Recombinant yarrowia lipolytica strain for producing astaxanthin based on fusion protein method and application of recombinant yarrowia lipolytica strain

By constructing an astaxanthin synthesis pathway in Yersinia lipolytica and using a fusion protein ligase to express hemoglobin VHb, the problems of intermediate metabolite accumulation and insufficient oxygen supply were solved, achieving efficient astaxanthin synthesis and high yield.

CN121652953APending Publication Date: 2026-03-13NANJING TECH UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-12
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently synthesize astaxanthin in Yersinia lipolytica, and the accumulation of intermediate metabolites affects product accumulation, while insufficient cellular oxygen supply limits biomass.

Method used

A complete astaxanthin synthesis pathway was constructed in Yersinia lipolytica. The key enzymes CrtW and CrtZ for astaxanthin synthesis were linked by a fusion protein approach, and hemoglobin VHb was expressed to improve cellular oxygen supply.

Benefits of technology

This study achieved efficient astaxanthin synthesis in Yeast Extract, reduced the accumulation of intermediate metabolites, and increased cell biomass and astaxanthin yield, reaching a shake flask yield of 340.29 mg/L and a fermenter yield of 2.85 g/L.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121652953A_ABST
    Figure CN121652953A_ABST
Patent Text Reader

Abstract

The invention discloses a Yarrowia lipolytica engineering bacterium for producing astaxanthin based on a fusion protein method and application of the Yarrowia lipolytica engineering bacterium. A complete astaxanthin synthesis path is expressed in host bacteria by recombinant Yarrowia lipolytica; comprising geranyl geranyl diphosphate synthase CrtE, phytoene synthetase / lycopene cyclase CrtYB, phytoene desaturase CrtI, 3-hydroxy-3-methylglutaryl CoA reductase tHMGR, beta-carotene ketoalcohol enzyme CrtW and beta-carotene hydroxylase CrtZ, and astaxanthin synthesis key enzymes CrtW and CrtZ are subjected to fusion expression by using a short peptide or Linker, so that the astaxanthin is obtained. Meanwhile, the expression of hemoglobin VHb from vitreoscilla is increased; the astaxanthin production performance of the recombinant strain is verified on the basis of protein engineering and fermentation engineering, and the astaxanthin production capacity of the yarrowia lipolytica is further improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a recombinant lipophilic yeast engineered strain for producing astaxanthin based on a fusion protein method and its application. Background Technology

[0002] Yarrowia lipolytica is an unconventional oil-producing yeast with a clear genetic background and well-developed gene-editing tools. Due to its abundant precursor supply, it is an excellent substrate strain for synthesizing acetyl-CoA derivatives. Yarrowia lipolytica is recognized as a "Generally Recognized As Safe (GRAS)" strain by the US FDA. It does not produce toxins, and its fermentation products do not require complex toxin removal processes, allowing them to be directly used in food additives, health products, and feed additives, meeting the market demand for natural products. Yarrowia lipolytica is a typical "lipogenic yeast," capable of synthesizing and accumulating large amounts of lipid droplets. Astaxanthin, as a fat-soluble carotenoid, can benefit from these droplets, which provide a natural storage site, reducing the product's toxicity to cells while increasing its accumulation. It can efficiently utilize various carbon sources, including conventional sources such as glucose and sucrose, as well as low-cost renewable sources such as glycerol, vegetable oil, industrial waste molasses, and lignocellulose hydrolysate. It is particularly suitable for the resource utilization of industrial waste (such as glycerol, a byproduct of biodiesel), significantly reducing raw material costs. It exhibits excellent environmental tolerance: it can grow stably over a wide pH range (pH 2.5-10), under high osmotic pressure, and with high product concentrations, eliminating the need for strict control of environmental parameters (such as precise pH regulation) in industrial fermentation, thus reducing energy consumption and control costs during the fermentation process. Its genome sequencing is complete, revealing a clear genetic background, and it possesses a highly efficient gene editing system capable of multi-gene site-specific integration and precise regulation of metabolic flux.

[0003] Astaxanthin is a natural, fat-soluble carotenoid. Its core advantage stems from its unique molecular structure (containing hydroxyl and ketone groups at both ends, with a long conjugated double bond system), possessing both superior bioactivity and wide-ranging applications. It has outstanding advantages in the fields of medicine, health, food, feed, and cosmetics. It exhibits excellent cell protection and tissue repair capabilities, able to cross the blood-brain barrier and blood-retinal barrier to directly protect key tissue cells such as nerve cells, retinal cells, and cardiomyocytes. It can also scavenge free radicals in skin cells, delay collagen loss, reduce fine lines and wrinkles, improve skin laxity and dullness, and brighten skin tone. In recent years, with the continuous development of synthetic biology, the synthesis of astaxanthin using metabolic engineering and genetic engineering techniques to modify *Yarrowia lipolytica* has become a new research hotspot. Summary of the Invention

[0004] The first objective of this invention is to construct a complete astaxanthin synthesis pathway in Yersinia lipolyticis, enabling the de novo synthesis of astaxanthin.

[0005] The second objective of this invention is to link the key astaxanthin synthesis enzymes CrtW and CrtZ with RIDD and RIAD short peptides.

[0006] The third objective of this invention is to link the key enzymes CrtW and CrtZ in astaxanthin synthesis with different linkers to reduce the substrate transport distance.

[0007] The fourth objective of this invention is to express hemoglobin in Yersinia lipolyticis, thereby increasing the oxygen uptake capacity of the cells and improving the biomass of the engineered strain.

[0008] The fifth objective of this invention is to provide a method for constructing the above-mentioned recombinant Yersinia lipophila strain.

[0009] The present invention also provides the application of the above-mentioned recombinant Yersinia lipolyticis strain in the synthesis of the natural product astaxanthin.

[0010] To achieve the above objectives, the present invention adopts the following technical solution:

[0011] A recombinant Yersinia lipolytica engineered strain for producing astaxanthin based on a fusion protein method was obtained by expressing gerany-gerany diphosphate synthase CrtE, phytoene synthase / lycopene cyclase CrtYB, and phytoene desaturase CrtI from Pharbitis rubescens, 3-hydroxy-3-methylglutaryl-CoA reductase tHMGR from Saccharomyces cerevisiae, and β-carotene ketolase CrtW and β-carotene hydroxylase CrtZ from Haematococcus pluvialis in a host strain.

[0012] The host bacterium is Yersinia lipophila po1f.

[0013] In a preferred embodiment, the nucleotide sequences of the geraniol geraniol diphosphate synthase CrtE, phytoene synthase / lycopene cyclase CrtYB, phytoene desaturase CrtI, 3-hydroxy-3-methylglutaryl-CoA reductase tHMGR, β-carotene ketolase CrtW, and β-carotene hydroxylase CrtZ are shown in SEQ ID NO: 1-6, respectively.

[0014] As a preferred embodiment, the key enzymes for astaxanthin synthesis, CrtW and CrtZ, are linked using short peptides RIDD and RIAD, respectively.

[0015] Preferably, CrtW is linked to the short peptide RIAD and CrtZ is linked to the short peptide RIDD.

[0016] As a preferred embodiment, the key enzymes CrtW and CrtZ for astaxanthin synthesis are linked using five different linkers.

[0017] The Linker can be any one of GGGGGGGGGG, EKGGGEK, GGGEKGGG, or GGGSGGGS.

[0018] EKGGGEK is preferred.

[0019] More preferably, the Linker is connected to CrtW and CrtZ in the manner of CrtW-EKGGGEK-CrtZ.

[0020] In a preferred embodiment, the hemoglobin VHb that increases cellular oxygen uptake capacity is introduced into the intB site of the Yersinia lipolytica genome, and its nucleotide sequence is shown in SEQ ID No: 7.

[0021] The method for constructing the above-mentioned recombinant Yersinia lipophila strain includes:

[0022] Using BB3-intB as the vector plasmid, recombinant plasmids CrtI, CrtE, CrtYB, tHMGR, CrtW, and CrtZ were constructed. The recombinant plasmids were integrated into the intB site of the po1f genome to obtain the Yersinia lipophila strain Yl-A that produces astaxanthin through cytoplasmic engineering.

[0023] Using BB3-intB as a vector, recombinant plasmids CrtI, CrtE, CrtYB, tHMGR, CrtW-RIDD, and CrtZ-RIAD were constructed. The recombinant plasmids were integrated into the intB site of the po1f genome to obtain the Yl-ADA strain of Yersinia lipolytica that produces astaxanthin through cytoplasmic engineering.

[0024] Using BB3-intB as a vector, recombinant plasmids CrtI, CrtE, CrtYB, tHMGR, CrtW-RIAD, and CrtZ-RIDD were constructed. The recombinant plasmids were integrated into the intB site of the po1f genome to obtain the Yersinia lipophila strain Yl-AAD, which is used for cytoplasmic engineering to produce astaxanthin.

[0025] Using BB3-intB as a vector, recombinant plasmids CrtI, CrtE, CrtYB, tHMGR, and CrtW-GGGGGGGGGG-CrtZ were constructed. The recombinant plasmids were integrated into the intB site of the po1f genome to obtain the Yersinia lipolytica strain Yl-AL1, which is used for cytoplasmic engineering to produce astaxanthin.

[0026] Using BB3-intB as a vector, recombinant plasmids CrtI, CrtE, CrtYB, tHMGR, and CrtW-EKGGGEK-CrtZ were constructed. The recombinant plasmids were integrated into the intB site of the po1f genome to obtain the Yersinia lipophila strain Yl-AL2, which is used for cytoplasmic engineering to produce astaxanthin.

[0027] Using BB3-intB as a vector, recombinant plasmids CrtI, CrtE, CrtYB, tHMGR, and CrtW-GGGEKGGG-CrtZ were constructed. The recombinant plasmids were integrated into the intB site of the po1f genome to obtain the Yersinia lipophila strain Yl-AL3, which is used for cytoplasmic engineering to produce astaxanthin.

[0028] Using BB3-intB as a vector, recombinant plasmids CrtI, CrtE, CrtYB, tHMGR, and CrtW-GGGSGGGS-CrtZ were constructed. The recombinant plasmids were integrated into the intB site of the po1f genome to obtain the Yersinia lipophila strain Yl-AL4, which is used for cytoplasmic engineering to produce astaxanthin.

[0029] Using BB3-intB as a vector, recombinant plasmids CrtI, CrtE, CrtYB, tHMGR, and CrtW-GGGGSGGPGS-CrtZ were constructed. The recombinant plasmids were integrated into the intB site of the po1f genome to obtain the Yersinia lipolytica strain Yl-AL5, which is used for cytoplasmic engineering to produce astaxanthin.

[0030] Using BB3-intB as a vector, recombinant plasmids CrtI, CrtE, CrtYB, tHMGR, and CrtZ-GGGGGGGGGG-CrtW were constructed. The recombinant plasmids were integrated into the intB site of the po1f genome to obtain the Yersinia lipolytica strain Yl-AL6, which is used for cytoplasmic engineering to produce astaxanthin.

[0031] Using BB3-intB as a vector, recombinant plasmids CrtI, CrtE, CrtYB, tHMGR, and CrtZ-EKGGGEK-CrtW were constructed. The recombinant plasmids were integrated into the intB site of the po1f genome to obtain the Yersinia lipophila strain Yl-AL7, which is used for cytoplasmic engineering to produce astaxanthin.

[0032] Using BB3-intB as a vector, recombinant plasmids CrtI, CrtE, CrtYB, tHMGR, and CrtZ-GGGEKGGG-CrtW were constructed. The recombinant plasmids were integrated into the intB site of the po1f genome to obtain the Yersinia lipolyticis strain Yl-AL8, which is used for cytoplasmic engineering to produce astaxanthin.

[0033] Using BB3-intB as a vector, recombinant plasmids CrtI, CrtE, CrtYB, tHMGR, and CrtZ-GGGSGGGS-CrtW were constructed. The recombinant plasmids were integrated into the intB site of the po1f genome to obtain the Yersinia lipophila strain Yl-AL9, which is used for cytoplasmic engineering to produce astaxanthin.

[0034] Using BB3-intB as a vector, recombinant plasmids CrtI, CrtE, CrtYB, tHMGR, and CrtZ-GGGGSGGPGS-CrtW were constructed. The recombinant plasmids were integrated into the intB site of the po1f genome to obtain the Yersinia lipophila strain Yl-AL10 for cytoplasmic engineering production of astaxanthin.

[0035] Using BB3-intB as a vector, recombinant plasmids CrtI, CrtE, CrtYB, tHMGR, CrtW-EKGGGEK-CrtZ, and VHb were constructed. The recombinant plasmids were integrated into the intB site of the po1f genome to obtain the Yersinia lipolytica strain Yl-AL2V, which is used for cytoplasmic engineering to produce astaxanthin.

[0036] The application of the above-mentioned recombinant Yersinia lipolyticis strain in the synthesis of the natural product astaxanthin.

[0037] The applications include:

[0038] (1) The recombinant Yersinia lipolyticis strain constructed above was cultured on a nutrient medium to obtain the fermentation product;

[0039] (2) The fermentation product was extracted with dimethyl sulfoxide and ethanol to obtain astaxanthin.

[0040] The culture medium uses glucose as the carbon source.

[0041] More preferably, the culture medium consists of 5-40 g / L glucose, 20 g / L tryptone, and 10 g / L yeast extract.

[0042] In a preferred embodiment, the fermentation culture uses glucose as the carbon source.

[0043] More preferably, a batch feeding fermentation method can be adopted, with the initial glucose concentration in the fermenter being 40 g / L. When the glucose is about to be exhausted, glucose is added to maintain the glucose concentration in the fermenter below 5 g / L.

[0044] Beneficial effects:

[0045] The recombinant *Yersinia lipolytica* strain of this invention enables de novo synthesis of astaxanthin from glucose, achieving efficient synthesis of the natural product astaxanthin in *Yersinia lipolytica*. Furthermore, this invention constructs a complete astaxanthin synthesis pathway within *Yersinia lipolytica*, enabling de novo astaxanthin synthesis. Subsequently, based on a fusion protein, the key astaxanthin synthesis enzymes CrtW and CrtZ are linked by short peptides or linkers to reduce the transport distance of intermediate metabolites, thereby reducing the accumulation of the intermediate metabolite β-carotene and better promoting astaxanthin synthesis. Subsequently, expression of hemoglobin VHb derived from *Oscillatoria hygroscopica* significantly promotes dissolved oxygen levels in *Yersinia lipolytica*, thereby increasing its biomass, which has a positive effect on astaxanthin, an intracellular product. Finally, through shake-flask fermentation, the Yl-AL2V strain achieved 340.29 mg / L of astaxanthin using glucose, and simultaneously achieved 2.85 g / L of astaxanthin in a 5 L fermenter, with a content of 25.96 mg / g. Attached Figure Description

[0046] Figure 1 The diagram shows the structure of plasmid BB3-intB-IEYBtW-RIDD-Z-RIAD, which carries URA3 as a selection marker for Yersinia lipophila.

[0047] Figure 2 The diagram shows the structure of plasmid BB3-intB-IEYBtW-RIAD-Z-RIDD, which carries URA3 as a selection marker for Yersinia lipophila.

[0048] Figure 3 The diagram shows the structure of plasmid BB3-intB-IEYBtW-Linker-Z, which carries URA3 as a selection marker for Yersinia lipophila.

[0049] Figure 4 The diagram shows the structure of plasmid BB3-intB-IEYBtZ-Linker-W, which carries URA3 as a selection marker for Yersinia lipophila.

[0050] Figure 5 The graph shows the yield of astaxanthin produced by engineered strains Yl-A, Yl-ADA, Yl-AAD, Yl-AL1, Yl-AL2, Yl-AL3, Yl-AL4, Yl-AL5, Yl-AL6, Yl-AL7, Yl-AL8, Yl-AL9, and Yl-AL10 using glucose as a carbon source.

[0051] Figure 6 OD2 of engineered strains Yl-AL2 and Yl-AL2V using glucose as a carbon source 600 A graph showing the production volume of astaxanthin.

[0052] Figure 7The graph shows the yield of astaxanthin produced by the engineered strain Yl-AL2V in a 5 L fermenter using glucose as a carbon source. Detailed Implementation

[0053] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0054] The original strain used in the examples was *Yarrowia lipolytica* po1f. *Yarrowia lipolytica* po1f is commercially available.

[0055] In this embodiment, the extraction and quantitative analysis steps of astaxanthin are as follows:

[0056] 1. Extraction of astaxanthin

[0057] (1) Take 1 mL of the mixed fermentation broth and centrifuge at 12000 rpm for 5 min (wash twice with pure water).

[0058] (2) After draining the water, resuspend the contents in 2 mL of dimethyl sulfoxide (DMSO) (preheated at 60℃) and shake evenly on a vortex mixer. Then place it in a 55℃ water bath for 15 min.

[0059] (3) Add 4 mL of anhydrous ethanol.

[0060] (4) Centrifuge the sample at 12,000 rpm for 5 min. Transfer the supernatant to a new centrifuge tube and store it away from light.

[0061] 2. Quantitative analysis of astaxanthin: High performance liquid chromatography was used to detect the concentration of astaxanthin.

[0062] The liquid chromatograph used in this study was an Agilent Technologies 1200 Infinity series; the column was an Acclaim™ 120 C30 column; the UV absorption wavelength was 450 nm; the mobile phase was methanol and methyl tert-butyl ether; the flow rate was controlled at 1.0 mL / min; and the column temperature was 25℃.

[0063] Example 1: Amplification of Gene Elements and Preparation of Target Plasmids

[0064] Based on the nucleotide sequences of the geranylgeranyl diphosphate synthase gene crtE, the phytoene synthase / lycopene cyclase gene crtYB, and the phytoene desaturase gene crtI from X. denrorhous provided on NCBI, the gene sequences shown in SEQ ID No: 1, SEQ ID No: 2, and SEQ ID No: 3 were obtained after codon optimization. The optimized gene codons resulted in better compatibility between the exogenous gene and the chassis of Yersinia lipolytica.

[0065] Based on the coding gene sequence of 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase tHMGR from Saccharomyces cerevisiae provided on NCBI, PCR amplification was performed using the Saccharomyces cerevisiae genome as a template. The gene sequence of tHMGR is shown in SEQ ID No: 4.

[0066] Based on the nucleotide sequences of β-carotene ketolase CrtW and β-carotene hydroxylase CrtZ from H. pluvialis provided on NCBI, the gene sequences shown in SEQ ID No: 5 and SEQ ID No: 6 were obtained after codon optimization. The optimized gene codons made the exogenous gene more compatible with the chassis of Yersinia lipolytica.

[0067] Based on the nucleotide sequence of the hemoglobin gene VHb from *Vibrio hygroscopicus* provided on NCBI, the gene sequence shown in SEQ ID No: 7 was obtained after codon optimization. The optimized gene codons resulted in better compatibility between the exogenous gene and the chassis of *Yarrowia lipolytica*.

[0068] (II) Construction of recombinant plasmids

[0069] 1. The recombinant plasmids BB1-23-CrtI, BB1-23-CrtE, and BB1-23-CrtYB were constructed by Genscript Biotech Inc., which synthesized the crtI, crtE, and crtYB gene sequences. The recombinant plasmid BB1-23-tHMGR was amplified by PCR using the Saccharomyces cerevisiae genome as a template to obtain the tHMGR gene sequence. Each gene fragment was inserted into plasmid BB1-23 using the Goldengate method to obtain the recombinant plasmids BB1-23-CrtI, BB1-23-CrtE, BB1-23-CrtYB, and BB1-23-tHMGR.

[0070] Using crtI-F and crtI-R as primers and the crtI gene sequence as a template, the crtI fragment was amplified. The primer sequences are shown in Table 1.

[0071] Using crtE-F and crtE-R as primers and the crtE gene sequence as a template, the crtE fragment was amplified. The primer sequences are shown in Table 1.

[0072] Using crtYB-F and crtYB-R as primers and the crtYB gene sequence as a template, the crtYB fragment was amplified. The primer sequences are shown in Table 1.

[0073] Using tHMGR-F and tHMGR-R as primers and the Saccharomyces cerevisiae gene sequence as a template, the tHMGR fragment was amplified. The primer sequences are shown in Table 1.

[0074] Using CrtW-F and CrtW-R as primers and the crtW gene sequence as a template, the crtW fragment was amplified. The primer sequences are shown in Table 1.

[0075] Using CrtZ-F and CrtZ-R as primers and the crtZ gene sequence as a template, the crtZ fragment was amplified. The primer sequences are shown in Table 1.

[0076] Using VHb-F and VHb-R as primers and the VHb gene sequence as a template, the VHb fragment was amplified. The primer sequences are shown in Table 1.

[0077] The amplified crtI, crtE, crtYB, tHMGR, crtW, crtZ, and VHb fragments were recovered and purified by agarose gel electrophoresis.

[0078] GoldenGate assembly was performed using Bsa1 enzyme and T4 ligase from Shanghai Beyotime Biotechnology Co., Ltd. The circular recombinant vector was transformed into *E. coli* DH5α competent cells. Positive recombinant plasmids BB1-23-CrtI, BB1-23-CrtE, BB1-23-CrtYB, BB1-23-tHMGR, BB1-23-CrtW, BB1-23-CrtZ, and BB1-23-VHb were obtained through kanamycin sulfate resistance plate screening and colony PCR and sequencing verification.

[0079] 2. The recombinant plasmid BB2-AB-pGPM1-CrtI-ScCYC1tt was obtained by inserting plasmid BB1-23-CrtI, plasmid BB1-12-pGPM1, and plasmid BB1-34-ScCYC1tt into plasmid BB2-AB using the GoldenGate method with Bpi1 enzyme and T4 ligase. The recombinant plasmid BB2-BC-pPDC1-CrtE-RPP1Btt was obtained by inserting plasmid BB1-23-CrtE, plasmid BB1-12-pPDC1, and plasmid BB1-34-R into plasmid BB2-AB. PP1Btt was inserted into plasmid BB2-BC using the Goldengate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB2-BC-pPDC1-CrtE-RPP1Btt; the recombinant plasmid BB2-CD-pMDH3-CrtYB-RPS2tt was obtained by inserting plasmid BB1-23-CrtYB, plasmid BB1-12-pMDH3, and plasmid BB1-34-RPS2tt into plasmid BB2-CD using the Goldengate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB2-CD-pMDH3-CrtYB-RPS2tt. t; Recombinant plasmid BB2-DE-pADH2-tHMGR-RPL2Att is obtained by inserting plasmid BB1-23-tHMGR, plasmid BB1-12-pADH2, and plasmid BB1-34-RPL2Att into plasmid BB2-DE using the GoldenGate method with Bpi1 enzyme and T4 ligase. Recombinant plasmid BB2-EF-pTEF1-CrtW-IDP1tt is obtained by inserting plasmid BB1-23-CrtW, plasmid BB1-12-pTEF1, and plasmid BB1-34-RPL2Att into plasmid BB2-DE using the GoldenGate method with Bpi1 enzyme and T4 ligase. IDP1tt was inserted into plasmid BB2-EF using the GoldenGate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB2-EF-pTEF1-CrtW-IDP1tt; the recombinant plasmid BB2-FG-pGAP-CrtZ-RPS25Att was obtained by inserting plasmid BB1-23-CrtZ, plasmid BB1-12-pGAP, and plasmid BB1-34-RPS25Att into plasmid BB2-AB using the GoldenGate method with Bpi1 enzyme and T4 ligase.The recombinant plasmid BB2-GH-pGAP-VHb-RPS25Att was obtained by inserting plasmids BB1-23-VHb, BB1-12-pGAP, and BB1-34-RPS25Att into plasmid BB2-GH using the GoldenGate method with Bpi1 enzyme and T4 ligase, resulting in plasmid BB2-FG-pGAP-VHb-RPS25Att.

[0080] 3. The construction process of recombinant plasmid BB3-intB-IEYBtWZ is as follows:

[0081] The recombinant plasmid BB3-intB-IEYBtWZ was constructed by inserting plasmids BB2-AB-pGPM1-CrtI-ScCYC1tt, BB2-BC-pPDC1-CrtE-RPP1Btt, BB2-CD-pMDH3-CrtYB-RPS2tt, BB2-DE-pADH2-tHMGR-RPL2Att, BB2-EF-pTEF1-CrtW-IDP1tt, and BB2-FG-pGAP-CrtZ-RPS25Att into plasmid BB3-A6-intB using the GoldenGate method with Bsa1 enzyme and T4 ligase to obtain plasmid BB3-intB-IEYBtWZ, thus completing the construction of the recombinant plasmid BB3-intB-IEYBtWZ.

[0082] Recombinant plasmids BB3-intB-IEYBtW-RIDD-Z-RIAD, BB3-intB-IEYBtW-RIAD-Z-RIDD, BB3-intB-IEYBtW-GGGGGGGGGG-Z, BB3-intB -IEYBtW-EKGGGEK-Z, BB3-intB-IEYBtW-GGGEKGGG-Z, BB3-intB-IEYBtW-GGGSGGGS-Z, BB3-intB-IEYBtW-GGGGSGGPGS The construction process of -Z, BB3-intB-IEYBtZ-GGGGGGGGGG-W, BB3-intB-IEYBtZ-EKGGGEK-W, BB3-intB-IEYBtZ-GGGEKGGG-W, BB3-intB-IEYBtZ-GGGSGGGS-W, BB3-intB-IEYBtZ-GGGGSGGPGS-W, and BB3-intB-IEYBtW-EKGGGEK-Z-VHb is the same as that of BB3-intB-IEYBtWZ.

[0083] Table 1 Primer List

[0084] Primer Name Sequence (5’—3’) crtI-F GCATGCATGCATGGTCTCCCATGACTGCTTTGGCCTA crtI-R GGTCTCGAAGCTTACTGACCCTCCCAACC crtE-F GGTCTCCCATGGGCAAAGAGAAGGA crtE-R GGTCTCAAAGCGAATTCTTAGAAGG crtYB-F GGTCTCCCATGGACTACGCCAACAT crtYB-R GGTCTCGAAGCTTACAGTGGGATGT tHMGR-F GGTCTCCCATGGACCAATTGGTGAA tHMGR-R GGTCTCGAAGCTTAGGATTTAATGC CrtW-F GGTCTCCCATGCATGTGGCCTCAGCTC CrtW-R GGTCTCGAAGCTCATGCAAGAGCGGGCACCAA CrtZ-F GGTCTCCCATGCTGTCCAAGCTGCAGAG CrtZ-R GGTCTCGAAGCTCACCGTTTCGACCAGTCCAGC VHb-F GGTCTCCCATGCTGGACCAACAGAC VHb-R GGTCTCGAAGCTCACTCAACGGCCTGC

[0085] Example 2 Construction of recombinant bacteria

[0086] 1. Construction of recombinant strain Yl-A

[0087] The plasmid BB3-A6-intB-IEYBtWZ containing the CrtI-CrtE-CrtYB-tHMGR-CrtW-CrtZ gene expression cassette was introduced into Yersinia lipolytica po1f. The CrtI-CrtE-CrtYB-tHMGR-CrtW-CrtZ expression cassette was integrated into the intB site of the genome, resulting in the recombinant strain Yl-A.

[0088] The specific method is as follows:

[0089] ① Competent cells were prepared by overnight culture of the original Yersinia lipolytica in YPD liquid medium (containing 2% peptone, 1% yeast extract and 2% glucose).

[0090] ② Linearized BB3-A6-intB-IEYBtWZ was introduced into competent cells of Yeast lipolyticis using the Zymogen Frozen EZYeast Transformation Kit II from Zymo Research Corporation for homologous recombination.

[0091] ③ Using the selection medium SD-Leu, single colonies grew in 3-4 days. Positive clones identified correctly by PCR were named recombinant bacteria Yl-A. The selection medium SD-Leu contained: glucose 20 g / L, Tris ethanesulfonic acid 2.26 g / L, ammonium sulfate 3 g / L, trace elements 1 ml / L, 100× salt solution 10 ml / L, and agar powder 25 g / L.

[0092] 2. Construction of recombinant bacteria Yl-ADA, Yl-AAD, Yl-AL1, Yl-AL2, Yl-AL3, Yl-AL4, Yl-AL5, Yl-AL6, Yl-AL7, Yl-AL8, Yl-AL9, Yl-AL10, Yl-AL2V

[0093] Linearized plasmids BB3-intB-IEYBtW-RIDD-Z-RIAD, BB3-intB-IEYBtW-RIAD-Z-RIDD, BB3-intB-IEYBtW-GGGGGGGGGG-Z, BB3-intB-IEYBtW-EKGGGEK-Z, BB3 -intB-IEYBtW-GGGEKGGG-Z, BB3-intB-IEYBtW-GGGSGGGS-Z, BB3-intB-IEYBtW-GGGGSGGPGS-Z, BB3-intB-IEYBtZ-GGGGGGGGGG-W, BB3-intB-IE YBtZ-EKGGGEK-W, BB3-intB-IEYBtZ-GGGEKGGG-W, BB3-intB-IEYBtZ-GGGSGGGS-W, BB3-intB-IEYBtZ-GGGGSGGPGS-W, and BB3-intB-IEYBtW-EKGGGEK-Z-VHb were introduced into *Yersinia lipolyticis* po1f to obtain recombinant strains Yl-ADA, Yl-AAD, Yl-AL1, Yl-AL2, Yl-AL3, Yl-AL4, Yl-AL5, Yl-AL6, Yl-AL7, Yl-AL8, Yl-AL9, Yl-AL10, and Yl-AL2V. The specific construction process is the same as that of Yl-A.

[0094] Example 3: Application of recombinant bacteria in astaxanthin production

[0095] The engineered bacteria were cultured using the recombinant bacteria YL-A, Yl-ADA, Yl-AAD, Yl-AL1, Yl-AL2, Yl-AL3, Yl-AL4, Yl-AL5, Yl-AL6, Yl-AL7, Yl-AL8, Yl-AL9, Yl-AL10, and Yl-AL2V from Example 2 to produce astaxanthin.

[0096] The specific method is as follows: Take the strain from the seed preservation tube, inoculate it into the YPD test tube with a 1% inoculation amount, and culture it at 30℃ for 24 hours to obtain the seed liquid;

[0097] The seed culture was inoculated at a rate of 1% into 50 mL of fermentation medium (40 g / L glucose, 10 g / L yeast extract, and 20 g / L tryptone). The culture was incubated at 25℃ with shaking at 220 rpm for 5 days, with 4 mL of 40 g / L glucose added every 24 h. After 120 h of fermentation, the astaxanthin yields of the recombinant strains YL-A, Yl-ADA, Yl-AAD, Yl-AL1, Yl-AL2, Yl-AL3, Yl-AL4, Yl-AL5, Yl-AL6, Yl-AL7, Yl-AL8, Yl-AL9, and Yl-AL10 were 144.8 mg / L, 160.85 mg / L, 162.56 mg / L, 206.77 mg / L, 310.73 mg / L, 236.25 mg / L, 272.47 mg / L, and 269.90 mg / L, respectively. mg / L, 233.86 mg / L, 207.89 mg / L, 217.08 mg / L, 197.84 mg / L, 205.09 mg / L ( Figure 5 This indicates that fusion expression of key enzymes in astaxanthin synthesis can shorten the transport distance of intermediate metabolites and enhance the catalytic efficiency of the enzymes.

[0098] Astaxanthin, as an intracellular product, benefits from increased cell biomass, which plays a positive role in its accumulation. The conversion of β-carotene to astaxanthin also requires oxygen. Therefore, we selected hemoglobin VHb from *Oxidobryophyte* to increase dissolved oxygen in the cells and thus increase yeast cell biomass. After expressing VHb, the engineered strain Yl-AL2V achieved an astaxanthin yield of 340.29 m³ / L (…). Figure 6 ).

[0099] Example 4: High-density fermentation production of astaxanthin using recombinant strain Yl-AL2V

[0100] ① Seed culture:

[0101] a. Primary seed culture: Take 1% of the recombinant strain Yl-AL2V bacterial culture from the cryopreservation tube and inoculate it into YPD test tubes. Incubate at 30°C and 200 rpm for 24 hours to obtain the primary seed culture. The YPD medium contains 2% peptone, 1% yeast extract and 2% glucose.

[0102] b. Secondary seed culture: Take the primary seed culture and inoculate it into a new seed culture medium at an inoculation rate of 10%, and culture it at a constant temperature under the same conditions as a to obtain the seed culture for fermentation culture.

[0103] ② Batch feeding fermentation

[0104] The seed culture obtained from seed culture was inoculated into a 5 L fermenter containing fermentation medium (40 g / L glucose, 20 g / L peptone, 10 g / L yeast extract). Recombinant strain Yl-AL2V underwent fed-batch fermentation in the 5 L fermenter at 30℃, 500 rpm, and dissolved oxygen maintained at 40%. The initial glucose concentration in the fermenter was 40 g / L. When the glucose was nearly depleted, glucose was added continuously to maintain the glucose concentration below 5 g / L. Samples were taken every 12 h to determine cell dry weight, and astaxanthin was extracted from the fermentation broth to determine its content. After 7 days of fermentation, the cell OD... 600 The concentration reached 297.16, and the astaxanthin yield reached 2.85 g / L, with a content of 25.96 mg / g. Figure 7 ).

[0105] This invention constructs a complete astaxanthin synthesis pathway in *Yarrowia lipolytica*, enabling de novo astaxanthin synthesis. Subsequently, key enzymes in astaxanthin synthesis are self-assembled or expressed as fusion proteins to reduce substrate transport distances, enhance the conversion efficiency of β-carotene to astaxanthin, and reduce the accumulation of intermediate metabolites. Furthermore, to increase intracellular dissolved oxygen levels, hemoglobin derived from *Oscillatoria hygroscopica* is expressed to improve cellular oxygen uptake and thus increase cell biomass. Finally, scale-up cultivation is conducted in a 5 L fermenter, and the production capacity of the strain is comprehensively evaluated by measuring the OD500 of the recombinant strain in the fermenter. 600 The monitoring of astaxanthin production is expected to further increase astaxanthin yield in larger fermentation tanks, laying the foundation for subsequent industrialization.

Claims

1. A recombinant Yersinia lipolyticis strain that produces astaxanthin, characterized in that, The recombinant Yersinia lipolytica strain was obtained by expressing geraniol-geraniol diphosphate synthase CrtE, phytoene synthase / lycopene cyclase CrtYB, and phytoene desaturase CrtI from Pharbitis rubescens, 3-hydroxy-3-methylglutaryl-CoA reductase tHMGR from Saccharomyces cerevisiae, and β-carotene ketolase CrtW and β-carotene hydroxylase CrtZ from Haematococcus pluvialis in a host strain; the nucleotide sequences are shown in SEQ ID No: 1-6, respectively.

2. The recombinant Yersinia lipolyticis strain for producing astaxanthin according to claim 1, characterized in that, CrtW and CrtZ were linked using short peptides RIDD and RIAD.

3. The recombinant Yersinia lipolyticis strain for producing astaxanthin according to claim 1, characterized in that, Connect CrtW and CrtZ using a Linker.

4. The recombinant Yersinia lipolyticis strain for producing astaxanthin according to claim 3, characterized in that, The nucleotide sequence of Vibrio hygroscopicus hemoglobin VHb is shown in SEQ ID No:

7.

5. The recombinant Yersinia lipolyticis strain for producing astaxanthin according to claim 1, characterized in that, The starting strain of *Yersinia lipolytica* is *Yersinia lipolytica* (…). Yarrowia lipolytca )po1f.

6. The recombinant lipophilic yeast strain for producing astaxanthin according to claim 3, characterized in that, The Linker can be any one of GGGGGGGGGG, EKGGGEK, GGGEKGGG, or GGGSGGGS.

7. The recombinant lipophilic yeast strain for producing astaxanthin according to claim 3, characterized in that, The CrtW is linked to the short peptide RIAD and the CrtZ is linked to the short peptide RIDD.

8. The recombinant Yersinia lipolyticis strain for producing astaxanthin according to claim 6, characterized in that, The Linker is EKGGGEK, and its connection with CrtW and CrtZ is CrtW-EKGGGEK-CrtZ.

9. The application of the recombinant Yersinia lipophila strain according to any one of claims 1-8 in the production of astaxanthin.

10. The application according to claim 9, characterized in that, Recombinant Yersinia lipolyticis strain was cultured on a nutrient medium to obtain fermentation products, from which astaxanthin was isolated.