0245] Test Article Average Inhibition Rate (%) (7 days) Z1 74

[0246] Conclusion: The double-stranded RNA conjugate of this invention effectively inhibits the expression of the target gene DGAT2.

[0247] Example 3: Inhibitory activity test of double-stranded RNA conjugate against target gene DGAT2 in mice subjected to high-pressure tail vein injection (HDI) of human DGAT2 plasmid

[0248] Animals: BALB / c mice, purchased from Shanghai Lingchang Biotechnology Co., Ltd., female, 6-7 weeks old.

[0249] DGAT2 plasmid DNA: pcDNA-DGAT2 plasmid, concentration 2 μg / μL, diluted with normal physiological saline for later use.

[0250] Reagents and consumables: see Table 4.

[0251] Table 4 Main Reagents and Consumables

[0252] Reagent Consumable Name Brand Trizol Invitrogen Stainless Steel Beads Qiagen FastKing cDNA First-Strand Synthesis Kit (degen) Qiagen DGAT2 Gene Expression Kit (Hs01045913_m1) Thermo

[0253] Experimental methods: DGAT2 plasmid DNA was injected via tail vein under high pressure. The in vivo experimental design, including drug administration and sample collection methods, is shown in Table 5.

[0254] Table 5 In vivo experimental design

[0255]

[0256] Compound treatment: Day 0 of the experiment was defined as the day the mice were administered the compound, Day -1 was the day before that, and Day 1 was the day after that, and so on. On Day 0, mice were subcutaneously injected with the solvent or the test compound at a volume of 5 mL / kg. Detailed information is shown in Table 5.

[0257] High-pressure injection of DGAT2 plasmid DNA solution into the tail vein of mice: On day 14, the plasmid DNA was prepared in physiological saline before injection and stored at 4°C until use. All mice were injected via tail vein with 8% of their body weight of plasmid DNA solution within 5 seconds (injection volume (mL) = mouse body weight (g) × 8%), and the mass of the plasmid injected into each mouse was 10 μg.

[0258] Experimental endpoint and liver sample collection: On day 15, 24 hours after high-pressure tail vein injection of the DGAT2 plasmid, all mice were euthanized by CO2 inhalation. Blood was collected from the heart after euthanasia, and liver samples were collected. Two liver tissue samples, approximately 70 mg each, were immersed in CO2. After incubating overnight at 4°C, the supernatant was discarded and transferred to a -80°C freezer for mRNA detection.

[0259] Quantitative PCR was used to detect the expression levels of the DGAT2 gene in mouse liver: RNA was extracted from the liver using Trizol. The RNA sample concentration was determined using a Nanodrop ONE (ultra-micro UV-Vis spectrophotometer), and the RNA was diluted to 400 ng / μL with RNase-free water for reverse transcription. Quantitative PCR was then used to detect the expression levels of the DGAT2 and NEO genes in mouse liver.

[0260] Experimental results: see Table 6.

[0261] Table 6. Results of the inhibitory activity test of the target gene DGAT2 by the double-stranded RNA conjugate in mice.

[0262]

[0263] Conclusion: The double-stranded RNA conjugate of this invention effectively inhibits the expression of the target gene DGAT2.

[0264] Example 4: IC50 of double-stranded RNA conjugate against the target gene DGAT2 in primary human hepatocytes (PHH) 50

[0265] Test compound: Prepared as a 100 μM / 200 μM stock solution using PBS.

[0266] Cells: Primary human hepatocytes (PHH) (lot number: JMJ) were provided by Shanghai WuXi AppTec Co., Ltd. PHH cells were revived and cultured in InvitroGRO CP medium (BIOIVT S0331) containing 10% (v / v) fetal bovine serum (FBS, Gibco catalog number 10091148) and 1% (v / v) penicillin-streptomycin (PS, HyClone catalog number SV30010).

[0267] Main reagents and consumables: The main reagents used in this experiment included FastStart Universal ProbeMaster (ROCHE catalog number 04914058001), RNA extraction kit (Qiagen catalog number 74182), HiScript III RTSuperMix for qPCR (+gDNAwiper) (Vazyme catalog number R323-01), 96-well plate (Costar catalog number 3599), and GAPDH. Gene Expression As-says(60×)(Thermo Cat. No. Hs02786624_g1), DGAT2 Gene Expression Assays (60×) (Thermo catalog number Hs01045913_m1).

[0268] Experimental method: Compound free uptake plate: inoculated with PHH (5.4×10) 4 Cells were plated into 96-well cell culture plates, and siRNA was added to the cells simultaneously. The compound entered the cells via free uptake. Nine concentration points were set for siRNA assays (100 nM, 20 nM, 4 nM, 0.8 nM, 0.16 nM, 0.032 nM, 0.0064 nM), with two replicates per well. A control group containing PBS and without the compound was also included. The cells were then incubated at 37°C in a 5% CO2 incubator.

[0269] RNA extraction and reverse transcription: After 48 hours, remove the culture medium and collect the cells for RNA extraction. Use according to the kit instructions. Total RNA was extracted using a 96-kit (QIAGEN-74182). cDNA was synthesized using HiScript III RTSuperMix for qPCR (+gDNAwiper) (Vazyme catalog number R323-01) according to the manufacturer's instructions.

[0270] qPCR detection of target gene mRNA expression levels: Target gene cDNA was detected by qPCR, and the internal reference gene GAPDH cDNA was also detected simultaneously. 8 μL of prepared PCR reaction solution and 2 μL of sample cDNA were added to each 384 well. The qPCR program was as follows: 50℃ for 2 min, 95℃ for 10 min, then cycling at 95℃ for 15 seconds, followed by 60℃ for 1 min, for a total of 40 cycles.

[0271] Experimental results: see Table 7.

[0272] Table 7. IC50 of double-stranded RNA conjugates against the target gene DGAT2 mRNA in primary human hepatocytes. 50 Table 7. Inhibition rate of the conjugate on the target gene in primary human hepatocytes.

[0273] NO. IC 50 (nM) Maximum Inhibition Rate (%) Z5 0.0469 96.96 Z8 0.0292 97.47 ds319 0.0623 96.59

[0274] Experimental conclusion: The double-stranded ribonucleic acid conjugate of this invention has a significant inhibitory effect on the target gene DGAT2. Example 5: Inhibitory activity test of the double-stranded ribonucleic acid conjugate against the target gene DGAT2 in eluted cynomolgus monkeys.

[0275] The experimental design is shown in Table 8. Liver samples were collected 0 hours before drug administration and on days 8, 15, 29, and 57 after drug administration. Quantitative PCR was used to detect the expression level of the DGAT2 gene in monkey livers.

[0276] dS319 is a siRNA that targets DGAT2.

[0277] Experimental results: see Table 9 and Figure 1 .

[0278] Table 8 Experimental Design

[0279]

[0280] Table 9. Results of the inhibitory activity assay of the double-stranded RNA conjugate against the target gene DGAT2 in eluted cynomolgus monkeys.

[0281]

[0282] Conclusion: The double-stranded ribonucleic acid conjugate of this invention has a significant inhibitory effect on the target gene DGAT2 in washed crabs and shows a long-term inhibitory trend.

[0283] Example 6: Assay of the inhibitory activity of double-stranded RNA conjugates against the target gene DGAT2 in eluted cynomolgus monkeys

[0284] The experimental design is shown in Table 10. Day 1 of the experiment was defined as the day the monkeys were given the drug, Day 0 as the day before, Day 2 as the day after, and so on. Two monkeys were used in each group. On Day 1 and Day 28, the monkeys were subcutaneously injected with the solvent or test compound at a volume of 0.5 mL / kg. Liver samples were collected on Day 0 before administration and Day 28 after administration. The test results are shown in Table 11.

[0285] Table 10 Experimental Design

[0286]

[0287]

[0288] Table 11 Results of the inhibitory activity test of the double-stranded ribonucleic acid conjugate against the target gene DGAT2 in eluted cynomolgus monkeys.

[0289]

[0290] Conclusion: The double-stranded ribonucleic acid conjugate of this invention has a significant inhibitory effect on the target gene DGAT2 in washed crabs and shows a long-term inhibitory trend.

Claims

1. A double-stranded ribonucleic acid that inhibits expression of a diacylglycerol acyltransferase 2 (DGAT2) gene, comprising a sense strand and an antisense strand forming a double-stranded region, the nucleotides in the double-stranded ribonucleic acid are independently optionally modified, wherein, the antisense strand comprises the sequence 5'-CGAAAAGCAAAUAGUCUAUGGUGUCC-3' (SEQ ID NO: 8), or 5'-CGAAAAUUUCUUUUAAAUAACCCACA-3' (SEQ ID NO: 9), or 5'-CGAAUGUAUUUCUGGAACUUCUUCUG-3' (SEQ ID NO: 10), or 5'-CGAAUUAAAUAACCCACAGACACCCA-3' (SEQ ID NO: 11).

2. The double-stranded ribonucleic acid of claim 1, wherein, the antisense strand comprises the sequence 5'-(invAB)CGAAAAGCAAAUAGUCUAUGGUGUCC-3' (SEQ ID NO: 16), or 5'-(invAB)CGAAAAUUUCUUUUAAAUAACCCACA-3' (SEQ ID NO: 17), or 5'-(invAB)CGAAUGUAUUUCUGGAACUUCUUCUG-3' (SEQ ID NO: 18), or 5'-(invAB)CGAAUUAAAUAACCCACAGACACCCA-3' (SEQ ID NO: 19), or 5'-(M06)CGAAAAGCAAAUAGUCUAUGGUGUCC-3' (SEQ ID NO: 20).

3. The double-stranded ribonucleic acid of claim 1, wherein, in the double-stranded ribonucleic acid, (i) the sense strand comprises the sequence 5'-ACACCAUAGACUAUUUGCUUU-3' (SEQ ID NO: 1), and the antisense strand comprises the sequence 5'-CGAAAAGCAAAUAGUCUAUGGUGUCC-3' (SEQ ID NO: 8); or (ii) the sense strand comprises the sequence 5'-GAAGAAGUUCCAGAAAUACAU-3' (SEQ ID NO: 2), and the antisense strand comprises the sequence 5'-CGAAUGUAUUUCUGGAACUUCUUCUG-3' (SEQ ID NO: 10); or (iii) the sense strand comprises the sequence 5'-CCAUAGACUAUUUGCUUU-3' (SEQ ID NO: 3), and the antisense strand comprises the sequence 5'-CGAAAAGCAAAUAGUCUAUGGUGUCC-3' (SEQ ID NO: 8); or (iv) the sense strand comprises the sequence 5'-GAAGUUCCAGAAAUACAU-3' (SEQ ID NO: 4), and the antisense strand comprises the sequence 5'-CGAAUGUAUUUCUGGAACUUCUUCUG-3' (SEQ ID NO: 10). 5'-GGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 5), and the antisense strand comprises the sequence 5'-GGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 5), and the antisense strand comprises the sequence 5'-GGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 5), and the antisense strand comprises the sequence 5'-GGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 5), and the antisense strand comprises the sequence 5'-GGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 5), and the antisense strand comprises the sequence 5'-GGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 5), and the antisense strand comprises the sequence 5'-GGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 5), and the antisense strand comprises the sequence 5'-GGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 5), and the antisense strand comprises the sequence 4. The double stranded ribonucleic acid of claim 1 or 2, wherein, (i) the sense strand comprises the sequence 5'-(invAB) GUCUGUGGGUUAUUUAAU -3' (SEQ ID NO: 15), and the antisense strand comprises the sequence 5'-(invAB) CGAAUUAAAUAACCCACAGACACCCA -3' (SEQ ID NO: 19); or (ii) the sense strand comprises the sequence 5'-(invAB) GAAGUUCCAGAAAUACAU -3' (SEQ ID NO: 13), and the antisense strand comprises the sequence 5'-(invAB) CGAAUGUAUUUCUGGAACUUCUUCUG -3' (SEQ ID NO: 18); or (iii) the sense strand comprises the sequence 5'-(invAB) CGAAUGUAUUUCUGGAACUUCUUCUG -3' (SEQ ID NO: 18); or (iv) the sense strand comprises the sequence 5'-(invAB) CGAAUGUAUUUCUGGAACUUCUUCUG -3' (SEQ ID NO: 18); or (v) the sense strand comprises the sequence 5'-(invAB) CGAAUGUAUUUCUGGAACUUCUUCUG -3' (SEQ ID NO: 18); or (vi) the sense strand comprises the sequence 5'-(invAB) CGAAUGUAUUUCUGGAACUUCUUCUG -3' (SEQ ID NO: 18); or (vii) the sense strand comprises the sequence 5'-(invAB) CGAAUGUAUUUCUGGAACUUCUUCUG -3' (SEQ ID NO: 18); or 5'-(invAB) CGAAUGUAUUUCUGGAACUUCUUCUG -3' (SEQ ID NO: 18); or 5'-a*c*accaUfaGfAfCfuauuugCfuuu-3' (SEQ ID NO: 25), and the anti sense strand comprises the sequence 5'-(M06)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3' (SEQ ID NO: 33); or (vi) the sense strand comprises the sequence 5'-UGGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 7), and the anti sense strand comprises the sequence 5'-(invAB)CGAAAAUUUCUUUUAAAUAACCCACA-3' (SEQ ID NO: 17); or (vii) the sense strand comprises the sequence 5'-(invAB)GGGUUAUUUAAAAGAAAUUA-3' (SEQ ID NO: 14), and the anti sense strand comprises the sequence 5'-(invAB)CGAAAAUUUCUUUUAAAUAACCCACA-3' (SEQ ID NO: 17); or (viii) the sense strand comprises the sequence 5'-ACACCAUAGACUAUUUGCUUU-3' (SEQ ID NO: 1), and the anti sense strand comprises the sequence 5'-(M06)CGAAAAGCAAAUAGUCUAUGGUGUCC-3' (SEQ ID NO: 20).

5. The double stranded ribonucleic acid of any of claims 1-4, wherein, (i) the sense strand comprises the sequence 5'-a*c*accaUfaGfAfCfuauuugCfuuu-3' (SEQ ID NO: 25), and the anti sense strand comprises the sequence 5'-(M06)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3' (SEQ ID NO: 33); or (ii) the sense strand comprises the sequence 5'-(invAB)*g*a*aGfuUfCfCfagaaauAfcau-3' (SEQ ID NO: 22), and the anti sense strand comprises the sequence 5'-(invAB)*CfGfaa*UfguauuucuggaAfcUfucuuc*u*g-3' (SEQ ID NO: 31); or (iii) the sense strand comprises the sequence 5'-g*a*agaaGfuUfCfCfagaaauAfcau-3' (SEQ ID NO: 27), and the anti sense strand comprises the sequence 5'-(invAB)*CfGfaa*UfguauuucuggaAfcUfucuuc*u*g-3' (SEQ ID NO: 31); or (iv) the sense strand comprises the sequence 5'-(invAB)*c*c*aUfaGfAfCfuauuugCfuuu-3' (SEQ ID NO: 21), and the anti sense strand comprises the sequence 5'-(invAB)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3' (SEQ ID NO: 29); or (v) the sense strand comprises the sequence 5'-a*c*accaUfaGfAfCfuauuugCfuuu-3' (SEQ ID NO: 25), and the antisense strand comprises the sequence 5'-(invAB)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3' (SEQ ID NO: 29); or (vi) the sense strand comprises the sequence 5'-u*g*gguuAfuUfUfAfaaagaaauua-3' (SEQ ID NO: 28), and the antisense strand comprises the sequence 5'-(invAB)*CfGfaa*AfauuucuuuuaaAfuAfaccca*c*a-3' (SEQ ID NO: 30); or (vii) the sense strand comprises the sequence 5'-(invAB)*g*gguuAfuUfUfAfaaagaaauua-3' (SEQ ID NO: 23), and the antisense strand comprises the sequence 5'-(invAB)*CfGfaa*AfauuucuuuuaaAfuAfaccca*c*a-3' (SEQ ID NO: 30); or (viii) the sense strand comprises the sequence 5'-(invAB)*g*u*cUfgUfGfGfguuauuUfaau-3' (SEQ ID NO: 24), and the antisense strand comprises the sequence 5'-(invAB)*CfGfaa*UfuaaauaacccaCfaGfacacc*c*a-3' (SEQ ID NO: 32); or (ix) the sense strand comprises the sequence 5'-a*c*accaUfaGfAfCfuauuugcuuu-3' (SEQ ID NO: 26), and the antisense strand comprises the sequence 5'-(M06)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3' (SEQ ID NO: 33); or (x) the sense strand comprises the sequence 5'-a*c*accaUfaGfAfCfuauuugcuuu-3' (SEQ ID NO: 26), and the antisense strand comprises the sequence 5'-(invAB)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3' (SEQ ID NO: 29).

6. A double stranded ribonucleic acid conjugate for inhibiting the expression of a diacylglycerol acyltransferase 2 (DGAT2) gene, comprising the double stranded ribonucleic acid of any one of claims 1-5, and conjugated thereto a ligand, such as a delivery system.

7. The double-stranded ribonucleic acid conjugate of claim 6, wherein, the delivery system comprises 1, 2, 3, 4 or 5 GalNAac groups or derivatives thereof; the delivery system comprises 1, 2, 3, 4 or 5 GalNAac groups or derivatives thereof; Preferably, when the delivery system comprises 2 or more GalNAc groups or derivatives thereof, the 2 or more GalNAc groups or derivatives thereof are linked to the double-stranded ribonucleic acid via a branching linkage.

8. The ribonucleic acid conjugate of claim 7, wherein, The delivery system is L96.

9. The ribonucleic acid conjugate of claim 8, selected from Z8: Sense: 5'-a*c*accaUfaGfAfCfuauuugCfuuu[L96]-3', Antisense: 5'-(M06)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3'; or Z1: Sense: 5'-(invAB)*g*u*cUfgUfGfGfguuauuUfaau[L96]-3', Antisense: 5'-(invAB)*CfGfaa*UfuaaauaacccaCfaGfacacc*c*a-3'; or Z2: Sense: 5'-(invAB)*g*a*aGfuUfCfCfagaaauAfcau[L96]-3', Antisense: 5'-(invAB)*CfGfaa*UfguauuucuggaAfcUfucuuc*u*g-3'; or Z3: Sense: 5'-g*a*agaaGfuUfCfCfagaaauAfcau[L96]-3', Antisense: 5'-(invAB)*CfGfaa*UfguauuucuggaAfcUfucuuc*u*g-3'; or Z4: Sense: 5'-(invAB)*c*c*aUfaGfAfCfuauuugCfuuu[L96]-3', Antisense: 5'-(invAB)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3'; or Z5: Sense: 5'-a*c*accaUfaGfAfCfuauuugCfuuu[L96]-3', Antisense: 5'-(invAB)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3'; or Z6: Sense: 5'-u*g*gguuAfuUfUfAfaaagaaauua[L96]-3', Antisense: 5'-(invAB)*CfGfaa*AfauuucuuuuaaAfuAfaccca*c*a-3'; or Z7: Sense: 5'-(invAB)*g*gguuAfuUfUfAfaaagaaauua[L96]-3', Antisense: 5'-(invAB)*CfGfaa*AfauuucuuuuaaAfuAfaccca*c*a-3'; or Z9: Sense: 5'-a*c*accaUfaGfAfCfuauuugcuuu[L96]-3', Antisense: 5'-(M06)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3'; or Z10: sense strand: 5'-a*c*accaUfaGfAfCfuauuugcuuu[L96]-3', antisense strand: 5'-(invAB)*CfGfaa*AfagcaaauagucUfaUfggugu*c*c-3'.

10. A pharmaceutically acceptable salt comprising the double-stranded ribonucleic acid according to any one of claims 1-5 or the double-stranded ribonucleic acid conjugate according to any one of claims 6-9.

11. A pharmaceutical composition comprising the double-stranded ribonucleic acid according to any one of claims 1-5, the double-stranded ribonucleic acid conjugate according to any one of claims 6-9 and / or the pharmaceutically acceptable salt according to claim 10, and a pharmaceutically acceptable carrier or excipient.

12. Use of the double-stranded ribonucleic acid according to any one of claims 1-5, the double-stranded ribonucleic acid conjugate according to any one of claims 6-9 or the pharmaceutically acceptable salt according to claim 10 for the manufacture of a medicament for the treatment of a disease associated with DGAT2 expression.

13. Use according to claim 12, wherein, The disease associated with DGAT2 expression is a metabolic disease (e.g., obesity, diabetes, insulin resistance, non-alcoholic fatty liver disease) associated with abnormal expression of DGAT2, a cardiovascular disease (e.g., such as atherosclerosis), a skin barrier disease (e.g., congenital ichthyosis-like erythroderma, skin dryness, abnormal keratinization, lethal skin barrier defect that can occur in the neonatal period), a tumor or a neurodegenerative disease.