Application of a biological material for enhancing expression of DaMYB48 in resisting anthracnose

Abstract

The present application belongs to the technical field of Dioscorea alata Blume anthracnose prevention and treatment, and particularly relates to application of a biological agent material for enhancing expression of DaMYB48 in resisting anthracnose. The application of the biological agent material for enhancing expression of DaMYB48 in resisting anthracnose is characterized in that the nucleotide sequence of DaMYB48 is shown as SEQ ID NO. 3. The expression of DaMYB48 is enhanced to enhance the resistance of the plant to anthracnose. The application of the agent for enhancing expression of DaMYB48 in resisting anthracnose of Dioscorea alata Blume can significantly enhance the resistance of the plant to anthracnose, and the area of the disease spot is significantly reduced, and the prevention and treatment effect is stable. The material used in the present application is a biological material, and will not pollute the environment. On the other hand, the present application reduces the invasion of anthracnose by regulating the closure of stomata of leaves, belongs to physical action, and thus will not cause the anthracnose pathogen to produce drug resistance.

Description

Technical Field

[0001] This invention belongs to the field of anthracnose prevention and control technology, specifically relating to the application of a biological agent material that enhances DaMYB48 expression in anthracnose control. Background Technology

[0002] Dioscorea opposita is an important tropical crop belonging to the Dioscoreaceae family and the Dioscorea genus. Its tubers are rich in starch, polysaccharides, proteins, vitamins, minerals, and various bioactive substances, serving as a food, vegetable, and medicinal ingredient. However, anthracnose is the leading fungal disease in the large-scale cultivation of Dioscorea opposita. It is characterized by a short incubation period, rapid spread, and frequent reinfection. Once an outbreak occurs in the field, the leaf spot rate can exceed 60% within 7 days, leading to a sharp reduction in photosynthetic area and hindering starch accumulation in tubers. This generally results in a yield reduction of 20% to 40%, and in severe cases, complete crop failure, becoming a bottleneck restricting the improvement of Dioscorea opposita yield and quality.

[0003] MYB transcription factors are one of the largest families of transcription factors in plants. A key characteristic is the presence of a conserved MYB domain at the N-terminus, which may specifically bind to MBS elements in the promoters of target genes, thereby regulating the expression of downstream target genes. Currently, the specific disease resistance functions of MYB transcription factors in sweet potato, particularly DaMYB48, remain unclear.

[0004] Currently, the control of anthracnose in sweet potatoes still mainly relies on agricultural and chemical control methods. Agricultural control includes measures such as selecting disease-free seed potatoes, implementing crop rotation for more than three years, reasonable planting density, increasing the application of well-rotted organic fertilizer, timely removal of diseased plant debris from the field, and constructing drainage ditches to reduce field humidity. These measures can reduce the incidence of disease to some extent, but their effectiveness is unstable due to limitations imposed by climate, cultivation habits, and labor costs. The long-term, high-frequency use of chemical control agents not only leads to the development of drug resistance in the anthracnose pathogen but also causes soil microecological imbalance, seriously affecting exports and consumer health. Therefore, existing anthracnose control technologies for sweet potatoes suffer from unstable control effects and the development of drug-resistant anthracnose pathogens. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides the application of a biological agent material that enhances DaMYB48 expression in the treatment of anthrax.

[0006] To facilitate understanding of this invention, the materials used in this invention and their abbreviations are listed below:

[0007] Abscisic acid, abbreviated as ABA.

[0008] The purpose of this invention is to provide the application of a biological agent material that enhances the expression of DaMYB48 in the treatment of anthracnose, wherein the nucleotide sequence of DaMYB48 is shown in SEQ ID NO.3. Enhancing the expression of DaMYB48 improves the plant's resistance to anthracnose. Overexpression of DaMYB48 causes stomata on plant leaves to close, blocking the invasion of anthracnose pathogens and increasing the plant's resistance to anthracnose infection.

[0009] Preferably, the biopharmaceutical material comprises a recombinant plasmid containing the nucleotide sequence shown in SEQ ID NO.3.

[0010] The nucleotide sequence of SEQ ID NO.3 is as follows:

[0011] ATGTCCCCTCAAGAAGAACGTCTTGTTCTTGAACTCCACTCTCACTGGGGCAATAGATGGTCTCGAATAGCTAGAAGACTACCTGGTCGCACTGATAATGAGATTAAGAATTACTGGAGGACTCATATGAGGAAGAAGGCACAAGAAAGAAAGAAAAACTTGGCTGGAGAAACTAGTACTGCTAGTGTTTGTACTAGTACTAGTACTACAACTGCTGATGCAAGTACTACT GATAATATTACTGCTACTACTGCTACTTTGACAGAAGGTTTTGAAGATGAAATGGAAGGGTATCCAATTGATAAGATTTGGAATGAGTTATCTTGTGATGCTTCACCTGTTTTGGATTGTACTACTTGCTCTAGTTCTGATGAACTTTGGAATTTGGATGATGAAGAGGAATTATTACCCAACTCCATGAGTGATTGTTTGGTTCCTGCTCTGTATCAACAACATAGCTAG.

[0012] Preferably, the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NO.6.

[0013] The nucleotide sequence of SEQ ID NO.6 is as follows:

[0014] tagtctagaaagcttctgcagATGTCCCCTCAAGAAGAACGTCTTGTTCTTGAACTCCACTCTCACTGGGGCAATAGATGGTCTCGAATAGCTAGAAGACTACCTGGTCGCACTGATAATGAGATTAAGAATTACTGGAGGACTCATATGAGGAAGAAGGCACAAGAAAGAAAGAAAAACTTGGCTGGAGAAACTAGTACTGCTAGTGTTTGTACTAGTACTAGTACTACAACTGCTGATGCAAGTACTACT GATAATATTACTGCTACTACTGCTACTTTGACAGAAGGTTTTGAAGATGAAATGGAAGGGTATCCAATTGATAAGATTTGGAATGAGTTATCTTGTGATGCTTCACCTGTTTTGGATTGTACTACT TGCTCTAGTTCTGATGAACTTTGGAATTTGGATGATGAAGAGGAATTATTACCCAACTCCATGAGTGATTGTTTGGTTCCTGCTCTGTATCAACAACATAGCTAGggtaccatggtgagcaagggc.

[0015] Preferably, the method for constructing the recombinant plasmid includes the following steps:

[0016] The SEQ ID NO.3 was amplified using primers 1300_MYB48_F and 1300_MYB48_R to obtain a nucleotide fragment with a PstI restriction site and the first 15 bp homologous arm of the super1300GFP-C vector at the 5′ end, and a KpnI restriction site and the last 15 bp homologous arm of the super1300GFP-C vector at the 3′ end. The nucleotide fragment was then accurately ligated to the super1300GFP-C linearized vector that had been double-digested with PstI and KpnI through homologous recombination to obtain the recombinant plasmid.

[0017] Preferably, the design method for 1300_MYB48_F and 1300_MYB48_R is as follows: Primers containing homologous arms of the super1300GFP-C vector are designed, and PstI and KpnI restriction sites are selected. The 1300_MYB48_F primer uses the vector's PstI restriction site and its first 15 bp cloning primer; the 1300_MYB48_R primer uses the vector's KpnI restriction site and its last 15 bp cloning primer. The nucleotide sequence of 1300_MYB48_F is shown in SEQ ID NO. 4; the nucleotide sequence of 1300_MYB48_R is shown in SEQ ID NO. 5.

[0018] The nucleotide sequence of SEQ ID NO.4 is as follows:

[0019] TAGTCTAGAAAGCTTCTGCAGATGTCCCCTCAAGAAGAACGTCT.

[0020] The nucleotide sequence of SEQ ID NO.5 is as follows:

[0021] GCCCTTGCTCACCATGGTACCCTAGCTATGTTGTTGATACAGAGCAGG.

[0022] Preferably, the biological agent material includes recombinant Agrobacterium containing the recombinant plasmid.

[0023] Preferably, the recombinant Agrobacterium is obtained by introducing the recombinant plasmid into Agrobacterium.

[0024] Preferably, the method of importation is freeze-thaw method.

[0025] Preferably, the method for overexpressing DaMYB48 is as follows: the recombinant Agrobacterium is cultured to obtain an infectious bacterial solution, and the infectious bacterial solution is injected into the plant leaves to achieve overexpression of DaMYB48 in the plant.

[0026] Preferably, the plant is yam or tobacco.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] 1. The application of the biological agent material for enhancing DaMYB48 expression in the resistance to anthracnose, wherein the nucleotide sequence of DaMYB48 is shown in SEQ ID NO.3. Overexpression of DaMYB48 enhances the plant's resistance to anthracnose. Overexpression of DaMYB48 increases the ABA content in the plant leaves, causing stomatal closure and reducing the invasion of anthracnose pathogens, thereby improving resistance. The application of the biological agent material for enhancing DaMYB48 expression in the resistance to yam anthracnose significantly enhances the plant's resistance to anthracnose, significantly reduces the lesion area, and provides stable control. The materials used in this invention are biological materials and will not pollute the environment. Furthermore, this invention reduces the invasion of anthracnose by regulating the closure of leaf stomata, which is a physical action and therefore will not cause anthracnose pathogens to develop drug resistance.

[0029] 2. This invention provides a method for obtaining DaMYB48 and verifying the function of related materials in anthracnose resistance, revealing the positive regulatory role of DaMYB48 in the anthracnose resistance of sweet potato, and providing a theoretical basis and gene resource for its application in molecular breeding for disease resistance. This invention is the first to clone and verify the positive regulatory role of DaMYB48 in anthracnose resistance in sweet potato, providing a complete technical route for gene cloning, vector construction, transformation, expression detection, and functional verification, with good reproducibility and application prospects. Attached Figure Description

[0030] Figure 1 This is a clone diagram of DaMYB48 of the present invention.

[0031] Figure 2 This is a diagram showing the expression of DaMYB48 in leaves of the resistant and susceptible potato germplasm infected with anthracnose pathogen.

[0032] Figure 3 This is a subcellular localization diagram of DaMYB48 in tobacco leaves according to the present invention.

[0033] Figure 4 This is a diagram showing the expression of DaMYB48 in tobacco leaves overexpressed with DaMYB48 according to the present invention.

[0034] Figure 5 Phenotypic diagrams of tobacco leaves overexpressing DaMYB48 according to this invention, inoculated with anthracnose pathogen. In the diagram, A represents a leaf from the CK tobacco plant, with the left side of the same leaf inoculated with PDA blank medium and the right side inoculated with Bacillus anthracnose; the two leaves are parallel samples. B represents a leaf from the OE-DaMYB48 tobacco plant, with the left side of the same leaf inoculated with PDA blank medium and the right side inoculated with Bacillus anthracnose; the two leaves are parallel samples.

[0035] Figure 6This is a diagram showing the stomatal state of tobacco leaves overexpressing DaMYB48 according to the present invention. In the diagram, A represents the stomata of the CK leaf of the tobacco plant, and B represents the stomata of the OE-DaMYB48 leaf of the tobacco plant. Detailed Implementation

[0036] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the following detailed description, in conjunction with preferred embodiments and accompanying drawings, provides a clear and complete account of the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0037] It should be noted that all technical terms used in this invention are for the purpose of describing specific embodiments only and are not intended to limit the scope of protection of this invention. Unless otherwise specified, all raw materials, reagents, instruments and equipment used in the following embodiments of this invention can be purchased from the market or prepared by existing methods.

[0038] The main materials used in this invention are: plant RNA extraction kit, reverse transcription kit, and fluorescence quantitative reagent.

[0039] The plant RNA extraction kit was purchased from Nanjing Novizan Biotechnology Co., Ltd., and its product name is Fast Pure Universal Plant Total RNA Isolation Kit. The reverse transcription kit was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., and its product name is Hifair® Ⅲ 1st Strand cDNA Synthesis Kit (gDNA digester plus). The provided fluorescence quantitative reagent was purchased from Beijing Qingke Biotechnology Co., Ltd., and its product name is 2×Universal SYBR qPCR Mix (Blue).

[0040] Example 1

[0041] Cloning the DaMYB48 fragment involves the following steps:

[0042] RNA was extracted from *Dioscorea opposita* leaves using a plant RNA extraction kit. First-strand cDNA was obtained by reverse transcription using the RNA as a template. Nucleotide alignment was performed in the whole *Dioscorea opposita* genome using the *Dioscorea opposita* transcriptome sequence to obtain the cDNA sequence of *Dioscorea opposita* DaMYB48 (Dioal.07G121400). Specific primers MYB48_F and MYB48_R were designed based on this sequence, and *Dioscorea opposita* cDNA was used as a template to amplify *Dioscorea opposita* DaMYB48. The nucleotide sequence of MYB48_F is shown in SEQ ID NO.1. The nucleotide sequence of MYB48_R is shown in SEQ ID NO.2. The nucleotide sequence of *Dioscorea opposita* DaMYB48 is shown in SEQ ID NO.3, consisting of 462 bases. The PCR amplification reaction system is shown in Table 1. The PCR amplification program was: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 10 s, 54℃ annealing for 20 s, 72℃ extension for 30 s, for a total of 30 cycles, with a final extension at 72℃ for 5 min. The PCR product detection results are shown in Table 1. Figure 1 As shown.

[0043] Table 1 PCR amplification reaction system

[0044]

[0045] The nucleotide sequence of SEQ ID NO.1 is: ATGTCCCCTCAAGAAGAACGTCT.

[0046] The nucleotide sequence of SEQ ID NO.2 is: CTAGCTATGTTGTTGATACAGAGCA.

[0047] Example 2

[0048] The expression analysis of DaMYB48 in resistant and susceptible yam germplasm after invasion by the anthracnose pathogen of yam tuber included the following steps:

[0049] 1. Prepare a porcelain dish 40cm long and 60cm wide. Spray the dish with alcohol and then rinse it with sterile water. Spread sterile water-soaked kraft paper evenly on the bottom of the dish to maintain moisture, and place a perforated plastic mesh frame on top. Wipe the surface of the leaves of both disease-resistant and disease-susceptible yam varieties with 75% alcohol. Use a sterile needle to prick five to seven holes on each side of the leaf vein. For the uninoculated control group, use a 5mm diameter punch to take blank culture medium from the blank PDA medium and place it on the left side of the leaf vein wound with a sterilized inoculation needle. For the treatment group, use a 5mm diameter punch to extract anthracnose mycelial blocks from the edge of the colony and place them on the right side of the leaf vein wound in the same leaf. Place cotton balls soaked in 75% alcohol on the left and right culture media respectively to isolate them from external bacteria. Each germplasm sample was repeated three times. Finally, the inoculated leaves were placed on the grid rack in the porcelain dish. After all the leaves were inoculated, plastic wrap was placed on the porcelain dish. The porcelain dishes were then placed in an incubator with a relative humidity of 70% and a temperature of 28°C. After 24 hours of dark and humid treatment, the leaves were cultured under normal light. The cotton balls were removed 24 hours after inoculation. Disease surveys were conducted every other day.

[0050] 2. Leaves from different inoculation sites were collected, and total RNA was extracted from the leaves. The RNA was then reverse transcribed to synthesize first-strand cDNA. Using the first-strand cDNA as a template and the EF-1a gene as an internal reference gene, the expression of DaMYB48 was detected by real-time quantitative PCR.

[0051] The PCR system consisted of 10 µL of a real-time PCR reagent, including: 0.2 µL of 10 µM forward primer, 0.2 µL of 10 µM reverse primer, 300 ng of tobacco leaf cDNA as a template, 5 µL of SYBR® Premix Ex Taq™ II Mix (2X), and RNase-free ddH2O to bring the total to 10 µL.

[0052] The procedure for quantitative real-time PCR amplification is as follows: 95℃ pre-denaturation for 1 min, 95℃ denaturation for 10 s, 60℃ annealing for 30 s, 72℃ extension for 20 s, for a total of 40 cycles.

[0053] The quantitative real-time PCR assay used primer pairs MYB48_F_q and MYB48_R_q to detect the expression of DaMYB48, and primer pairs EF-1a-F and EF-1a-R to detect the expression of the internal reference gene EF-1a. The nucleotide sequence of MYB48_F_q is shown in SEQ ID NO. 7. The nucleotide sequence of MYB48_R_q is shown in SEQ ID NO. 8. The nucleotide sequence of EF-1a-F is shown in SEQ ID NO. 9. The nucleotide sequence of EF-1a-R is shown in SEQ ID NO. 10.

[0054] The nucleotide sequence of SEQ ID NO.7 is: ATGTCCCCTCAAGAAGAACGTC.

[0055] The nucleotide sequence of SEQ ID NO.8 is: CTGTCAAAGTAGCAGTTGTAGCAG.

[0056] The nucleotide sequence of SEQ ID NO.9 is: TCAGGCTGACTGTGCTGTCCT.

[0057] The nucleotide sequence of SEQ ID NO.10 is: GTGGTGGCGTCCATCTTGTT.

[0058] The expression results of DaMYB48 in the leaves of resistant and susceptible yam varieties at 1, 3, and 5 days after infection are as follows: Figure 2 As shown in the figure, "anti-1d" represents the expression level of DaMYB48 in leaves of resistant *Dioscorea opposita* var. *mongolica ...

[0059] Example 3

[0060] Subcellular localization analysis of DaMYB48

[0061] 1. Construction of the recombinant vector 35S::DaMYB48-GFP

[0062] The recombinant vector 35S::DaMYB48-GFP includes an original vector and a target gene fragment. The original vector is the plant green fluorescent protein expression vector pCAMBIA1300-35S::GFP. The target gene fragment is derived from the cDNA of Dioscorea opposita leaves. The target gene fragment is the complete coding sequence of DaMYB48 without a stop codon and with a homologous arm, denoted as DaMYB48-0, and its nucleotide sequence is shown in SEQ ID NO.13.

[0063] The nucleotide sequence of SEQ ID NO.13 is as follows:

[0064] tagtctagaaagcttctgcagATGTCCCCTCAAGAAGAACGTCTTGTTCTTGAACTCCACTCTCACTGGGGCAATAGATGGTCTCGAATAGCTAGAAGACTACCTGGTCGCACTGATAATGAGATTAAGAATTACTGGAGGACTCATATGAGGAAGAAGGCACAAGAAAGAAAGAAAAACTTGGCTGGAGAAACTAGTACTGCTAGTGTTTGTACTAGTACTAGTACTACAACTGCTGATGCAAGTACTAC TGATAATATTACTGCTACTACTGCTACTTTGACAGAAGGTTTTGAAGATGAAATGGAAGGGTATCCAATTGATAAGATTTGGAATGAGTTATCTTGTGATGCTTCACCTGTTTTGGATTGTACTA CTTGCTCTAGTTCTGATGAACTTTGGAATTTGGATGATGAAGAGGAATTATTACCCAACTCCATGAGTGATTGTTTGGTTCCTGCTCTGTATCAACAACATAGCggtaccatggtgagcaagggc.

[0065] The specific construction steps are as follows:

[0066] S1 primer design and gene amplification

[0067] To ensure correct insertion of DaMYB48 into the multiple cloning site of the pCAMBIA1300-35S::GFP vector, specific primers YC_MYB48_F and YC_MYB48_R with specific restriction enzyme sites were designed. The nucleotide sequence of YC_MYB48_F is shown in SEQ ID NO. 11. The nucleotide sequence of YC_MYB48_R is shown in SEQ ID NO. 12.

[0068] The nucleotide sequence of SEQ ID NO.11 is: TAGTCTAGAAAGCTTCTGCAGATGTCCCCTCAAGAAGAACGTCT.

[0069] The nucleotide sequence of SEQ ID NO.12 is: GCCCTTGCTCACCATGGTACCGCTATGTTGTTGATACAGAGCAGG.

[0070] Using the potato cDNA obtained in Example 1 as a template, high-fidelity PCR amplification was performed using the above primers to obtain a DaMYB48 coding region fragment without a stop codon, which has a PstI restriction site at the 5′ end and a homologous arm 15 bp before it, and a Kpn I restriction site 15 bp after it at the 3′ end.

[0071] Double digestion and ligation of S2 vector and fragment

[0072] The empty vector pCAMBIA1300-35S::GFP was double-digested using PstI and KpnI restriction enzymes. After recovery of the digested products by agarose gel electrophoresis, ligation was performed using 2×Hieff Clone® Universal Enzyme Premix at 50°C for 10 min, ligating the DaMYB48 fragment (SEQ ID NO. 13) with homologous arms and lacking a stop codon to the linearized vector, constructing the fusion expression vector pCAMBIA1300-35S::DaMYB48-GFP. pCAMBIA1300-35S::DaMYB48-GFP is abbreviated as 35S::DaMYB48-GFP. In 35S::DaMYB48-GFP, DaMYB48 is correctly fused to the reading frame of the GFP gene, enabling expression of the DaMYB48-GFP fusion protein driven by the 35S promoter.

[0073] 2. Agrobacterium transformation and preparation of infection solution

[0074] 35S::DaMYB48-GFP and the empty vector control 35S::GFP were transformed into Agrobacterium GV3101 competent cells using a freeze-thaw method. The specific method was as follows: 50 μL of Agrobacterium GV3101 competent cells were thawed on ice, 1 μg of the above plasmid DNA was added, and the mixture was gently mixed. The cells were then flash-frozen in liquid nitrogen for 5 min, followed by heat shock at 37°C for 5 min, and then placed on ice for 5 min. 700 μL of antibiotic-free LB broth was added, and the cells were cultured at 28°C with shaking at 200 rpm for 3 h. 100 μL of the bacterial culture was plated onto LB agar plates containing 50 μg / L Kana and 25 μg / L Rif, and incubated upside down at 28°C for 2 days. Single clones were picked for colony PCR identification. Positive clones were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing verification, ultimately obtaining an Agrobacterium engineered strain containing the correct recombinant plasmid.

[0075] Selected positive monoclonal clones and nucleomarker bacterial suspensions that have been verified, and inoculated them into 10 mL of LB liquid medium containing the corresponding antibiotics. The cultures were incubated at 28°C with shaking at 200 rpm until OD500 was reached. 600The concentration was 0.8. Bacterial cells were collected by centrifugation at 5000 rpm for 10 min at room temperature and resuspended in an equal volume of MS infection buffer. The MS infection buffer was prepared with MS, 1 M MES, 0.05 M AS, and 1 M MgCl2, with a pH of 5.6. The resuspended bacterial solution was allowed to stand in the dark at room temperature for 3 h before injection.

[0076] 3. Transient transformation and fluorescence observation of tobacco leaves

[0077] Healthy leaves from 5-week-old *Nicotiana benthamiana* plants were collected. Using a 1mL sterile syringe (needle removed), equal volumes of 35S::DaMYB48-GFP and 35S::GFP were mixed with nuclear marker bacterial solution and injected into the mesophyll tissue from the underside of the leaves. 35S::DaMYB48-GFP served as the experimental group, and 35S::GFP as the control group. The experimental group was designated 35S:DaMYB48, and the control group was designated 35S:GFP. The injected tobacco plants were placed in a light incubator, initially in darkness for 24 hours, followed by 60 hours of normal light. Leaves from the injection area were cut and prepared into temporary slides for observation under a laser confocal microscope. GFP fluorescence was detected using a 488nm laser, and the nuclear marker was detected using a 560nm laser for clear labeling of the cell nucleus. The cell nucleus showed red fluorescence, while DaMYB48 showed green fluorescence. Subcellular localization results are shown below. Figure 3 As shown in the figure. The results indicate that DaMYB48 is located in the cell nucleus.

[0078] Example 4

[0079] Construction of OE-DaMYB48 tobacco overexpression plants includes the following steps:

[0080] 1. Construction of the recombinant vector 1300-DaMYB48

[0081] The entire nucleotide sequence of DaMYB48 was amplified using primers 1300_MYB48_F and 1300_MYB48_R. The sequence contains a PstI restriction site and a first 15 bp homologous arm at the 5' end, and a KpnI restriction site and a last 15 bp homologous arm at the 3' end. Homologous recombination was then used to accurately ligate the nucleotide fragment to the PstI and KpnI-digested linearized super1300GFP-C vector. Specifically, the 5' end of the first position of SEQ ID NO. 6 contains a PstI restriction site and a first 15 bp homologous arm, and the 3' end of the last position of SEQ ID NO. 6 contains a KpnI restriction site and a last 15 bp homologous arm, resulting in the recombinant vector 1300-DaMYB48. The nucleotide sequence of 1300_MYB48_F is shown in SEQ ID NO. 4. The nucleotide sequence of 1300_MYB48_R is shown in SEQ ID NO.5.

[0082] 2. Construction of OE-DaMYB48 overexpressing tobacco plants

[0083] The recombinant vector 1300-DaMYB48 was transformed into Agrobacterium GV3101 using a freeze-thaw method. The specific steps are as follows: 50 μL of EP tubes containing competent Agrobacterium GV3101 cells were pre-thawed on ice. 3 μL of 1300-GFP and 1300-DaMYB48 plasmids at a concentration of 300 ng / μL were added to the competent Agrobacterium cells. The EP tubes were then rapidly immersed in liquid nitrogen for 5 min, removed, and thawed in a 37°C water bath for 5 min, then placed on ice for 5 min. 700 μL of antibiotic-free LB medium was added, and the cells were incubated at 28°C and 200 rpm for 2 h. The culture was then plated on LB solid medium containing 25 μg / mL rifamycin and 50 μg / mL kanamycin for growth. Positive single clones were screened, and colony PCR amplification was performed using SEQ ID NO.4 and SEQ ID NO.5 to identify positive clones, thus obtaining Agrobacterium GV3101 containing the plant expression vector 1300-DaMYB48.

[0084] 10 μL of Agrobacterium bifidum containing 1300-GFP and 1300-DaMYB48 vectors were inoculated into 10 mL of LB medium containing 25 µg / mL rifamycin and 50 µg / mL kanamycin, respectively. The cultures were incubated at 28 °C and 200 rpm for approximately 20 h, until the culture reached OD. 600 The value was 0.8. Centrifuge at 5000 rpm for 10 min and discard the supernatant. Add 10 mL of MS infection solution, resuspend the bacterial cells, and let stand in the dark for 3 h. Inject the cells into the back of tobacco leaves with a syringe to construct the DaMYB48 overexpressing plant OE-DaMYB48 and the control plant OE-CK, respectively.

[0085] 3. Detection of gene expression efficiency in overexpression plants

[0086] DaMYB48 expression was detected by extracting RNA from leaves of DaMYB48-overexpressing tobacco plants and control tobacco plants, respectively, and reverse transcribing it into cDNA. The expression level of DaMYB48 was then detected using primers SEQ ID NO.7 and SEQ ID NO.8. The results are as follows: Figure 4 As shown in the figure. The results showed that the expression level of DaMYB48 in the OE-DaMYB48 overexpressing plants was significantly higher than that in the OE-CK plants, indicating that the overexpressing plants were successfully constructed.

[0087] Example 5

[0088] Functional validation of DaMYB48-overexpressing tobacco plants against anthracnose

[0089] Anthracnose pathogens were inoculated into leaves of OE-DaMYB48 tobacco overexpression plants and OE-CK control tobacco plants using the mycelial cake method. Six holes were made on each side of the leaf veins using a sterile needle. PDA blank medium was inoculated on the left side of each leaf, and anthracnose pathogens were inoculated on the right side. A cotton ball moistened with 75% alcohol was placed on top of the mycelial cake. After inoculation, the plants were placed in an incubator at 70% relative humidity and 28℃ for 24 hours in darkness and humidity before normal light incubation. The cotton balls were removed 24 hours after inoculation. On day 5 after inoculation, a significant difference in lesion phenotypes was observed on the leaf surfaces of OE-DaMYB48 overexpression tobacco plants and OE-CK control tobacco plants. The results are as follows: Figure 5 As shown in the figure. The results showed that the lesion area of ​​tobacco leaves overexpressing DaMYB48 after inoculation with anthracnose was smaller than that of the control, indicating that DaMYB48 overexpression improved tobacco anthracnose resistance.

[0090] Example 6

[0091] The detection of stomata in leaves of tobacco plants overexpressing DaMYB48 includes the following steps:

[0092] Hold the leaf between your index finger and thumb to hold it in place. Use tweezers to tear the leaf at an angle, exposing the mesophyll cells. Then, use tweezers to completely peel off the epidermis. Place two drops of distilled water in the center of a glass slide, immerse the peeled epidermis in the center of the slide, cover with a coverslip, and observe the stomata under a microscope, taking photos and recording the results. Figure 6 As shown in the figure. The results showed that the stomatal opening of tobacco leaves overexpressing DaMYB48 was smaller than that of the control, indicating that DaMYB48 overexpression caused the stomata of tobacco leaves to close. By closing the stomata, the invasion of pathogens was reduced, thus improving the tobacco's resistance to anthracnose.

[0093] It should be noted that when numerical ranges are involved in this invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as in the embodiments, preferred embodiments are described in this invention to avoid redundancy. Although preferred embodiments of this invention have been described, those skilled in the art, once they understand the inventive concept of this invention, can make other changes and modifications to these embodiments, and all such changes and modifications fall within the scope of this invention.

[0094] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. If such modifications and variations fall within the scope of equivalents of this invention, then this invention also intends to include these modifications and variations.

Claims

1. The application of a biological agent material that enhances DaMYB48 expression in the treatment of anthrax, characterized in that, The nucleotide sequence of DaMYB48 is shown in SEQ ID NO.3; enhancing the expression of DaMYB48 enhances the plant's resistance to anthracnose. The plant in question is tobacco.

2. The application of the biological agent material enhancing DaMYB48 expression according to claim 1 in the treatment of anthrax, characterized in that, The biopharmaceutical material includes a recombinant plasmid containing the nucleotide sequence shown in SEQ ID NO.

3.

3. The application of the biological agent material enhancing DaMYB48 expression according to claim 2 in the treatment of anthrax, characterized in that, The nucleotide sequence of the recombinant plasmid is shown in SEQ ID NO.

6.

4. The application of the biological agent material enhancing DaMYB48 expression according to claim 3 in the treatment of anthrax, characterized in that, The method for constructing the recombinant plasmid includes the following steps: The SEQ ID NO.3 was amplified using primers 1300_MYB48_F and 1300_MYB48_R to obtain a nucleotide fragment with a PstI restriction site and a pre-homologous arm at the 5′ end of the super1300GFP-C vector, and a KpnI restriction site and a post-homologous arm at the 3′ end of the super1300GFP-C vector. The nucleotide fragment was then ligated to the super1300GFP-C linearized vector, which had been double-digested with PstI and KpnI, through homologous recombination to obtain a recombinant plasmid.

5. The application of the biological agent material that enhances DaMYB48 expression according to claim 4 in the treatment of anthrax, characterized in that, The nucleotide sequence of 1300_MYB48_F is shown in SEQ ID NO.4; the nucleotide sequence of 1300_MYB48_R is shown in SEQ ID NO.

5.

6. The application of the biological agent material enhancing DaMYB48 expression according to claim 2 in the treatment of anthrax, characterized in that, The biological agent material includes: recombinant Agrobacterium containing the recombinant plasmid.

7. The application of the biological agent material for enhancing DaMYB48 expression according to claim 6 in the treatment of anthrax, characterized in that, The recombinant Agrobacterium was obtained by introducing the recombinant plasmid into Agrobacterium.

8. The application of the biological agent material for enhancing DaMYB48 expression according to claim 7 in the treatment of anthrax, characterized in that, The method used for importation is the freeze-thaw method.

9. The application of the biological agent material for enhancing DaMYB48 expression according to claim 8 in the treatment of anthrax, characterized in that, The method for overexpressing DaMYB48 is as follows: the recombinant Agrobacterium is cultured to obtain an infectious bacterial solution, and the infectious bacterial solution is injected into the leaves of the plant to achieve overexpression of DaMYB48 in the plant.

Images