Application of granulocyte-plasma cell as target in tumor immunotherapy
By identifying granulocytes and plasma cells as novel immunosuppressive markers and constructing predictive models using genes such as CD63, the problem of poor efficacy of B-cell depletion therapy in the treatment of solid tumors has been solved, and the efficacy of tumor immune checkpoint blockade therapy has been improved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-24
- Publication Date
- 2026-03-10
AI Technical Summary
Existing B-cell depletion therapies are not effective in treating solid tumors. Some mature regulatory B cells and plasma cell subsets do not express or express low levels of CD20 molecules, resulting in unsatisfactory targeted therapy effects.
We will identify and utilize granulo-plasma cells (GPCs) as novel biomarkers for immunosuppressive function. By detecting genes such as CD63, ARSA, DNAJC3, NPC2, PSAP, GSTP1, and PRDX4, we will construct a model to predict the efficacy of tumor immune checkpoint blockade therapy and develop corresponding treatment systems.
It significantly improved the efficacy of tumor immune checkpoint blockade therapy, providing new therapeutic targets for tumor immunotherapy, particularly enhancing the treatment effect in nasopharyngeal carcinoma, lung cancer, colorectal cancer, ovarian cancer, cervical cancer, head and neck tumors, gastric cancer, thymic tumors, pancreatic cancer, testicular tumors, and breast cancer.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of granulocytes and plasma cells as targets in tumor immunotherapy. Background Technology
[0002] In recent years, with the rapid development of immunotherapy, it has become one of the most important methods for cancer treatment. B cell depletion therapy (BCDT) was first clinically applied to autoimmune diseases such as systemic lupus erythematosus, rheumatoid arthritis, and multiple sclerosis. Clinical trials of rituximab, a CD20-targeting monoclonal antibody, for treating solid tumors are underway. However, these tumors contain immunosuppressive B cells, typically regulatory B cells (Bregs) that produce IL-10 and TGF-β, and plasma cells (PCs) that produce IL-10. These mature cells do not express CD20, leading to poor efficacy of anti-CD20 monoclonal antibodies in tumors with these suppressive B cells. Therefore, the search for more immunosuppressive plasma cell marker proteins, such as surface immunoglobulin IgA (IgA), is crucial. + Plasma cells, by targeting these proteins, can specifically eliminate immunomodulatory plasma cells in the microenvironment, promoting immune responses, which has important clinical significance.
[0003] The era of B-cell depletion therapy began in 1975, marking the birth of monoclonal antibody technology and making its application possible. Rituximab, a human-mouse chimeric monoclonal antibody, has several major mechanisms of action against B lymphocytes, including complement-dependent cytotoxicity (CDC), induction of B-cell apoptosis, and antibody-dependent cytotoxicity (ADCC). As the first approved monoclonal antibody targeting CD20, rituximab was initially used in 1997 to treat relapsed or refractory low-grade or follicular non-Hodgkin's lymphoma and significantly improved the treatment efficacy for most B-cell malignancies, including diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, and chronic lymphocytic leukemia.
[0004] Subsequently, rituximab's application expanded to the field of autoimmune diseases, demonstrating broad efficacy in various conditions. These include rheumatoid arthritis, systemic lupus erythematosus (SLE), and primary membranous nephropathy. Rituximab works by targeting the CD20 molecule on the surface of B cells, reducing the production of autoantibodies, thus treating B-cell-related diseases such as SLE and glomerulonephritis. Furthermore, rituximab has also been used to treat neuroimmunological diseases such as myasthenia gravis. However, in the field of solid tumors, the overall efficacy of anti-CD20 monoclonal antibodies is not ideal. This may be related to the heterogeneity of solid tumors, the immunosuppressive properties of the tumor microenvironment, and the delivery efficiency of anti-CD20 monoclonal antibodies.
[0005] Although rituximab has shown strong therapeutic effects, some mature regulatory B-cell subsets and plasma cell subsets do not express or express low levels of CD20 molecules, leading to poor efficacy of B-cell depletion therapy. Therefore, finding a surface biomarker with immunosuppressive function is particularly important.
[0006] Regulatory B cells can limit inflammatory responses by secreting inhibitory cytokines such as IL-10, IL-35, and TGF-β. These Breg cells play important roles in various immunopathological processes, including autoimmune diseases, tumor immune responses, and transplant tolerance. However, Breg cells lack a signature transcription factor; their common characteristic is the production of immunosuppressive cytokines such as IL-10 and TGF-β. Regulatory B cells can be generated at multiple stages of B cell development and can also be involved in CD24 cell proliferation. hi CD38 hi Immature B cell population and CD24 hi CD38 lo CD27 + It is enriched in the memory B cell population.
[0007] Furthermore, plasma cells and plasmablasts are two cell types that do not express CD20; they are collectively referred to as antibody-secreting cells. Plasma cells have a long lifespan, undergo terminal differentiation, and produce antibodies, while plasmablasts have a short lifespan and can proliferate. These two cell types may not be effectively eliminated in B-cell depletion therapy because they do not express or express low levels of CD20 molecules.
[0008] Therefore, to improve the therapeutic efficacy of B-cell depletion therapy, it is necessary to identify novel surface biomarkers that are highly expressed in immunosuppressive regulatory B-cell subsets and plasma cell subsets to more effectively target these cells and enhance therapeutic effects. This may involve in-depth research into B-cell subsets to identify new therapeutic targets, thereby developing more effective B-cell depletion therapies. Summary of the Invention
[0009] The technical problem this invention aims to solve relates to the limitations of rituximab in the treatment of B-cell lymphoma and autoimmune diseases. Although rituximab has shown potent therapeutic effects, some mature regulatory B-cell subsets and plasma cell subsets do not express or express low levels of CD20 molecules, leading to poor efficacy of B-cell depletion therapy. Therefore, finding a surface biomarker with immunosuppressive function is particularly important.
[0010] The first aspect of the present invention is to provide a granulocyte-plasma cell marker.
[0011] A second aspect of the present invention aims to provide the use of substances for detecting granulocyte-plasma cell markers in the preparation of products for predicting the efficacy of tumor immune checkpoint blockade therapy.
[0012] The third aspect of this invention aims to provide a method for constructing a model for predicting the efficacy of tumor immune checkpoint blockade therapy.
[0013] A fourth aspect of the present invention provides a system for predicting the efficacy of tumor immune checkpoint blockade therapy.
[0014] The fifth aspect of this invention aims to provide the use of CD63 knockout reagents in the preparation of medicaments for treating tumors.
[0015] To achieve the above-mentioned objectives of this invention, the technical solution adopted by this invention is as follows: In a first aspect, the present invention provides a granulocyte-plasma cell marker.
[0016] In some embodiments of the present invention, the granulo-plasma cells are a subpopulation of plasma cells that significantly overexpress genes associated with degranulation function.
[0017] In some embodiments of the present invention, the granulocytes highly express CD63, ARSA, DNAJC3, NPC2, PSAP, GSTP1, and PRDX4.
[0018] A second aspect of the invention provides the use of substances for detecting granulocyte-plasma cell markers in the preparation of products for predicting the efficacy of tumor immune checkpoint blockade therapy.
[0019] In some embodiments of the present invention, the granulocytes highly express CD63, ARSA, DNAJC3, NPC2, PSAP, GSTP1, and PRDX4.
[0020] In some embodiments of the present invention, the substance for detecting granulocyte-plasma cell markers includes a substance for detecting A) or B): A) CD63, ARSA, DNAJC3, NPC2, PSAP, GSTP1 and PRDX4; B) CD63 and CD19.
[0021] This invention has been experimentally verified to show that CD63 and CD19 can be used as marker genes to represent granulocytes and plasma cells in the first aspect of this invention.
[0022] In some embodiments of the present invention, the substance for detecting A) or B) includes reagents for detecting A) or B) at the protein level or gene level.
[0023] In some embodiments of the present invention, the reagents for detecting A) or B) at the protein level are selected from reagents of one or more detection methods from the group consisting of: chemiluminescence, immunofluorescence, protein chip, proteometry, immunohistochemistry, patch tracing based on labeling technology, Western blotting, and enzyme-linked immunosorbent assay (ELISA).
[0024] In some embodiments of the present invention, the reagents for detecting A) or B) at the gene level are selected from reagents of one or more detection methods from the group consisting of: high-throughput sequencing, digital PCR, and quantitative real-time PCR.
[0025] In some embodiments of the present invention, the test samples for the product include cell or tissue samples.
[0026] In some embodiments of the present invention, the product includes a test kit, a test chip, or a test strip.
[0027] In some embodiments of the present invention, the test subjects of the product include humans.
[0028] In some embodiments of the present invention, the immune checkpoint inhibitors include: PD-1 inhibitors and PD-L1 inhibitors.
[0029] A third aspect of the present invention provides a method for constructing a model for predicting the efficacy of tumor immune checkpoint blockade therapy, comprising the following steps: Models were constructed using expression levels in granulocytes and plasma cells.
[0030] In some embodiments of the present invention, the model construction algorithm includes at least one of logistic regression, linear discriminant analysis, support vector machine, random forest, and recursive partitioning tree.
[0031] A fourth aspect of the present invention provides a system for predicting the efficacy of tumor immune checkpoint blockade therapy, the system comprising a computational device for predicting tumor immune checkpoint blockade therapy based on granulocyte-plasma cell expression level detection results.
[0032] In some embodiments of the present invention, the detection results include protein level results or RNA level results.
[0033] In some embodiments of the present invention, the system further includes any one or more of the following: 1) Detection result collection device, also known as detection result input device, can specifically be one or more of the following: mouse, keyboard, touch screen display, one or more buttons, one or more switches, one or more triggers, etc. 2) Diagnostic result output device, also known as diagnostic result display device, can specifically be one or more of the following: liquid crystal display (LCD), light-emitting diode (LED) display, plasma display, projection display, touch screen display, etc. 3) Diagnostic result sending device, which can send the results of distinguishing whether the subject is in a strong or weak risk group to an information communication terminal device that can be viewed by the patient or medical staff.
[0034] A fifth aspect of the invention provides the use of CD63 knockout reagents in the preparation of medicaments for treating tumors.
[0035] In some embodiments of the present invention, the CD63 knockout reagent is present on CD19. + Specific knockout of CD63 in cells.
[0036] In some embodiments of the present invention, the drug further includes immune checkpoint inhibitors.
[0037] In some embodiments of the present invention, the drug comprises pharmaceutically acceptable excipients. In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one of the following: solvents, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, flow aids, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesion agents, integrators, penetration enhancers, pH adjusters, buffers, plasticizers, surfactants, defoamers, thickeners, encapsulating agents, humectants, absorbents, diluents, flocculants and anti-flocculators, filter aids, release inhibitors, and carriers.
[0038] The pharmaceutically acceptable excipients mentioned above are generally recognized for use in this purpose and as inactive ingredients in the pharmaceutical preparation. Compilations of pharmaceutically acceptable excipients can be found in reference books such as the *Handbook of Pharmaceutical Excipients* (2nd edition, edited by A. Wade and PJ Weller; published by the American Pharmaceutical Association, Washington and The Pharmaceutical Press, London, 1994) and the *Pharmacopoeia of the People's Republic of China - List of Pharmaceutical Excipients*.
[0039] In some embodiments of the present invention, the dosage form of the drug includes a gastrointestinal dosage form or a non-gastrointestinal dosage form.
[0040] The beneficial effects of this invention are: This invention is the first to propose that granulocyte-plasma cells (GPCs) accumulate in nasopharyngeal carcinoma, lung cancer, colorectal cancer, ovarian cancer, cervical cancer, head and neck tumors, gastric cancer, thymic tumors, pancreatic cancer, testicular tumors, and breast cancer. It also demonstrates a correlation with the prognosis of various cancer patients, showing that GPCs can predict the treatment efficacy of cancer patients treated with ICB immunotherapy. Targeting GPCs can significantly improve the efficacy of ICB immunotherapy, providing a new therapeutic target for tumor immunotherapy. Attached Figure Description
[0041] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 The results of GPC isolation and characterization are shown below. A shows single-cell atlases and subpopulation classifications of plasma cells in ten types of cancer with high B-cell infiltration; B shows the expression distribution of degranulation-related genes in plasma cell subpopulations; CD shows the significantly high expression of immunoglobulin-related genes in CD63+ B cells of nasopharyngeal carcinoma and colorectal cancer tissues; E is a heatmap showing the degranulation-related genes identified in the single-cell atlases of plasma cells in nasopharyngeal carcinoma and colorectal cancer tissues on CD63+ B cells. + and CD63 - B cell expression; FG represents the high enrichment of GPC subsets in tumor tissues, particularly in gastric cancer, colorectal cancer, and lung cancer.
[0042] Figure 2The expression results of GPCs in multiple cancer types are shown below. A and G represent multicolor immunohistochemical results, showing GPCs in colorectal cancer, lung cancer, nasopharyngeal carcinoma, gastric cancer, cervical cancer, endometrial cancer, and breast cancer, with green indicating CD19 and red indicating CD63. HK represents flow cytometry results, showing that GPCs were enriched in the tumor microenvironment of colorectal cancer, lung cancer, nasopharyngeal carcinoma, and gastric cancer tumor tissues compared to paired normal epithelial tissues or peripheral blood samples. All values are shown as mean ± standard error; * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001.
[0043] Figure 3 The results show the gene set of GPC expression, where AB represents qRT-PCR results, showing the gene expression of GPCs and non-GPCs in fresh tissues from patients with colorectal and lung cancer. All values are shown as mean ± standard error; * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001.
[0044] Figure 4 The results show that GPCs possess the characteristic plasma cell phenotype. AE represents flow cytometry results, indicating the expression levels of plasma cell proteins CD38 and CD138 on the surface of GPCs and non-GPCs in fresh nasopharyngeal and colorectal cancer tissues. FG shows the flow cytometry sorting of GPCs and non-GPCs from tumor-infiltrating lymphocytes in colorectal and nasopharyngeal carcinoma. Cell culture supernatants were collected, and the levels of IgA and IgG in the supernatants were detected by ELISA. All values are shown as mean ± standard error; * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001.
[0045] Figure 5The results show that GPCs possess a granulocyte phenotype, including: A) flow cytometry analysis of myeloid cell-associated molecules CSF1R, CSF2R, CSF3R, KDR, TLR2, and TLR4 on the surface of both non-GPCs and GPCs; B) flow cytometry results showing that GPCs and non-GPCs produce higher levels of ARG-1 intracellularly in colorectal cancer, lung cancer, and nasopharyngeal carcinoma; C and D) flow cytometry sorting of GPCs and non-GPCs in colorectal cancer, lung cancer, and ovarian cancer. The levels of S100A8 / A9 and MMP9 in the supernatant of non-GPCs; E shows the multicolor immunofluorescence results of the myeloid-associated protein molecule MPO produced by GPCs and non-GPCs, with purple indicating CD19, green indicating CD63, red indicating MPO, and DAPI indicating the nucleus; F shows the results of multicolor immunohistochemistry of MPO and ARG-1 produced by GPCs in colorectal cancer, lung cancer, nasopharyngeal carcinoma, gastric cancer, cervical cancer, and breast cancer. Yellow indicates CD19, red indicates CD63, green indicates MPO, orange indicates ARG1, and DAPI indicates the nucleus.
[0046] Figure 6 Clinical predictive results for GPCs, where: A represents CD63 in the immune microenvironment of colorectal cancer as shown by multicolor immunohistochemistry. + CD19 + B cell expression was analyzed using the HALO digital pathology image analysis platform. Red fluorescence represents CD63, green fluorescence represents CD19, and DAPI represents the cell nucleus. BC shows the Kaplan-Meier survival curves illustrating the impact of low (blue) and high (red) GPC expression in colorectal and nasopharyngeal carcinoma on overall survival in newly diagnosed colorectal cancer patients. DI indicates the statistical significance of GPC and CD8 expression in patients treated with PD-1 immunotherapy. + EOMES + T cell expression levels in the response (R) and no-response (NR) groups. R includes partial response (PR), and NR includes stable disease (SD) and progressive disease (PD). JK curves show ROC curve analysis of GPCs versus prognoses in immunotherapy-treated lung and nasopharyngeal carcinoma patients. All values are shown as mean ± standard error; * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001.
[0047] Figure 7The results of GPC treatment are shown below, including: genotype identification results for AB mice. A represents the amplification results using Cd63 Loxp Sequence Primers, and B represents the amplification results using Cre-Cd19 Mutant Sequence Primers. Mice #01, #02, #05, #08, and #15 are Cre-Cd19 positive, Cd63 Loxp positive homozygous mice, i.e., CD19 positive mice. + Mice with conditional Cd63 knockout in B cells; C, E, and F represent tumor growth curves of subcutaneous tumors (colorectal cancer, lung cancer, melanoma) in mice, respectively; F shows the tumor growth curve of MC38 in Cd19-Cd63 conditional knockout mice combined with PD-1 immunotherapy (n=8); G shows the tumor immune microenvironment detected by flow cytometry, CD8+. + T cells produce the cytokine IFN-γ (CD8). + IFN-γ + ) and Granzyme B (CD8) + GrB + (n=5). All values are displayed as mean ± standard error; * indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001. Detailed Implementation
[0048] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
[0049] All clinical samples collected in this invention have been approved by the Ethics Committee of Sun Yat-sen University Cancer Center and obtained informed consent from the patients, thus complying with relevant laws and regulations.
[0050] Example 1: Analysis and Identification of GPCs This study aimed to explore the heterogeneity of B-cell populations in the tumor microenvironment. Single-cell transcriptome data of 10 cancer types with high B-cell infiltration were collected from public databases. These cancers included nasopharyngeal carcinoma, lung cancer, colorectal cancer, ovarian cancer, cervical cancer, head and neck tumors, gastric cancer, thymic tumors, pancreatic cancer, and testicular tumors, involving 251 samples from 15 published studies. Seurat software was used to standardize the single-cell data, detect hypervariable genes, perform principal component analysis, and dimensionality reduction clustering analysis. Harmony software was used to integrate and analyze datasets from different sources to remove batch effects, constructing a single-cell atlas of tumor-infiltrating plasma cells. Figure 1 (A) From Figure 1 In the B subpopulation, a group of plasma cells showed significantly high expression of genes related to degranulation function, among which the membrane protein CD63 was significantly highly expressed.
[0051] To verify the degranulation phenotype of CD63-positive plasma cell subsets, fresh tumor specimens were collected from four patients with colorectal cancer and four patients with nasopharyngeal carcinoma. Fresh tissue was harvested intraoperatively and temporarily stored on ice in RPMI 1640 medium. To maintain cell viability, single cells were isolated within 2 hours of sample collection. Tissue digestion solution was prepared by adding 0.1 mg / mL DNase and 0.1 μg / mL type IV collagenase to RPMI 1640 medium, and adding an appropriate amount of digestion solution according to the size of the tumor tissue. Sterile scissors and forceps were prepared, and 7 cm sections of tissue were selected according to cell size. 2 For cell culture dishes, place the tissue in a culture dish, cut it into small pieces, add an appropriate amount of tissue digestion solution, and disperse the cell clumps with a pipette tip. Incubate at 37°C for 30 minutes. After digestion, repeatedly pipette the cells and filter them through a pre-prepared 70 μm cell sieve. Add erythrocyte lysis buffer and incubate at room temperature for 10 minutes. Centrifuge at 500 g for 5 minutes at room temperature. Wash 2-3 times with RPMI 1640. Perform flow cytometry staining on the collected tumor-infiltrating lymphocytes. Count the cells, collecting (1-5) × 10⁻⁶ cells. 5 Cells were transferred to 1.5 mL EP tubes and centrifuged at 500 g for 5 min at room temperature. After washing, cells were resuspended in 1 mL PBS and centrifuged again at 500 g for 5 min at room temperature. Cells were then resuspended in 100 μL PBS with 5 μL of Fc Receptor blocking solution and incubated at 4°C for 15–30 min. Depending on cell grouping, 100 μL of diluted flow cytometry antibody (FITC-anti-human CD45 antibody, PerCP-Cyanine 5.5 anti-human CD19 antibody, APC anti-human CD63 antibody) and Fixed Viability Dye eFluor 780 antibody were added to resuspend the cells, and the cells were incubated at 4°C in the dark for 30 min. Cells were washed with 1 mL PBS and centrifuged at 500 g for 5 min at 4°C, washing twice. GPCs and non-GPCs were separated using a flow cytometer (BDFACS Melody), and CD63 was isolated. + CD19 + and CD63 - CD19 +B cells. DNA libraries were constructed using the Novizuma Single Cell Full-Length mRNA Amplification Kit (N712) and the Novizuma Illumina DNA Library Preparation Kit (TD503), and then transcriptome sequencing was performed using the Illumina high-throughput sequencing platform.
[0052] Sequencing results showed that compared to CD63 - CD19 + B cells, CD63 + Immunoglobulin-related genes were significantly upregulated in B cells, and genes related to degranulation function were highly expressed, consistent with the plasma cell single-cell atlas, especially CD63, ARSA, DNAJC3, NPC2, PSAP, GSTP1, and PRDX4. Therefore, this embodiment names this cell group as Granulo-Plasma Cells (GPCs), and uses these seven genes as specific molecular markers for GPCs. AUCell software was used to score the single-cell dataset of B cells, and cells with a score greater than one were defined as GPCs. Among the ten cancer types with high B-cell infiltration involved in the single-cell transcriptome data, this GPC subset was enriched in tumor tissues, particularly in gastric cancer, colorectal cancer, and lung cancer. Figure 1 ).
[0053] Example 2: Expression of GPCs in pan-cancer species The purpose of this embodiment is to investigate whether GPCs exist in colorectal cancer, lung cancer, nasopharyngeal carcinoma, gastric adenocarcinoma, cervical cancer, endometrial cancer, and breast cancer, and to investigate the specific expression of GPCs in the tumor microenvironment of patients with colorectal cancer, lung cancer, nasopharyngeal carcinoma, and gastric adenocarcinoma.
[0054] CD19 and CD63 were stained using multicolor immunohistochemistry. Paraffin sections of tumor tissue were baked at 65°C, dewaxed in xylene (3 cycles), and visually inspected for residual wax. After complete dewaxing, the sections were hydrated with a gradient of different concentrations of ethanol (100%, 100%, 95%, 90%, 80%, 70%, 60%), and then passed through ddH2O (2 cycles). Retrieval: EDTA antigen retrieval buffer (pH 8.0) was used for 2 minutes and 30 seconds. Blocking: 0.5% BSA solution was incubated at room temperature for 10 minutes. The blocking buffer was discarded, and diluted primary antibody (anti-human CD19, ZSGB-Bio, 1:200) was added and incubated at room temperature for 1 hour. Washing was performed three times with Tris-buffered Tween wash buffer (TBST: Tris-HCl + NaCl + Tween 20) for 3 minutes each. Horseradish peroxidase-labeled secondary antibody was added and incubated at room temperature for 10 minutes. Add TBST and wash for 3 min, repeat 3 times. Add single-color TSA fluorescent dye (Opaldyes 520, 1:250) and incubate at room temperature in the dark for 10 min. Add TBST and wash for 3 min, repeat 3 times. Proceed to the next cycle. Retrieval: EDTA antigen retrieval solution (pH 8.0), retrieval time 2 min 30 sec. Blocking: 0.5% BSA solution, incubate at room temperature for 10 min. Discard the blocking solution, add diluted primary antibody (CD63, Cell Signaling Technology, 1:400), incubate at room temperature for 1 hour. Add TBST and wash for 3 min, repeat 3 times. Add horseradish peroxidase-labeled secondary antibody, incubate at room temperature for 10 min. Add TBST and wash for 3 min, repeat 3 times. Add single-color TSA fluorescent dye (Opal dyes 620, 1:250), incubate at room temperature in the dark for 10 min. Add TBST and wash for 3 min, repeat 3 times. Add anti-fluorescence quencher with DAPI, and mount. Store in a light-protected refrigerator at 4°C. Scanned using a Jiangfeng fully automated digital scanner, and further analyzed using the HALO digital pathology image analysis platform.
[0055] Tumor specimens and their paired normal tissues or paired blood samples were collected. Fresh tissue was removed during the operation and temporarily stored on ice in RPMI 1640 medium. To maintain cell viability, single cells should be isolated within 2 hours of sample collection. Tissue digestion solution was prepared: 0.1 mg / mL of DNase and 0.1 μg / mL of type IV collagenase were added to RPMI 1640 medium, and an appropriate amount of tissue digestion solution was added according to the size of the tumor tissue. Sterile scissors and forceps were prepared, and 7 cm sections of the tumor tissue were selected according to cell size. 2Place the tissue in a cell culture dish and cut it into small pieces. Add an appropriate amount of tissue digestion solution and break up the cell clumps with a pipette tip. Incubate at 37°C for 30 min. After digestion, repeatedly pipette the cells and filter them through a pre-prepared 70 μm cell sieve. Add red blood cell lysis buffer and incubate at room temperature for 10 min. Centrifuge at 500 g for 5 min at room temperature. Wash 2-3 times with RPMI 1640.
[0056] Fresh peripheral blood was drawn from the patient and centrifuged at 3000 r / min for 15 min at room temperature to separate the plasma. The blood cells were diluted with physiological saline at a 1:1 ratio. Lymphocyte separation medium was added to a centrifuge tube, and then the diluted blood cells were slowly dripped along the tube wall into the lymphocyte separation medium, taking care not to disrupt the separation interface. The ratio of separation medium to diluted blood cells was 1:1. The cells were centrifuged at 2000 r / min (increase speed 2, decrease speed 0) for 25 min at room temperature. After separation, the cells separated into four layers: physiological saline, white membrane, lymphocyte separation medium, and red blood cells from top to bottom. The white membrane was removed and transferred to a 50 mL centrifuge tube. Physiological saline was added to the top 50 mL to wash the cells. The tube was centrifuged at 500 g at room temperature for 5 min. The cells were washed again with 50 mL of physiological saline and centrifuged at 500 g at room temperature for 5 min.
[0057] Tumor-infiltrating lymphocytes and peripheral blood lymphocytes were collected and stained by flow cytometry. Cell counts were performed, and (1-5) × 10⁶ cells were collected. 5 Cells were transferred to 1.5 mL EP tubes and centrifuged at 500 g for 5 min at room temperature. After washing, cells were resuspended in 1 mL PBS and centrifuged again at 500 g for 5 min at room temperature. Cells were then resuspended in 100 μL PBS with 5 μL of Fc Receptor blocking solution and incubated at 4°C for 15–30 min. Depending on cell grouping, 100 μL of diluted flow cytometry antibody (FITC-anti-human CD45 antibody, PerCP-Cyanine5.5 anti-human CD19 antibody, APC anti-human CD63 antibody) and Fixed ViabilityDye eFluor 780 antibody were added to resuspend the cells, and the cells were incubated at 4°C in the dark for 30 min. Cells were washed twice with 1 mL PBS and centrifuged at 500 g for 5 min at 4°C. Flow cytometry was performed using a Beckman CytoFLEX Flow cytometer, and the results were analyzed using FlowJo 10.0 software.
[0058] Depend on Figure 2 The results of multicolor immunohistochemistry showed that GPCs exist in the immune microenvironment of multiple cancer types, including colorectal cancer, lung cancer, nasopharyngeal carcinoma, gastric adenocarcinoma, cervical cancer, endometrial cancer, and breast cancer. Compared with normal tissue or peripheral blood, the content of GPCs in the immune microenvironment of patients with colorectal cancer, lung cancer, nasopharyngeal carcinoma, and gastric adenocarcinoma was increased, suggesting that this B cell subset is enriched in pan-cancer species.
[0059] Example 3: Plasma cell phenotype and function of GPCs in tumors The purpose of this embodiment is to investigate whether GPCs in the tumor microenvironment possess a plasma cell phenotype.
[0060] This experiment collected fresh tissue specimens from patients with colorectal cancer, nasopharyngeal carcinoma, and lung cancer. Fresh tissue was harvested intraoperatively and temporarily stored on ice in RPMI 1640 medium. To maintain cell viability, single cells needed to be isolated within 2 hours of sample collection. Tissue digestion solution was prepared by adding 0.1 mg / mL DNase and 0.1 μg / mL type IV collagenase to RPMI 1640 medium, and then adding an appropriate amount of digestion solution according to the size of the tumor tissue. Sterile scissors and forceps were prepared, and 7 cm sections of tissue were selected based on cell size. 2 Place the tissue in a cell culture dish and cut it into small pieces. Add an appropriate amount of tissue digestion solution and break up the cell clumps with a pipette tip. Incubate at 37°C for 30 min. After digestion, repeatedly pipette the cells and filter them through a pre-prepared 70μm cell sieve. Add red blood cell lysis buffer and incubate at room temperature for 10 min. Centrifuge at 500 g for 5 min at room temperature. Wash 2-3 times with RPMI 1640.
[0061] Tumor-infiltrating lymphocytes were collected and stained by flow cytometry. Cell counts were performed, and (1-5) × 10⁶ cells were collected. 5Cells were transferred to 1.5 mL EP tubes and centrifuged at 500 g for 5 min at room temperature. After washing, cells were resuspended in 1 mL PBS and centrifuged again at 500 g for 5 min at room temperature. Cells were then resuspended in 100 μL PBS with 5 μL of Fc Receptor blocking solution and incubated at 4°C for 15–30 min. Depending on the cell grouping, cells were resuspended in 100 μL of diluted flow cytometry antibody (PerCP-Cyanine 5.5 anti-human CD19 antibody, APC anti-human CD63 antibody, APC / Cyanine 7 anti-human CD38 antibody, PE anti-human CD138 antibody) at a 1:100 concentration and incubated at 4°C in the dark for 30 min. Cells were washed twice with 1 mL PBS and centrifuged at 500 g for 5 min at 4°C. Detection was performed using a Beckman CytoFLEX Flow cytometer, and results were analyzed using FlowJo 10.0 software.
[0062] The collected tumor-infiltrating lymphocytes were sorted by flow cytometry. Cells were resuspended and washed in 1 mL PBS, centrifuged at 500 g for 5 min at room temperature. Cells were resuspended in 100 μL PBS with 5 μL of Fc Receptor blocking solution and incubated at 4°C for 15–30 min. Based on cell grouping, and according to the concentration of the 1:100 antibody dilution, 100 μL of diluted flow cytometry antibody (FITC-anti-human CD45 antibody, PerCP-Cyanine5.5 anti-human CD19 antibody, APC anti-human CD63 antibody) and the fixed-viability dye DyeeFluor 780 antibody were added to resuspend the cells, and incubated at 4°C in the dark for 30 min. Cells were washed with 1 mL PBS, centrifuged at 500 g for 5 min at 4°C, washed twice, filtered through a 70 μm cell sieve, and then sorted by flow cytometry (BD FACS Melody) for GPCs and non-GPCs.
[0063] RNA was extracted from sorted cells using the following steps: Centrifuge at 2000 r / min, 4℃ for 5 min. Discard the supernatant and resuspend the cells in 500 μL of Trizol into an enzyme-free 1.5 mL EP tube. Add 100 μL of chloroform, vortex vigorously for 10 seconds, incubate at room temperature for 5 min, and centrifuge at 12000 g, 4℃ for 15 min. Carefully aspirate the supernatant (the centrifuge tube separates into three layers: a colorless aqueous phase, a DNA layer, and a protein layer; RNA is present in the aqueous phase) and transfer it to a newly prepared 1.5 mL enzyme-free EP tube; add 250 μL of isopropanol to precipitate the RNA, and incubate at room temperature for 10 min (if precipitation time is delayed, it can be placed in a -20℃ freezer); centrifuge at 12000 g, 4℃ for 10 min. Discard the supernatant, add 1 mL of pre-chilled 75% ethanol (prepared at -20℃), and invert the tube several times. Centrifuge at 7500 g, 4℃ for 5 min. Discard the supernatant, allow the precipitate to dry at room temperature for 10 min, and dissolve the RNA in RNase-free H2O depending on the cell count. Detect RNA concentration using Nanodrop. Reverse transcribe mRNA into cDNA using the 4× EZscript Reverse Transcription Mix II kit. The steps are as follows: Prepare the reverse transcription reaction system by adding 100 ng to 2 μg of total RNA (generally, use 1 μg of total RNA, add 5 μL of 4× EZscript RT Mix II, then add ddH2O) to a final volume of 20 μL. Reverse transcription reaction conditions: 42℃ for 15 minutes, then 95℃ for 30 seconds. The obtained product is cDNA, which is diluted 10-fold before proceeding to the next step of real-time quantitative PCR detection. Perform the qRT-PCR reaction using Novizan ChamQ SYBR® qPCR Master Mix. The reaction system was as follows: 5 μL of 2×qPCR Master Mix, 1 μL of diluted cDNA, 1 μL of 2.5 μmol / L upstream and downstream primers, and 3 μL of DEPC water. After mixing and centrifuging to the bottom of the plate, the following amplification program was performed: 95℃ pre-denaturation for 5 minutes, followed by 45 cycles under the following conditions: 98℃ for 10 s; 60℃ for 20 s; 72℃ for 30 s. qRT-PCR was used to identify the GPC subtype gene set, including seven genes: CD63, ARSA, DNAJC3, NPC2, PSAP, GSTP1, and PRDX4. Results are as follows... Figure 3 As shown.
[0064] The result is Figure 3 As predicted by single-cell assays, in fresh tissues of colorectal and lung cancer, GPC cells expressed higher levels of CD63, PRDX4, PSAP, ARSA, DNAJC3, NPC2, and GSTP1 compared to non-GPC cells, indicating that CD63 expression was significantly higher. +CD19 + It can be used as a marker gene to represent a GPC subpopulation for subsequent functional experiments.
[0065] The sorted cells were cultured in X-VIVO medium for 3 days. After 3 days, the cell supernatant was collected for enzyme-linked immunosorbent assay (ELISA) to detect immunoglobulins IgG and IgA in the cell supernatant. According to the reagent instructions, the cells were coated one day in advance: using a 96-well ELISA plate, the capture antibody dilution buffer was prepared with PBS according to the antibody concentration used, and 100 μL was added to each well of the plate. The plate was then incubated overnight at 4°C. The next day, the ELISA plate was removed, the antibody dilution buffer was discarded, and 200 μL of washing buffer (PBS with 0.02% Tween 20 added) was added. The plate was shaken for 1 min and washed three times. After the final wash, the liquid in the plate was discarded as much as possible. 200 μL of blocking buffer (PBS with 0.02% Tween 20 + 0.1% BSA added) was added, and the plate was incubated at room temperature for 1 hour. Discard the blocking buffer, add 200 μL of washing buffer (PBS with 0.02% Tween 20 added), shake on a shaker for 1 min, and wash three times to remove as much liquid as possible from the plate. Add 100 μL of standard and supernatant sample to each well, place in a humidified chamber, and incubate at room temperature for 2 hours. Discard the supernatant, add 200 μL of washing buffer (PBS with 0.02% Tween 20 added), shake on a shaker for 1 min, and wash three times to remove as much liquid as possible from the plate. Add 100 μL of pre-prepared biotin-labeled detection antibody to each well, and incubate at room temperature for 2 hours. Discard the supernatant, add 200 μL of washing buffer, shake on a shaker for 1 min, and wash three times to remove as much liquid as possible from the plate. Add 100 μL of horseradish peroxidase-conjugated streptavidin, and incubate at room temperature for 20 min. Discard the supernatant, add 200 μL of washing buffer, and shake on a shaker for 1 min. Wash three times in total, removing as much liquid as possible from the plate. Add 100 μL of the pre-prepared chromogenic substrate, place in a humidified chamber, and incubate in the dark for 20–30 min, observing the color change. When the color shows no significant change, add 100 μL of reaction stop solution and immediately measure A. 450 Value (within 3 minutes). Results are as follows: Figure 4 As shown.
[0066] Depend on Figure 4 It was found that, compared to non-GPCs, GPCs highly expressed plasma cell marker proteins CD38 and CD138 on their surface. ELISA analysis of cell culture supernatant showed that GPCs produced higher levels of immunoglobulins IgG and IgA compared to non-GPCs, with the difference in IgA production being more pronounced. This suggests that GPCs possess plasma cell phenotype and function in the tumor microenvironment.
[0067] Example 4: Granulocyte phenotype and function of GPCs in tumors The purpose of this embodiment is to investigate whether GPCs in the tumor microenvironment have granulocyte phenotype and function.
[0068] This experiment collected fresh tissue specimens from patients with colorectal cancer, lung cancer, nasopharyngeal carcinoma, and gastric cancer. Fresh tissue was removed during surgery and temporarily stored on ice in RPMI 1640 medium. To maintain cell viability, single cells needed to be isolated within 2 hours of sample collection. Tissue digestion solution was prepared by adding 0.1 mg / mL DNase and 0.1 μg / mL type IV collagenase to RPMI 1640 medium, and then adding an appropriate amount of digestion solution according to the size of the tumor tissue. Sterile scissors and forceps were prepared, and 7 cm sections of tissue were selected according to cell size. 2 Place the tissue in a cell culture dish and cut it into small pieces. Add an appropriate amount of tissue digestion solution and break up the cell clumps with a pipette tip. Incubate at 37°C for 30 min. After digestion, repeatedly pipette the cells and filter them through a pre-prepared 70 μm cell sieve. Add red blood cell lysis buffer and incubate at room temperature for 10 min. Centrifuge at 500 g for 5 min at room temperature. Wash 2-3 times with RPMI 1640.
[0069] Tumor-infiltrating lymphocytes were collected and stained by flow cytometry. Cell counts were performed, and (1-5) × 10⁶ cells were collected. 5Transfer cells to a 1.5 mL EP tube and centrifuge at 500 g for 5 min at room temperature. Resuspend and wash cells in 1 mL PBS, centrifuge at 500 g for 5 min at room temperature. Add 5 μL of Fc Receptor blocking solution to 100 μL PBS, resuspend cells, and incubate at 4°C for 15–30 min. Based on cell grouping, and according to the concentration of the 1:100 antibody dilution buffer, 100 μL of diluted flow cytometry antibodies (PerCP-Cyanine 5.5 anti-human CD19 antibody, APC anti-human CD63 antibody, eFluor 450 anti-human CD63 antibody, APC anti-human CSF1R (CD115) Antibody, APC anti-human CSF2R (CD116) Antibody, PE anti-human CSF3R (CD114) Antibody, PE anti-human KDR (CD309) Antibody, PE-Cyanine 7 anti-human TLR2 (CD282) Antibody, BV421 anti-human TLR4 (CD284) Antibody) were added to resuspend the cells, and incubated at 4°C in the dark for 30 min. The cells were then washed with 1 mL of PBS, centrifuged at 500 g at 4°C for 5 min, and washed twice. The assay was performed using a Beckman CytoFLEX Flow cytometer, and the results were analyzed using FlowJo 10.0 software.
[0070] Flow cytometry was used to detect the expression level of the cytokine ARG-1. Cytokine stimulation solution was prepared by adding phorbol ester (PMA), ionomycin, and a protein transport inhibitor (Brefeldin A, BFA) to X-VIVO lymphocyte culture medium. Cells were resuspended in 500 μL of cytokine stimulation solution and cultured in 48-well cell culture plates at 37°C for 4–6 hours. Cells were counted, and (3–5) × 10⁵ cells were collected and transferred to 1.5 mL EP tubes. Cells were centrifuged at 500 g for 5 min at room temperature. Cells were resuspended and washed with 1 mL of PBS and centrifuged at 500 g for 5 min at room temperature. Cells were resuspended in 100 μL of PBS with 5 μL of Fc receptor blocking solution and incubated at 4°C for 15–30 min.
[0071] Based on cell grouping, prepare a 1:100 dilution of surface flow cytometry antibody in advance. Add 100 μL of the diluted flow cytometry antibody (PerCP-Cyanine 5.5 anti-human CD19 antibody, APC anti-human CD63 antibody) and Fixed Viability Dye eFluor 780 antibody to resuspend the cells and incubate at 4°C in the dark for 30 min. Wash the cells with 1 mL of PBS, centrifuge at 500 g, 4°C for 5 min, and wash 2-3 times. Resuspend the cells with 100 μL of fixation buffer and incubate at 4°C in the dark for 30-60 min. Prepare a 1×Permwash permeabilization buffer by dissolving 10×Perm wash solution in ddH2O, and resuspend the cells 2-3 times with 1 mL of 1×Perm wash permeabilization buffer. Add the intracellular antibody (APC anti-human / mouse ARG-1 Antibody) at a 1:100 dilution to the permeabilization buffer to ensure effective intracellular staining antibody entry into the cells. Resuspend cells in 100 μL of diluted flow cytometry antibody and incubate at 4°C in the dark for 30 min. Wash cells with 1 mL of cell permeabilization buffer and centrifuge at 500 g, 4°C for 5 min. Resuspend cells in 200–300 μL of PBS and transfer to flow cytometry tubes for analysis using a Beckman CytoFLEX flow cytometer. Analyze the results using FlowJo 10.0 software.
[0072] The collected tumor-infiltrating lymphocytes were sorted by flow cytometry. Cells were resuspended and washed with 1 mL of PBS, centrifuged at 500 g for 5 min at room temperature. Cells were resuspended in 100 μL of PBS with 5 μL of Fc Receptor blocking solution and incubated at 4°C for 15–30 min. Based on cell grouping, and according to the concentration of the 1:100 antibody dilution buffer, 100 μL of diluted flow cytometry antibodies (FITC-anti-human CD45 antibody, PerCP-Cyanine5.5 anti-human CD19 antibody, APC anti-human CD63 antibody) and the fixed-viability dye DyeeFluor 780 antibody were added to resuspend the cells, and the cells were incubated at 4°C in the dark for 30 min. Cells were washed with 1 mL of PBS, centrifuged at 500 g for 5 min at 4°C, washed twice, filtered through a 70 μm cell sieve, and then sorted by flow cytometry (BD FACS Melody) for GPCs and non-GPCs. After sorting, the cells were cultured in X-VIVO medium for 3 days. After 3 days, the cell supernatant was collected for enzyme-linked immunosorbent assay (ELISA) to detect immunoglobulins S100A8 / A9 and MMP9 in the cell supernatant. According to the reagent instructions, the cells were coated one day in advance: using a 96-well ELISA plate, 100 μL of capture antibody dilution buffer (PBS) was prepared according to the antibody concentration used and added to each well. The plate was incubated overnight at room temperature. The next day, the ELISA plate was removed, the antibody dilution buffer was discarded, and 200 μL of washing buffer (PBS with 0.02% Tween 20) was added. The plate was shaken for 1 min and washed three times. After the final wash, as much liquid as possible was discarded from the plate. 200 μL of blocking buffer (PBS with 0.02% Tween 20 + 0.1% BSA) was added, and the plate was incubated at room temperature for 1 hour. Discard the blocking buffer, add 200 μL of washing buffer (PBS with 0.02% Tween 20 added), shake on a shaker for 1 min, and wash three times to remove as much liquid as possible from the plate. Add 100 μL of standard and supernatant sample to each well, place in a humidified chamber, and incubate at room temperature for 2 hours. Discard the supernatant, add 200 μL of washing buffer (PBS with 0.02% Tween 20 added), shake on a shaker for 1 min, and wash three times to remove as much liquid as possible from the plate. Add 100 μL of pre-prepared biotin-labeled detection antibody to each well, and incubate at room temperature for 2 hours. Discard the supernatant, add 200 μL of washing buffer, shake on a shaker for 1 min, and wash three times to remove as much liquid as possible from the plate. Add 100 μL of horseradish peroxidase-conjugated streptavidin, and incubate at room temperature for 20 min.Discard the supernatant, add 200 μL of washing buffer, and shake on a shaker for 1 min. Wash three times in total, removing as much liquid as possible from the plate. Add 100 μL of the pre-prepared chromogenic substrate, place in a humidified chamber, and incubate in the dark for 20–30 min, observing the color change. When there is no significant color change, add 50 μL of reaction stop solution and immediately measure A. 450 Value (within 3 minutes). Results are as follows: Figure 5 As shown.
[0073] Multicolor immunohistochemistry was used to stain paraffin sections of patient tissues from colorectal cancer, lung cancer, nasopharyngeal carcinoma, gastric cancer, cervical cancer, and breast cancer with CD19, CD63, MPO, and ARG-1. Tumor tissue paraffin sections were baked at 65°C, dewaxed in xylene (3 cycles), and visually inspected for residual wax. After complete dewaxing, the sections were hydrated with a gradient of different concentrations of ethanol (100%, 100%, 95%, 90%, 80%, 70%, 60%), and then passed through ddH2O (2 cycles). Retrieval: EDTA antigen retrieval solution (pH 8.0) was used for 2 minutes and 30 seconds. Blocking: 0.5% BSA solution was incubated at room temperature for 10 minutes. The blocking solution was discarded, and diluted primary antibody (CD63, Cell Signaling Technology, 1:400) was added and incubated at room temperature for 1 hour. Washing buffer (PBST) was added for 3 minutes, repeated 3 times. Horseradish peroxidase-labeled secondary antibody was added and incubated at room temperature for 10 minutes. Wash 3 times with washing buffer for 3 min. Add single-color TSA fluorescent dye (Opal dyes 620, 1:250) and incubate at room temperature in the dark for 10 min. Wash 3 times with washing buffer for 3 min. Proceed to the next cycle. Retrieval: EDTA antigen retrieval solution (pH 8.0), retrieval time 2 min 30 sec. Blocking: 0.5% BSA solution, incubate at room temperature for 10 min. Discard the blocking solution, add diluted primary antibody (anti-human / mouse ARG-1, Abcam, 1:400), incubate at room temperature for 1 hour. Wash 3 times with washing buffer for 3 min. Add horseradish peroxidase-labeled secondary antibody, incubate at room temperature for 10 min. Wash 3 times with washing buffer for 3 min. Add single-color TSA fluorescent dye (Opal dyes 570, 1:250), incubate at room temperature in the dark for 10 min. Wash 3 times with washing buffer for 3 min. Proceed to the next cycle. Retrieval: EDTA antigen retrieval solution (pH 8.0), retrieval time 2 min 30 s. Blocking: 0.5% BSA solution, incubate at room temperature for 10 min. Discard the blocking solution, add diluted primary antibody (anti-human MPO, Cell Signaling Technology, 1:500), incubate at room temperature for 1 hour. Wash with washing buffer for 3 min, wash 3 times. Add horseradish peroxidase-labeled secondary antibody, incubate at room temperature for 10 min. Wash with washing buffer for 3 min, wash 3 times. Add single-color TSA fluorescent dye (Opal dyes 520, 1:250), incubate at room temperature in the dark for 10 min. Wash with washing buffer for 3 min, wash 3 times. Proceed to the next cycle. Retrieval: EDTA antigen retrieval solution (pH 8.0), retrieval time 2 min 30 s. Blocking: 0.5% BSA solution, incubate at room temperature for 10 min.Discard the blocking buffer, add diluted primary antibody (anti-human CD19, ZSGB-Bio, 1:200), and incubate at room temperature for 1 hour. Wash with washing buffer for 3 minutes, repeating 3 times. Add horseradish peroxidase-labeled secondary antibody and incubate at room temperature for 10 minutes. Wash with washing buffer for 3 minutes, repeating 3 times. Add single-color TSA fluorescent dye (Opal dyes 520, 1:690) and incubate at room temperature in the dark for 10 minutes. Wash with washing buffer for 3 minutes, repeating 3 times. Add anti-fluorescence quencher containing DAPI and mount. Store in the dark at 4°C. Scan with a Jiangfeng fully automated digital scanner and perform further analysis on the HALO digital pathology image analysis platform.
[0074] Depend on Figure 5 Flow cytometry results showed that, compared to non-GPCs, GPCs highly expressed myeloid-associated cell surface receptors CSF1R, CSF2R, CSF3R, KDR, TLR2, and TLR4, and produced higher levels of ARG-1. ELISA results showed that GPCs produced higher levels of S100A8 / A9 and MMP9. Multicolor immunohistochemistry results showed that GPCs were present in tissues of colorectal cancer, lung cancer, nasopharyngeal carcinoma, gastric cancer, cervical cancer, and ovarian cancer, and could produce myeloid-associated granule proteins MPO and ARG-1. This suggests that GPCs possess myeloid-associated phenotypes and functions in the tumor microenvironment.
[0075] Example 5: Correlation between GPCs and immune response in newly diagnosed cancer patients and cancer patients treated with ICB. The purpose of this embodiment is to explore the correlation between GPCs and the prognosis of newly diagnosed cancer patients, and the correlation between GPCs and the immune response of cancer patients after ICB treatment.
[0076] This experiment collected specimens from 193 newly diagnosed colorectal cancer patients and 101 newly diagnosed nasopharyngeal carcinoma patients (the newly diagnosed tumor patients had never received any anti-tumor treatment before surgery, such as radiotherapy, chemotherapy, immunotherapy, or traditional Chinese medicine). CD19 and CD63 were stained using multicolor immunohistochemistry. Multicolor immunohistochemistry was used to stain paraffin blocks of colorectal cancer and nasopharyngeal carcinoma patient tissues with CD19 and CD63. Tumor tissue paraffin sections were baked at 65°C, dewaxed with xylene in three batches, and visually inspected for any wax residue. After complete dewaxing, the sections were hydrated with a gradient of different concentrations of ethanol (100%, 100%, 95%, 90%, 80%, 70%, 60%) and passed through two batches of ddH2O. Repair: EDTA antigen repair solution (pH 8.0) was used for 2 minutes and 30 seconds. Blocking: 0.5% BSA solution was used for incubation at room temperature for 10 minutes. Discard the blocking buffer, add diluted primary antibody (anti-human CD19, ZSGB-Bio, 1:200), and incubate at room temperature for 1 hour. Wash 3 times with Tris-buffered Tween wash buffer (TBST: Tris-HCl + NaCl + Tween 20) for 3 minutes. Add horseradish peroxidase-labeled secondary antibody and incubate at room temperature for 10 minutes. Wash 3 times with TBST for 3 minutes. Add single-color TSA fluorescent dye (Opal dyes 520, 1:250) and incubate at room temperature in the dark for 10 minutes. Wash 3 times with TBST for 3 minutes. Proceed to the next cycle. Retrieval: EDTA antigen retrieval buffer (pH 8.0), retrieval time 2 minutes 30 seconds. Blocking: 0.5% BSA solution, incubate at room temperature for 10 minutes. Discard the blocking buffer, add diluted primary antibody (CD63, Cell Signaling Technology, 1:400), and incubate at room temperature for 1 hour. Wash with TBST for 3 min, repeat 3 times. Add horseradish peroxidase-labeled secondary antibody and incubate at room temperature for 10 min. Wash with TBST for 3 min, repeat 3 times. Add single-color TSA fluorescent dye (Opal dyes 620, 1:250) and incubate at room temperature in the dark for 10 min. Wash with TBST for 3 min, repeat 3 times. Add anti-fluorescence quencher containing DAPI and mount. Store in the dark at 4°C. Scan with Jiangfeng fully automated digital scanner and perform further analysis on the HALO digital pathology image analysis platform. Use Kaplan-Meier analysis to compare the correlation between GPCs and non-GPCs subsets and overall survival (OS) of patients with colorectal cancer and nasopharyngeal carcinoma.
[0077] Multicolor immunohistochemistry was used to stain paraffin sections of colorectal cancer, lung cancer, and nasopharyngeal carcinoma treated with PD-1 / PD-L1 immunosuppressants for CD19, CD63, CD8, and EOMES staining. Tumor tissue paraffin sections were baked at 65°C, dewaxed in xylene (3 cycles), and visually inspected for residual wax. After complete dewaxing, the sections were hydrated with a gradient of different concentrations of ethanol (100%, 100%, 95%, 90%, 80%, 70%, 60%), and then passed through ddH2O (2 cycles). Repair: EDTA antigen repair solution (pH 8.0) was used for 2 minutes and 30 seconds. Blocking: 0.5% BSA solution was incubated at room temperature for 10 minutes. The blocking solution was discarded, and diluted primary antibody (CD63, Cell Signaling Technology, 1:400) was added and incubated at room temperature for 1 hour. TBST was added for 3 minutes and 3 washes. Horseradish peroxidase-labeled secondary antibody was added and incubated at room temperature for 10 minutes. Add TBST and wash for 3 min, repeat 3 times. Add single-color TSA fluorescent dye (Opal dyes 620, 1:250) and incubate at room temperature in the dark for 10 min. Add TBST and wash for 3 min, repeat 3 times. Proceed to the next cycle. Retrieval: EDTA antigen retrieval solution (pH 8.0), retrieval time 2 min 30 sec. Blocking: 0.5% BSA solution, incubate at room temperature for 10 min. Discard the blocking solution, add diluted primary antibody (anti-human CD19, ZSGB-Bio, 1:200), incubate at room temperature for 1 hour. Add TBST and wash for 3 min, repeat 3 times. Add horseradish peroxidase-labeled secondary antibody, incubate at room temperature for 10 min. Add TBST and wash for 3 min, repeat 3 times. Add single-color TSA fluorescent dye (Opal dyes 570, 1:250), incubate at room temperature in the dark for 10 min. Add TBST and wash for 3 min, repeat 3 times. Proceed to the next cycle. Retrieval: EDTA antigen retrieval solution (pH 8.0), retrieval time 2 min 30 s. Blocking: 0.5% BSA solution, incubate at room temperature for 10 min. Discard the blocking solution, add diluted primary antibody (Anti-human / mouse EOMES Antibody, Abcam, 1:400), incubate at room temperature for 1 hour. Add TBST, wash for 3 min, wash 3 times. Add horseradish peroxidase-labeled secondary antibody, incubate at room temperature for 10 min. Add TBST, wash for 3 min, wash 3 times. Add single-color TSA fluorescent dye (Opal dyes 520, 1:250), incubate at room temperature in the dark for 10 min. Add TBST, wash for 3 min, wash 3 times. Proceed to the next cycle. Retrieval: EDTA antigen retrieval solution (pH 8.0), retrieval time 2 min 30 s. Blocking: 0.5% BSA solution, incubate at room temperature for 10 min.Discard the blocking buffer, add diluted primary antibody (Rabbit anti-human CD8 Antibody, ZSGB-Bio, 1:200), and incubate at room temperature for 1 hour. Wash with TBST for 3 min, repeat 3 times. Add horseradish peroxidase-labeled secondary antibody and incubate at room temperature for 10 min. Wash with TBST for 3 min, repeat 3 times. Add single-color TSA fluorescent dye (Opal dyes 520, 1:690) and incubate at room temperature in the dark for 10 min. Wash with TBST for 3 min, repeat 3 times. Add anti-fluorescence quencher containing DAPI and mount. Store in the dark at 4°C. Scan with a Jiangfeng fully automated digital scanner and perform further analysis using the HALOV.3.0.1 digital pathology image analysis platform.
[0078] In this embodiment, HALO software was used to analyze the multispectral images of each sample. The software's algorithm, based on DAPI staining of cell nuclei, can identify cell boundaries and calculate the ratio of cell nucleus to cytoplasm. Fluorescence intensity thresholds were set according to the staining intensity of different biomarkers in the cytoplasm or nucleus. CD19 was determined based on the co-localization of CD19 and CD63 spots. + CD63 - and CD19 + CD63 + The number of spots. Furthermore, this embodiment also considers the expression levels of CD8 and EOMES to determine the number of CD8 spots. + T cells are divided into two distinct populations (EOMES) + CD8 + and EOMES - CD8 + In the analysis, this embodiment randomly selected 5 to 10 visual field regions from each image for statistical analysis. The Mann-Whitney test was used to analyze GPCs, non-GPCs, and CD8. + EOMES - and CD8 + EOMES + Correlation analysis was performed between patients with a treatment response (partial response, PR) and those without a treatment response (stable disease, SD + progressive disease, PD). Results are as follows: Figure 6 As shown.
[0079] Depend on Figure 6It is evident that, compared to non-GPCs, GPC subsets are directly proportional to poor prognosis in treatment-naïve colorectal and nasopharyngeal carcinoma patients. In patients with colorectal, lung, and nasopharyngeal carcinoma who have undergone immunotherapy, GPC subsets are increased in patients with no treatment response (stable disease (SD) + progressive disease (PD)), and CD8+ is also present. + EOMES + Lethality CD8 + The proportion of T cells was reduced. Furthermore, the proportion of GPCs effectively differentiated patient treatment response, with areas under the curve (AUC) of 0.848 and 0.866, respectively. This suggests that this cell subset has certain clinical predictive value for patient prognosis and the effectiveness of immunotherapy, and could serve as a novel target for predicting immunotherapy prognosis.
[0080] Example 7: Functional validation of GPCs in vivo and their correlation with ICB immunotherapy To further investigate whether GPCs have a cancer-promoting effect in vivo, the inventors commissioned Suzhou Cyagen Biotech Co., Ltd. to design gRNAs (gRNA1 (matching forward strand of gene): ACGGTCTGATGGTATCGCCAAGG, SEQ ID NO: 1; gRNA2 (matching forward strand of gene): GTGGCTATGAAGTAATGTAGGGG, SEQ ID NO: 2) using CRISPR / Cas9 technology, and obtained Cd63 gene conditional knockout mice (Cd19-Cd63flox / flox) through pronuclear microinjection. Genotyping of mouse tail DNA was performed by PCR using specific primers (Cre-Cd19 Mutant Sequence Primers-F: 5′-GCGGTCTGGCAGTAAAAACTATC-3′, SEQ ID NO: 3; Cre-Cd19 Mutant Sequence Primers-R: 5′-GTGAAACAGCATTGCTGTCACTT-3′, SEQ ID NO: 4; Cd63 Loxp Sequence Primers-F: 5′- TCTCCACCCTCATTTCCATCTTTC-3′, SEQ ID NO: 5; Cd63 Loxp Sequence Primers-R: 5′- GGAGAATCCACTCCATGAAAAGAC-3′, SEQ ID NO: 6).
[0081] CD63 expression was identified as follows: A 3mm section of mouse tail tissue was excised and collected into a 1.5 mL clean centrifuge tube. 200 μL of mouse tail lysis buffer containing 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, and 0.4 mg / mL Proteinase K was added to each tube. The tube was briefly centrifuged to ensure the tail tissue and lysis buffer were at the bottom simultaneously. The tube was incubated overnight at 56 °C for lysis. After incubation, the tube was vortexed to increase DNA release. The tube was then centrifuged at 12000 rcf for 10 min at 4 °C. The supernatant was collected as a template for the extracted DNA. Primers 1: Cre-Cd19 Mutant Sequence Primers-F: 5′-GCGGTCTGGCAGTAAAAACTATC-3′ (SEQ ID NO: 7) and Cre-Cd19 Mutant Sequence Primers-R: PCR amplification was performed using 5′-GTGAAACAGCATTGCTGTCACTT-3′ (SEQ ID NO: 8) and identification primer pairs 2: Cd63 Loxp Sequence Primers-F: 5′-TCTCACCCTCATTTCCATCTTTC-3′ (SEQ ID NO: 9) and Cd63 Loxp Sequence Primers-R: 5′-GGAGAATCCACTCCATGAAAAGAC-3′ (SEQ ID NO: 10) (reaction system and procedure are shown in Tables 1 and 2). After the PCR reaction, 10 μL was taken for 2% agarose gel electrophoresis, and the results were as follows: Figure 2 The results showed that for Cre-Cd19 Mutant Sequence Primers, a single band of 102 bp was considered Cre-Cd19 positive, otherwise negative; for Cd63 Loxp Sequence Primers, a single band of 204 bp was considered Cd63 Loxp positive homozygous mice, and a single band of 137 bp was considered Cd63 Loxp negative mice. If both 204 bp and 137 bp bands appeared in the same sample from the same mouse, the mouse was identified as a Cd63 Loxp heterozygous mouse.
[0082] Table 1 PCR reaction system
[0083] Table 2 PCR amplification system
[0084] Take C57 / BL6 and Cd19-Cd63 of the same age and weight △ Mice, at 6 weeks of age, were injected with colorectal cancer cells (MC38) (5×10^ 5 (8 mice per group), mouse lung cancer cells (LLC) (5 × 10^ 5 (6 mice per group) and mouse melanoma cells (B16-F10) (5 × 10^ 5 (8 mice per group) Subcutaneous tumors were formed, and the tumor volume was measured every 3 days using the formula: Volume = (Length × Width)^ 2 The calculation is based on 1 / 2). Animals were euthanized when the maximum tumor diameter reached approximately 15 mm. For PD-1 antibody treatment (8 mice per group), euthanasia was performed when the tumor size reached 500 mm. 3 At that time, the anti-PD-1 antibody (BE0273, BioXcells) and the control IgG antibody were diluted with PBS, and 10 mg / kg of anti-PD-1 antibody was injected intraperitoneally every 3 days.
[0085] Mouse tumor samples were washed with PBS, and tissue digestion solution was prepared: 0.1 mg / mL DNase and 0.1 μg / mL type IV collagenase were added to RPMI 1640 medium, and an appropriate amount of tissue digestion solution was added according to the size of the tumor tissue. Sterile scissors and forceps were prepared, and 7 cm sections were selected according to the cell size. 2 In a cell culture dish, place the tissue and cut it into small pieces. Add an appropriate amount of tissue digestion solution and break up the cell clumps with a pipette tip. Incubate at 37°C for 30 min. After digestion, repeatedly pipette the cells and filter them through a pre-prepared 70 μm cell sieve. Wash twice with RPMI 1640 to obtain mouse tumor-infiltrating lymphocytes. Prepare mouse lymphocyte separation medium by diluting physiological saline and digested tumor-infiltrating lymphocytes at a 1:1 ratio. Add the lymphocyte separation medium to a centrifuge tube, then slowly drip the diluted tumor-infiltrating lymphocytes along the tube wall, being careful not to disrupt the separation medium interface. Centrifuge at 2000 r / min (increase speed 2, decrease speed 0) for 25 min at room temperature. Aspirate the white membrane and transfer it to a 50 mL centrifuge tube. Fill the tube with physiological saline to 50 mL and wash the cells. Add erythrocyte lysis buffer and incubate at room temperature for 10 min. Centrifuge at 500 g for 5 min at room temperature. Wash the cells again with 50 mL of physiological saline, centrifuge at 500 g for 5 min at room temperature. Proceed to the next step of flow cytometry staining.
[0086] Preparation of cytokine stimulation solution: Add phorbol ester (PMA), ionomycin, and protein transport inhibitor (Brefeldin A, BFA) to X-VIVO lymphocyte culture medium. Resuspend cells in 500 μL of cytokine stimulation solution and incubate in 48-well cell plates at 37°C for 4–6 hours. Count cells and collect (3–5) × 10⁻⁶ cells. 5 Transfer to a 1.5 mL EP tube, centrifuge at 500 g for 5 min at room temperature. Resuspend and wash cells in 1 mL PBS, centrifuge at 500 g for 5 min at room temperature. Add 5 μL Fc Receptor blocking solution to 100 μL PBS, resuspend cells, and incubate at 4°C for 15–30 min.
[0087] Based on cell grouping, prepare a 1:100 dilution of the surface flow cytometry antibody in advance. Add 100 μL of the diluted flow cytometry antibody (CD45 anti-mouse FITC Antibody, CD3 anti-mouse PE-Cyanine 7 Antibody, CD8 anti-mouse PerCP-Cyanine 5.5 Antibody) and the fixed-viability dye eFluor 780 antibody to resuspend the cells. Incubate at 4°C in the dark for 30 min. Wash the cells with 1 mL of PBS, centrifuge at 500 g, 4°C for 5 min, and wash 2-3 times. Resuspend the cells with 100 μL of fixation buffer and incubate at 4°C in the dark for 30-60 min. Prepare a 1×Perm wash permeabilization buffer by dissolving 10×Perm wash solution in ddH2O, and resuspend the cells twice with 1 mL of the 1×Perm wash permeabilization buffer. Intracellular antibodies (IFN-γ anti-mouse PE Antibody, Granzyme B anti-mouse eFluor 450 Antibody) were added to the cell permeabilization buffer at a ratio of 1:100 to prepare an antibody dilution solution, ensuring effective entry of the intracellular staining antibody into the cells. Cells were resuspended in 100 μL of the diluted flow cytometry antibody and incubated at 4°C in the dark for 30 min. Cells were washed with 1 mL of cell permeabilization fixation solution and centrifuged at 500 g at 4°C for 5 min. Cells were resuspended in 200–300 μL of PBS and transferred to flow cytometry tubes for analysis using a Beckman CytoFLEX flow cytometer. Results were analyzed using FlowJo 10.0 software.
[0088] Mouse genotyping is determined by Figure 7As shown, #01, #02, #05, #08, and #15 are Cre-Cd19 positive, Cd63 Loxp positive homozygous mice, i.e., CD19 positive mice. + Conditional knockout of Cd63 in B cells (Cd19-Cd63) △ In animal experiments, compared to C57 / BL6 mice, in Cd19-Cd63... △ In conditional knockout mice, the growth rate of tumor cells in colorectal cancer, lung cancer, and melanoma was significantly slowed; while in Cd19-Cd63... △ In conditional knockout mouse models, the addition of PD-1 immunotherapy significantly inhibited tumor cell growth. Flow cytometry results also showed that, within the tumor immune microenvironment of the mice, effector CD8... + The killing function of T cells was significantly enhanced.
[0089] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.
Claims
1. A granulocyte-monocyte marker, characterized in that: the granulocyte-monocyte cell highly expresses CD63, ARSA, DNAJC3, NPC2, PSAP, GSTP1 and PRDX4.
2. Use of a substance for detecting a granulocyte-monocyte marker in the preparation of a product for predicting the effect of tumor immune checkpoint blockade therapy; the granulocyte-monocyte cell highly expresses CD63, ARSA, DNAJC3, NPC2, PSAP, GSTP1 and PRDX4.
3. The use according to claim 2, characterized in that: the substance for detecting a granulocyte-monocyte marker comprises a substance for detecting A) or B): A) CD63, ARSA, DNAJC3, NPC2, PSAP, GSTP1 and PRDX4; B) CD63 and CD19.
4. The use according to claim 3, characterized in that: the substance for detecting A) or B) comprises a reagent for detecting A) or B) at the protein level or at the gene level; preferably, the reagent for detecting A) or B) at the protein level is selected from one or more detection methods of the following group: chemiluminescence method, immunofluorescence method, protein chip method, protein mass spectrometry method, immunohistochemical method, patch tracking method based on labeling technology, Western blot method, enzyme-linked immunosorbent assay; the reagent for detecting A) or B) at the gene level is selected from one or more detection methods of the following group: high-throughput sequencing, digital PCR, fluorescent quantitative PCR.
5. The use according to claim 2, characterized in that: the product comprises a detection kit, a detection chip or a detection test strip.
6. The use according to claim 2, characterized in that: the detection sample of the product comprises a cell or tissue sample.
7. The use according to claim 2, characterized in that: the tumor comprises nasopharyngeal carcinoma, lung cancer, colorectal cancer, ovarian cancer, cervical cancer, endometrial cancer, breast cancer, head and neck tumor, gastric cancer, thymus tumor, pancreatic cancer and testicular tumor.
8. Use of a reagent for knocking out CD63 in the preparation of a drug for treating a tumor.
9. The use according to claim 8, characterized in that: The reagent that knocks out CD63 in CD19 + cells specifically knocks out CD63.
10. The use according to claim 8 or 9, characterized in that: the drug further comprises an immune checkpoint inhibitor.