Construction method and application of Wilson disease animal model
By introducing a specific deletion mutation in exon 8 of the mouse Atp7b gene using CRISPR/Cas9 gene editing technology, an animal model that accurately simulates large deletion mutations in human Wilson's disease was constructed. This solves the problem that existing models cannot simulate the pathogenic mechanism of large deletions and provides a tool for research and treatment strategies.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-12
- Publication Date
- 2026-03-20
AI Technical Summary
Existing animal models of Wilson's disease cannot accurately simulate the complete protein inactivation and potential negative effects caused by large fragment deletions, which limits the study of the pathogenesis of such mutant patients and the development of treatment strategies.
A specific deletion mutation was introduced into exon 8 of the mouse Atp7b gene using CRISPR/Cas9 gene editing technology. Targeted sgRNA, Cas9 mRNA and ssODN homologous recombination templates were designed and prepared. The mixture was then injected into mouse single-cell embryos via microinjection to cultivate an animal model with stable inheritance of the Atp7b gene specific deletion mutation.
An animal model of Wilson's disease that accurately simulates the large deletion mutation of the human Atp7b gene was constructed, filling the gap in existing models. It provides a tool for studying unique pathological mechanisms such as complete protein inactivation and negative effects, serves as an ideal model for evaluating gene therapy strategies, and can be used to screen targeted therapeutic drugs.
Smart Images

Figure CN121699998A_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of gene editing and disease model construction technology, and specifically relates to a method for constructing an animal model of Wilson's disease and its application. Background Technology
[0002] Wilson's disease (WD) is an autosomal recessive inherited disorder of copper metabolism, primarily caused by… Atp7b This is caused by a gene mutation. The gene encodes a protein responsible for transporting copper ions to ceruloplasmin and promoting copper excretion in bile. Its functional defects can lead to abnormal accumulation of copper in tissues such as the liver and brain, causing a series of pathological changes including liver damage and neurological symptoms. Different populations... Atp7b Gene mutation profiles vary; besides point mutations, large deletions are also an important type of pathogenic mutation. However, existing animal models of WD gene editing (such as...) Atp7b Gene knockout or point mutation models have failed to adequately simulate the unique pathological mechanisms such as complete protein inactivation and potential negative effects caused by large fragment deletions, limiting the research on the pathogenesis of WD patients with such mutations and the development of treatment strategies.
[0003] To gain a deeper understanding of the pathogenesis of Wilson's disease and develop effective treatments, it is crucial to construct animal models that closely resemble the characteristics of the human disease. Currently, existing animal models of Wilson's disease are primarily obtained through gene editing technology, including... Atp7b Gene knockout models and point mutation models. For example, knockout mice using CRISPR / Cas9 technology. Atp7b Exon 2 of the gene was selected, resulting in a model of hepatic copper accumulation (CN 113862305 A). Regarding zebrafish models, existing techniques utilize Crispant technology to design a combination of four sgRNAs to knock out zebrafish. Atp7b Exon 8 of the gene was used to construct a zebrafish model of Wilson's disease (CN 117625613 A).
[0004] However, all existing models have significant limitations: current full knockout models cannot distinguish the unique pathogenic mechanisms of different mutation types (especially large deletions and point mutations); point mutation models can only simulate single amino acid changes and cannot reproduce the complete destruction of protein structure and potential negative effects caused by large deletions; while existing zebrafish models have high mutation diversity but lack precise simulation of specific large deletion mutations in humans. Since large deletion mutations account for a certain proportion of clinical patients and are often accompanied by severe phenotypes, the gaps in the existing model system result in a lack of effective experimental tools for studying the pathogenesis of these patients, screening therapeutic targets, and evaluating gene therapy, severely limiting the development of precision medicine for Wilson's disease. Summary of the Invention
[0005] To address the aforementioned problems, this application provides a method capable of accurately simulating human... Atp7b An animal model of the pathophysiological characteristics of large gene fragment deletion mutations fills the gaps in existing models and provides a more accurate and reliable experimental platform for basic research and clinical translation of Wilson's disease.
[0006] Firstly, this application proposes a method for constructing an animal model of Wilson's disease, the method comprising: using CRISPR / Cas9 gene editing technology in animals... Atp7b A specific deletion mutation was introduced into exon 8 of the gene; The specific fragment deletion mutation is c.2333_2340delGACGGTGG deletion mutation.
[0007] Furthermore, the animal in question is a mouse.
[0008] Furthermore, the construction method includes the following steps: Design and prepare target animals Atp7b The sgRNA, Cas9 mRNA, and ssODN homologous recombination template containing the target deletion mutation are located flanking the target region of exon 8 of the gene. The prepared sgRNA, Cas9 mRNA and ssODN homologous recombination template were mixed to form a microinjection mixture, which was then injected into mouse single-cell stage embryos. The injected embryos were transferred into pseudopregnant recipient animals and cultured to obtain F0 generation animals; Genotyping of F0 generation and subsequent generations of animals was performed to screen and breed new species. Atp7b Animal strains with stable inheritance of gene-specific deletion mutations.
[0009] Furthermore, the animal is a mouse, and the sgRNA sequence includes sgRNA1 and sgRNA2; The nucleotide sequence of sgRNA1 is shown in SEQ NO.1; The nucleotide sequence of sgRNA2 is shown in SEQ NO.2.
[0010] Furthermore, the ssODN homologous recombination template is 120 bp in length, formed by direct connection of 40nt upstream and 40nt downstream of the target deletion site, and modified by phosphorylation and thiolation.
[0011] Secondly, this application proposes the application of animal models prepared according to the described construction method in screening drugs for the prevention or treatment of Wilson's disease.
[0012] Thirdly, this application proposes the application of animal models prepared according to the described construction method in screening biomarkers for the treatment of Wilson's disease.
[0013] Compared with the prior art, this application has the following advantages: This application is the first to construct an accurate simulation of humans. Atp7b This animal model of Wilson's disease with large gene deletion mutations fills the gap in existing models (limited to complete knockout and point mutations) that cannot simulate the pathogenic mechanism of large gene deletions. Designed for clinically common mutation types for which corresponding models are lacking, this model provides an irreplaceable tool for studying unique pathological mechanisms such as complete protein inactivation and negative effects. Unlike point mutation models, this model does not express functional Atp7b protein at all, and its immune status is highly consistent with that of severely ill patients requiring gene therapy, making it an ideal preclinical model for evaluating strategies such as AAV-mediated gene replacement therapy. Furthermore, this model can be used to screen adjuvant therapies targeting the NLRP3 inflammasome, accelerating the development of precision treatment options for Wilson's disease.
[0014] This model systematically reproduces the core pathological features of human Wilson's disease, including severe imbalance of copper metabolism homeostasis, progressive liver function damage, and typical liver pathological processes. Moreover, its pathological development sequence is highly consistent with human diseases (liver lesions precede nervous system involvement), making it closer to clinical reality than existing models and providing a more reliable experimental basis for related research.
[0015] This application is the first to demonstrate that the overactivation of the hepatic NLRP3 inflammasome is the core driving force of liver inflammation in Wilson's disease, and that inhibiting NLRP3 can significantly reduce hepatocellular damage and fibrosis. This not only reveals a new pathogenesis, but also provides a clear target for targeted therapy, and demonstrates the high efficiency of this model in target validation.
[0016] Other features and advantages of this application will be set forth in the description which follows, and will be apparent in part from the description, or may be learned by practicing the application. The objectives and other advantages of this application may be realized and obtained by means of the structures pointed out in the description, claims and drawings. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 An embodiment of this application is shown. Atp7b A schematic diagram of gene exon 8 deletion strategy and sgRNA design; Figure 2 An embodiment of this application is shown. Atp7b Genotyping and sequencing map of F0 generation mice with deletions of 8 gene segments; Figure 3 An embodiment of this application is shown. Atp7b Genotyping and sequencing map of F0 generation mice with six gene fragment deletions; Figure 4 An embodiment of this application is shown. Atp7b Genotyping and sequencing map of F0 generation mice with two gene fragment deletions; Figure 5 This application illustrates stable inheritance in embodiments of the present application. Atp7b Gene sequencing validation results of 8 fragment deletion mouse models (F1 / F2 generation); Figure 6 This document illustrates the mRNA and protein expression levels of eight fragment-deleted mouse copper transporter proteins in embodiments of this application; where A represents liver tissue. Atp7b mRNA expression level; B represents the Western blot analysis and quantification results of ATP7b protein expression in liver tissue; C represents the Western blot analysis and quantification results of holo-CP expression in liver tissue; D represents the serum holo-CP content; data are expressed as mean ± standard deviation, n=6; compared with the age-matched WT group, P<0.01, P<0.001; Figure 7The following are the results of serum non-ceruloplasmin-bound copper and excretory copper content detection in mice with fragment deletions as illustrated in this application embodiment; wherein, A represents serum non-ceruloplasmin-bound copper content in mice of different ages; B represents 24-hour urinary copper content; C represents fecal copper content; data are expressed as mean ± standard deviation, n=6; compared with the age-matched WT group, P<0.01; Figure 8 The following diagram illustrates the results of assessing liver copper accumulation and serum liver function indicators in fragment-deleted mice according to embodiments of this application; where A represents the copper content in liver tissue of mice of different ages; B represents the serum ALT level; C represents the serum AST level; D represents the serum total bilirubin level; and E represents the serum albumin level. Data are expressed as mean ± standard deviation, n=6, compared with the age-matched WT group. P<0.05, P<0.001; Figure 9 The following are the histopathological and magnetic resonance imaging (MRI) analysis results of liver tissue from mice with fragment deletions in this embodiment of the present application; wherein, A is a representative HE-stained image (×200) of liver tissue from mice of different ages; B is the statistical analysis of liver pathological damage scores; C is a representative 9.4T MRI T1WI and T2WI image of the liver; D is the quantitative analysis result of liver T2 value; data are expressed as mean ± standard deviation, n=3; compared with the age-matched WT group, P<0.001; Figure 10 The results of copper content detection in the brain tissue of fragment-deleted mice in this application embodiment are shown; where A, B, C, D, and E are the results of copper content detection in 8-nt mice aged 1, 3, 5, and 7 months of age, respectively, using ICP-MS. + / + Copper content in the cortex, striatum, hippocampus, cerebellum, and brainstem tissues of mice and wild-type (WT) mice; data are expressed as mean ± standard deviation, n=6; compared with the age-matched WT group, P<0.001; Figure 11 The following are the results of pathological and magnetic resonance imaging analysis of brain tissue from mice with missing segments in this application embodiment; wherein, A is a representative HE-stained image (×200) of brain tissue from each group of mice; B is the statistical analysis of neuropathological scores; C is a representative image of 9.4T magnetic resonance T1WI and T2WI; D is the quantitative analysis result of T2 value in the basal ganglia region; data are expressed as mean ± standard deviation, n=6; there is no statistical difference compared with the age-matched WT group; Figure 12 The results of neurobehavioral feature analysis of fragment-deleted mice in the embodiments of this application are shown; where A represents 8nt mice of different ages. + / +A) Latency for escaping the target hole in the Barnes maze; B) Time spent in the open arm maze of the elevated cross maze; C) Time spent stationary in the central area of the open field test; D) Latency for falling in the Rotarod test; E) Total distance traveled in the open field test; F) Number of climbs in the open field test; Data are expressed as mean ± standard deviation, n=10. Compared with the age-matched WT group, P<0.05; Figure 13 This paper presents the results of detecting the expression and activation levels of key components of the NLRP3 inflammasome in the liver of mice with fragment deletions in this application embodiment; wherein, A is the representative band of Western blot for the expression of NLRP3, Cleaved Caspase-1 (Casp-1), ASC and mature IL-1β protein in mouse liver tissue; B is the quantitative analysis results of NLRP3, ASC, Casp-1 and mature IL-1β protein expression; data are expressed as mean ± standard deviation, n=3; compared with the WT group, P<0.001; Figure 14 This application illustrates AAV-mediated [method / technology] in an embodiment. Nlrp3 Effects of knockdown on NLRP3 inflammasome activation and inflammatory response in the liver of mice with fragment deletion; where A is a representative band of NLRP3 protein expression in liver tissue by Western blot; B is the quantitative analysis result of NLRP3 protein expression; C is a representative band of inflammasome-related proteins NLRP3, Casp-1, ASC and mature IL-1β in liver tissue by Western blot; D is the quantitative analysis result of NLRP3, Casp-1, ASC and mature IL-1β protein expression; E is a representative image of MPO immunohistochemical staining in liver tissue (×200); F is MPO + Quantitative analysis results of positive cell count; G represents qRT-PCR detection of inflammatory factors in liver tissue. Il1b , Il6 , Il18 , Tnfα mRNA expression levels; data are expressed as mean ± standard deviation, n=6; compared with the NC group. P<0.05, P<0.001; NC was the control group, sh Nlrp3 for Nlrp3 Gene silencing therapy group; Figure 15 This application illustrates AAV-mediated [method / technology] in an embodiment. Nlrp3The study investigated the ameliorative effect of knockdown on liver fibrosis in fragment-deleted mice. A shows the serum levels of hyaluronic acid (HA), laminin (LN), type III procollagen (HPC III), and type IV collagen (Col IV) as measured by ELISA. B shows a representative image (×200) of Masson staining. C shows the quantitative analysis results of collagen area stained by Masson staining. D shows the detection of liver fibrosis-related genes by qRT-PCR. Acta2 , Col1a1 , Tgfb1 and Timp1 mRNA expression levels; data are expressed as mean ± standard deviation, n=6; compared with the NC group. P<0.05, P<0.01, P<0.001; NC was the control group, sh Nlrp3 for Nlrp3 Gene silencing therapy group. Detailed Implementation
[0019] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.
[0020] Example 1 Preparation of targeted sgRNA and CRISPR / Cas9 components.
[0021] 1. sgRNA design and synthesis: A pair of targeted mice were designed using the professional CRISPR design tool (Benchling). Atp7b Specific sgRNAs flanking the target region of exon 8 of a gene. For example... Figure 1 As shown, the target sequence of the upstream sgRNA (sgRNA1) is TGCTCTTTGTGTTCACGCCC (5'-3', SEQ NO.1), and its prototype spacer adjacent motif (PAM) is TGG. The target sequence of the downstream sgRNA (sgRNA2) is CACGTGGCCAAGGTAGGCGG (5'-3', SEQ NO.2), and its PAM is AGG.
[0022] The DNA template containing the T7 promoter and sgRNA scaffold sequence was chemically synthesized by a biotechnology company.
[0023] 2. In vitro transcription of sgRNA: (1) Using the DNA template synthesized in step 1 as a template, amplification was performed by high-fidelity PCR enzyme to obtain a DNA template for in vitro transcription.
[0024] (2) The purified PCR products were transcribed using the MEGAscript T7 in vitro transcription kit. The reaction mixture consisted of 7.5 mM each of ATP, CTP, GTP, and UTP, 2 μL of T7 Enzyme Mix, 1 μg of template, and RNase-free water to a final volume of 20 μL. The mixture was incubated in a 37°C water bath for 4 hours.
[0025] (3) After the reaction is complete, add 1 μL of DNase I (RNase-free) and digest at 37°C for 15 minutes to remove the DNA template.
[0026] (4) The transcribed sgRNA was purified using the MEGAclear Kit, dissolved in RNase-free water, quantified, aliquoted and stored at -80℃.
[0027] 3. Preparation of Cas9 mRNA: (1) The pCS2+nCas9n plasmid was completely linearized by digesting it with NotI restriction endonuclease at 37°C for 3 hours, and the linearized product was recovered and purified by agarose gel electrophoresis.
[0028] (2) Linearized plasmids were transcribed in vitro using the mMESSAGE mMACHINE SP6 transcription kit. The reaction system was incubated at 37°C for 2 hours.
[0029] (3) After transcription is complete, DNase I is added to remove the DNA template.
[0030] (4) Cas9 mRNA was purified using the Lithium Chloride Precipitation method, dissolved in RNase-free water, quantified, aliquoted and stored at -20℃.
[0031] Example 2 Microinjection and model construction in mouse embryos.
[0032] 1. Collection of single-cell stage embryos: (1) Select healthy C57BL / 6J female mice aged 4-6 weeks and induce superovulation by intraperitoneal injection of pregnant mare serum gonadotropin (PMSG, 5 IU) and human chorionic gonadotropin (hCG, 5 IU), with an interval of 48 hours between the two injections.
[0033] (2) After superovulation, female mice were caged with adult male mice of fertility at a ratio of 1:1. The vaginal plugs were checked the next morning. If a female mouse with a plug was found, she was considered to be 0.5 days pregnant.
[0034] (3) The female rat with the plugged oviduct was euthanized, and the oviduct was quickly removed and placed in M2 manipulation solution. Under a stereomicroscope, the ampulla of the oviduct was torn with a dissecting needle to release the cumulus-oocyte complex.
[0035] (4) Transfer the complex to M2 solution containing 1 mg / mL hyaluronidase, gently pipette to remove cumulus cells, and obtain pure single-cell fertilized eggs. Wash the embryos three times each with M2 solution and M16 culture medium, then place them in a drop of M16 culture medium containing mineral oil and store them temporarily in a 37°C, 5% CO2 incubator for later use.
[0036] 2. Embryo microinjection: (1) Dilute the sgRNA1, sgRNA2 and Cas9 mRNA prepared in Example 1 to working concentrations (50 ng / μL for each sgRNA and 100 ng / μL for each Cas9 mRNA) with microinjection buffer (containing 0.125 mM EDTA and 5 mM Tris-HCl, pH 7.4), mix thoroughly, centrifuge, and place on ice for later use.
[0037] (2) Under the inverted differential interference phase contrast microscope and microsystem, a single fertilized egg is fixed with an ovipositor. After the injection needle draws up the mixture, it is inserted into the cytoplasm of the fertilized egg and about 5-10 pL of the mixture is slowly injected.
[0038] 3. Embryo transfer: (1) The embryos that survived after injection and had intact morphology were cultured in vitro to the two-cell stage.
[0039] (2) ICR female mice with pseudopregnancy of 0.5 days were selected as recipients. After anesthesia, the ovaries and fallopian tubes were exposed by a back incision, and about 20-25 embryos were transferred to the ampulla of the fallopian tube of the recipient female mouse using a transfer tube.
[0040] (3) The wound was sutured and the mother mouse was raised separately after she woke up. About 19-20 days later, the recipient mother mouse gave birth naturally, and F0 generation Founder mice were obtained.
[0041] Example 3 Genotyping and model breeding.
[0042] 1. Genomic DNA extraction: Ten to fourteen days after birth, 2-3 mm tail tip tissue was harvested from F0 generation mice and placed in a 1.5 mL centrifuge tube. The procedure was performed using an animal tissue genomic DNA rapid extraction kit (centrifuge column type). The specific steps were as follows: Add 180 μL Buffer T1 and 20 μL Proteinase K, and digest overnight in a 55°C water bath; add 200 μL Buffer B and mix thoroughly; add 200 μL anhydrous ethanol, mix well, and transfer the entire mixture to the adsorption column; wash sequentially with Buffer W1 and Wash Buffer; finally, elute the DNA with 60 μL Elution Buffer and store at -20°C.
[0043] 2. PCR amplification and sequencing identification: (1) Design and synthesize specific primers: Atp7b -ex8-F (SEQ NO.3):5'-GCCCCCATGCTCTTTGTGTT-3'; Atp7b -ex8-R (SEQ NO.4):5'-GCCTACCTTGGCCACGTGTT-3', used to amplify a fragment of approximately 300 bp containing the target site.
[0044] (2) PCR reaction system (25μL): 12.5μL of 2×Taq PCR Master Mix, 1μL of template DNA, 1μL each of upstream and downstream primers (10μM), and add sterile water to 25μL.
[0045] (3) PCR amplification program: 95℃ pre-denaturation for 5 minutes; 95℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, for a total of 35 cycles; and finally 72℃ final extension for 5 minutes.
[0046] (4) Take 5 μL of PCR product for 1.5% agarose gel electrophoresis. Send the PCR product with the correct band size to the sequencing company for Sanger sequencing.
[0047] (5) Using Chromas software to analyze the sequencing peak diagram and compare it with the wild-type sequence, a c.2333_2340delGACGGTGG deletion heterozygote (8nt) was successfully identified in the target region. + / - ), c.2333_2340delGACGGT (6nt + / - ), c.2333_2340delGACGGT (2nt + / - F0 generation mice ( Figure 2 , Figure 3 , Figure 4 ).
[0048] 3. Model breeding: (1) Heterozygotes identified by sequencing as having an 8-base deletion (8nt) + / - F0 generation Founder mice were backcrossed with wild-type C57BL / 6J mice to obtain F1 generation mice.
[0049] (2) Extract DNA from the tail tip of F1 mice and identify their genotypes (using the same methods as in steps 1 and 2 of this example) to screen for deletion heterozygotes.
[0050] (3) By intercrossing F1 generation heterozygous mice, wild-type (WT) and heterozygous (8nt) mice can theoretically be obtained. + / - ) and homozygotes (8nt) + / + Three genotypes of F2 generation mice were used. Genotyping of the F2 generation was performed to select homozygous mice, which were then used to establish a stable genetic lineage. Atp7b Mouse strain with deletion of exon 8 of gene ( Figure 5 ).
[0051] Example 4 Phenotypic validation of a fragment-deleted mouse model.
[0052] Homozygous deletion mice aged 8-12 weeks (8nt) + / + Systematic phenotypic analysis was performed on the wild-type control (WT) and its littermates: 1. Copper metabolism phenotypic analysis: (1) Liver tissue Atp7b Gene mRNA expression level detection: Total RNA extraction: Approximately 30 mg of mouse liver tissue was collected, and total RNA was extracted using the TRIzol reagent method. The simplified steps were as follows: the tissue was ground in liquid nitrogen, 1 mL of TRIzol was added, and the mixture was thoroughly homogenized; 0.2 mL of chloroform was added, and the mixture was vigorously vortexed and centrifuged; the upper aqueous phase was aspirated, and 0.5 mL of isopropanol was added to precipitate the RNA; the RNA precipitate was washed with 75% ethanol, and finally dissolved in RNase-free water.
[0053] RNA quality testing: RNA concentration and purity were measured using a micro-spectrophotometer (an A260 / A280 ratio between 1.8 and 2.0 was considered acceptable). RNA integrity was assessed using 1.5% agarose gel electrophoresis; clear 28S and 18S rRNA bands indicated no RNA degradation.
[0054] Reverse transcription: This was performed using the PrimeScript RT reagent Kit with gDNA Eraser. First, the gDNA Eraser was used to remove genomic DNA contamination at 42°C for 2 minutes, followed by reverse transcription at 37°C for 15 minutes and then at 85°C for 5 seconds to synthesize cDNA.
[0055] Real-time quantitative PCR (qRT-PCR): cDNA was used as a template and amplified using SYBR Premix Ex Taq II on a real-time fluorescence quantitative PCR instrument. The reaction system consisted of: 10 μL SYBR Premix Ex Taq II, 0.8 μL each of forward and reverse primers (10 μM), 0.4 μL ROX Reference Dye II, 2 μL cDNA template, and RNase-free water to a final volume of 20 μL. The reaction program was: 95℃ for 30 seconds; 95℃ for 5 seconds, 60℃ for 34 seconds, for a total of 40 cycles. The primer sequences used for amplifying Atp7b were: Atp7b-qF (SEQ NO. 5): 5'-AGCAGATGGCTCTGTTGCTG-3', Atp7b-qR (SEQ NO. 6): 5'-CTCCACAGCCACCATGAACA-3'. Gapdh was used as an internal control gene for normalization, and 2... –ΔΔCt The method calculates the relative expression level of mRNA, where the two Δ values represent the difference calculated in two steps.
[0056] Step 1: Calculate ΔCt; ΔCt = Target gene Ct value - Internal reference gene Ct value (Here, the target gene is Atp7b and the internal reference gene is Gapdh). Its function is to eliminate the differences in RNA extraction amount and reverse transcription efficiency between samples, so that the target gene Ct values of different samples are comparable.
[0057] Step 2: Calculate ΔΔCt; ΔCt = ΔCt of experimental group - ΔCt of control group (e.g., ΔCt of 8nt mouse minus ΔCt of WT mouse).
[0058] qRT-PCR analysis showed that, compared with WT mice, 8nt + / + mouse liver tissue Atp7b The mRNA expression level did not change significantly. Figure 6 (A). This result is in line with expectations, because the 8-base deletion mutation mainly affects the translation process of mRNA or leads to the production of unstable truncated proteins, but does not usually trigger nonsense-mediated mRNA degradation, thus the transcript level is preserved.
[0059] (2) Expression levels of ATP7b protein and ceruloplasmin in liver tissue: Western Blot Analysis: Approximately 50 mg of liver tissue was collected, and total protein was extracted using RIPA lysis buffer. Protein concentration was determined by the BCA method. An equal volume of protein was subjected to SDS-PAGE electrophoresis. After transfer to a membrane, Western blot analysis was performed using anti-ATP7b antibody, anti-ceruloplasmin (CP) antibody, and anti-GAPDH antibody.
[0060] result: ATP7b protein: 8nt + / + The ATP7b protein band was absent in mouse liver tissue. Figure 6 The presence of B in the mRNA level, compared to the unchanged mRNA level, demonstrates that this deletion mutation leads to protein synthesis failure.
[0061] Holo-CP in liver tissue: 8 nt was detected. + / + There was no significant difference in the expression level of ceruloplasmin (mainly in the deglycosylated precursor form) in the liver tissues of mice and WT mice. Figure 6 (C). This is because the synthesis of ceruloplasmin itself is not directly inhibited, and its expression level is not affected. Atp7b The direct impact of the missing information.
[0062] (3) Serum ceruloplasmin (CP) detection: orbital blood was collected from mice, allowed to stand at room temperature for 2 hours, and then centrifuged at 4°C and 3000 rpm for 15 minutes to collect serum. The serum CP content was detected using a mouse ceruloplasmin (CP) ELISA kit, strictly following the instructions.
[0063] The results showed that 5-month-old 8nt + / + Serum CP levels in mice were significantly lower than those in WT mice. Figure 6 (D).
[0064] (4) Detection of serum non-ceruloplasmin-binding copper levels: method: Serum total copper: A portion of serum was collected, and the total copper concentration was detected by inductively coupled plasma mass spectrometry (ICP-MS).
[0065] Non-CP bound copper calculation: The level of non-ceruloplasmin bound copper is estimated by the formula: Non-CP bound copper (μmol / L) ≈ Total serum copper (μmol / L) - Serum CP (μmol / L) × 6 (assuming each CP molecule binds 6 copper atoms).
[0066] Results: Compared with WT mice, 3-, 5-, and 7-month-old mice showed 8nt growth. + / + Serum non-CP-bound copper levels in mice were significantly elevated. Figure 7(A) indicates the presence of potentially toxic free copper in the bloodstream.
[0067] (5) 24-hour urinary copper excretion measurement: Methods: Mice were placed alone in metabolic cages, and urine was collected over 24 hours. The total urine volume was recorded. A portion of the urine was used to detect copper concentration by ICP-MS, and the total urinary copper excretion over 24 hours (μg / 24h) was calculated.
[0068] Results: Compared with WT mice, 8nt + / + Mice showed a significant increase in 24-hour urinary copper excretion at 3 and 5 months of age; this level remained high until 7 months of age. Figure 7 (Middle B). This indicates that the kidneys are compensating for the increased excretion of non-CP-bound copper in circulation.
[0069] (6) Fecal copper content detection: Methods: Feces were collected synchronously over 24 hours in a metabolic cage, accurately weighed, and dried to constant weight in a 65℃ oven. An appropriate amount of dried fecal powder was taken, nitric acid was added, and microwave digestion was performed. Finally, the copper concentration was detected by ICP-MS, and the copper content per gram of dry feces (μg / g dry weight) was calculated.
[0070] Results: At 1, 3, and 5 months of age, 8nt + / + There was no significant difference in fecal copper content between mice and WT mice. Figure 7 (C). This result is consistent with the pathological characteristics of Wilson's disease, namely, the loss of ATP7B function leads to severe obstruction of the pathway for hepatocytes to excrete copper into bile, preventing excess copper from entering the intestine through bile and being excreted in feces.
[0071] 2. Liver function and liver pathology analysis: (1) Detection of copper content in the liver: Methods: Approximately 50 mg of tissue from the same location in the left lobe of the liver of mice of different ages was accurately weighed and digested overnight with 65% nitrate. The copper concentration in the digestion solution was detected by ICP-MS, and the liver copper content (μg / g liver tissue) was calculated based on the wet weight of the tissue.
[0072] Result: 8nt + / + Significant liver copper accumulation was observed in mice at 1 month of age, and this accumulation continued to increase at 3, 5, and 7 months of age. The copper content in liver tissue was significantly higher than that in WT mice of the same age. Figure 8 (A). This directly proves the pathological deposition of copper in the liver.
[0073] (2) Serum liver function indicators: The collected serum was tested using a fully automated biochemical analyzer to determine the activity / concentration of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin and albumin (ALB).
[0074] The results showed that 8nt + / + In mice, ALT, AST, and Billrubin levels were significantly elevated, while serum ALB levels were significantly decreased. Figure 8 (BE).
[0075] (3) Histopathological observation of liver tissue: method: Histological staining: Tissue from the same location in the left lobe of mouse liver was fixed with 4% paraformaldehyde, routinely embedded in paraffin, and sectioned to a thickness of 4 μm. Hematoxylin-eosin (H&E) staining was performed, and the tissue morphology was observed under an optical microscope.
[0076] Magnetic resonance imaging (MRI) scan: Equipment and Coils: Image acquisition was performed using a Bruker 9.4T / 400 mm ultra-high field high aperture animal magnetic resonance imaging system, equipped with a self-made high-sensitivity mouse orthogonal high-pass radio frequency coil.
[0077] Scanning sequence and parameters: T2 structural images were obtained using a relaxation-enhanced fast acquisition (RARE) sequence. Specific parameters were: repetition time (TR) = 5000 ms, echo time (TE) = 30 ms, echo interval (ES) = 7.5 ms, Rare factor = 8, field of view (FOV) = 16 mm × 16 mm, image size = 192 × 192, slice thickness = 0.5 mm, averages = 3, and bandwidth = 50 kHz.
[0078] Image analysis: Visual evaluation was performed on the obtained T2-weighted images, and liver T2 relaxation time was quantitatively measured.
[0079] result: H&E staining: 1. 3 months old: 8nt + / + The liver tissue structure of mice was not significantly different from that of wild-type (WT) mice.
[0080] 5 months old: 8nt + / + The liver tissue of mice showed extensive inflammatory cell infiltration, hepatocyte nuclear swelling, and chromatin margination, typical pathological changes of Wilson's disease. Figure 9 (A, B)
[0081] MRI imaging analysis: Visual assessment: 5 months old, 8 nt + / + The proportions of the lobes of the mouse liver were harmonious, the liver capsule was slightly less smooth, the liver fissures were slightly widened, the signal intensity within the liver parenchyma was slightly uneven, and the intrahepatic vascular distribution was slightly increased and disordered, but no slightly high signal intensity was observed on T1WI, and no obvious diffuse nodular abnormal signal or reticular high signal intensity was observed on T2WI. Figure 9 (C)
[0082] Quantitative analysis: Compared with WT mice, 5-month-old 8nt + / + The T2 value of mouse liver was significantly reduced ( Figure 9 (D). A decrease in T2 value is usually associated with the deposition or fibrosis of paramagnetic substances (such as iron and copper) in tissues. This result is corroborated by biochemical test results showing extreme accumulation of copper in liver tissue, providing imaging evidence for non-invasive monitoring of disease progression.
[0083] 3. Phenotypic and behavioral analysis of the central nervous system: As Wilson's disease progresses, the liver's endogenous copper storage capacity is depleted, and excess copper gradually accumulates in other organs, particularly the central nervous system (CNS). We analyzed the copper levels of 8-nt cells at different ages. + / + Systematic measurements of intracranial copper content and behavioral analysis were performed on WT mice.
[0084] (1) Detection of copper content in brain tissue: Methods: Cortical, striatal, hippocampal, cerebellum and brainstem tissues of mice were isolated, accurately weighed, and copper content (μg / g tissue) of each brain region was detected by inductively coupled plasma mass spectrometry (ICP-MS).
[0085] result: 1. 3 months old: 8nt + / + The copper content in different brain regions of the mice was not significantly different from that of the WT mice.
[0086] 5-7 months: 8nt + / + The copper content in the striatum, hippocampus, and cerebellum of mice was significantly higher than that in age-matched WT mice. Figure 10 (AE).
[0087] The above results clearly indicate that, by Atp7b The copper deposition in the brain caused by the 8-base deletion mutation is a delayed event, consistent with the characteristic of neurological involvement in human Wilson's disease often occurring later than hepatic manifestations.
[0088] (2) Pathological observation of brain tissue: method: Histological staining: Mouse brain tissue (including cortex, basal ganglia, hippocampus, etc.) was taken, fixed with 4% paraformaldehyde, embedded in paraffin, sectioned, and stained with hematoxylin and eosin (H&E). Neuropathological evaluation and scoring were performed by an uninformed pathologist.
[0089] Magnetic resonance imaging (MRI) scan: The brain was scanned using a Bruker 9.4T MRI system to obtain T1-weighted images (T1WI) and T2-weighted images (T2WI), and the T2 relaxation time of the basal ganglia was quantitatively measured.
[0090] result: H&E staining: 8nt at each age + / + The mouse brain tissue structure was normal, with neurons arranged neatly, and no obvious glial cell proliferation, neuronal demyelination, or chromatin dissolution or other typical pathological changes were observed. Figure 11 (A) 8nt + / + The neuropathological scores of the mice were not significantly different from those of the WT mice. Figure 11 (B)
[0091] Cranial MRI: 8nt on T1WI and T2WI + / + No significant abnormal signal changes were observed in any brain region (including the cortex, basal ganglia, and hippocampus) of the mice compared to WT mice. Figure 11 (C). Quantitative analysis showed that 8nt + / + The T2 values of the basal ganglia of mice were not significantly different from those of the control group. Figure 11 (D).
[0092] Conclusion: Although at 5 and 7 months of age, 8nt + / + Significant copper accumulation was detected in the mouse brain, but no significant structural damage was observed in histopathology or conventional MRI imaging. This indicates that the model successfully simulated the early or subclinical stage of neurological involvement in Wilson's disease during the observation period, i.e., although there were biochemical abnormalities (copper accumulation), it had not yet developed into irreversible organic lesions, providing an ideal platform for studying the therapeutic time window for early intervention in the disease.
[0093] (3) Behavioral analysis: To assess the impact of intracranial copper accumulation on neurological function, a series of behavioral tests were conducted using the following methods.
[0094] method: Spatial memory ability: The escape latency required for mice to find the target hole was recorded using the Barnes maze test.
[0095] Anxiety and depression-like behaviors: Open-arm dwell time was tested using the elevated cross maze test (reflecting anti-anxiety behavior), and central zone rest time was recorded using the open field experiment (reflecting exploratory desire and depression-like behaviors).
[0096] Motor coordination and autonomous activity: Motor coordination (fall latency) was assessed using the Rotarod test, and autonomous activity was assessed using the total distance traveled and number of climbs in the open field experiment.
[0097] result: Cognitive function: 8nt at 1 month and 3 months + / + The target hole escape time of mice was not different from that of WT mice; while the escape time of 5-month-old mice was 8nt. + / + The escape time of mice was significantly prolonged. Figure 12 The result (A) indicates a delayed impairment in spatial memory.
[0098] Emotional and behavioral: 5 months old (8 nt) + / + Mice exhibited significantly reduced open-arm dwell time in the elevated cross maze, and also significantly shorter central rest time in the open field experiment. Figure 12 (B and C) together indicate that the mice exhibited anxiety-like and depression-like behaviors.
[0099] Motor function: In each tested age group, 8nt + / + Fall latency in mice during the Rotarod test ( Figure 12 (D) and the total distance traveled and number of climbs in the open field experiment ( Figure 12 There were no significant differences between the E and F mice and the WT mice, indicating that their basic motor coordination and voluntary activity abilities were not significantly affected.
[0100] Conclusion: Behavioral results demonstrate that the model successfully reproduces the core characteristics of neurological involvement in Wilson's disease: delayed, non-motor neuropsychiatric symptoms (cognitive impairment and mood abnormalities) appear after hepatic copper accumulation, while motor function remains intact during the observation period. This suggests that early intracranial copper deposition may not have caused severe pathological damage to neurons related to motor pathways, or the degree of damage may not have reached the threshold for causing motor impairment, which is highly consistent with the clinical manifestations of some human patients.
[0101] Example 5 Application of fragment deletion mouse models in the validation of pathogenesis and treatment strategies.
[0102] To verify the application value of this model in mechanism research and target validation, we investigated the use of AAV-mediated shRNA knockdown. Nlrp3 It expresses the intervention effect on liver lesions.
[0103] 1. Application of the model in mechanism research: Validation of NLRP3 inflammasome activation: (1) Western Blot analysis: Take WT and 8nt from Example 4 + / + Liver tissue proteins in mice were detected using anti-NLRP3 antibody, anti-Cleaved Caspase-1 antibody, anti-ASC antibody, and anti-IL-1β antibody. Results showed that, compared to WT mice, 8 nt + / + The protein levels of NLRP3, ASC, Casp-1, and mature IL-1β were all significantly upregulated in mouse liver tissue. Figure 13 (A and B) indicate that the NLRP3 inflammasome is overactivated.
[0104] 2. Application of the model in the validation of treatment strategies: AAV-mediated Nlrp3 Knock down: (1) Grouping and intervention of experimental animals: 8-nt experimental animals at 4 weeks of age were selected. + / + Mice were randomly divided into two groups: a model control group (8 nt) and a control group. + / + +AAV-NC) and the treatment group (8nt) + / + +AAV-shNlrp3, while age-matched WT mice served as the normal control group (WT+AAV-NC). The treatment group was injected via tail vein with a liver-specific promoter (TBG) expressing the target gene. Nlrp3 adeno-associated virus (AAV-TBG-mir30-Nlrp3, titer 1×10⁻⁶) shRNA 12 vg / mL), the injection dose is 100μL / animal (i.e., 1×10 vg / mL), and the injection dose is 100μL / animal (i.e., 1×10 vg / mL). 11 vg / animal. The model control group and the normal control group were injected with the same dose of empty control virus (AAV-TBG-mir30-Control).
[0105] (2) Evaluation of intervention effect (12 weeks after intervention): a) Liver Nlrp3 Knockdown efficiency verification: Western blotting showed that, compared with the model control group, the level of Nlrp3 in the liver tissue of mice in the treatment group was significantly knocked down (>60%). Figure 14 (A, B)
[0106] b) Inhibitory effect of NLRP3 inflammasome activation: Western blot analysis confirmed that the protein levels of ASC, Cleaved Caspase-1, and mature IL-1β in the liver tissue of mice in the treatment group were significantly lower than those in the model control group. Figure 14 (C, D)
[0107] c) Improvement in liver inflammation: Immunohistochemistry: Myeloperoxidase (MPO) immunohistochemical staining was performed on liver tissue sections. The results showed that neutrophil infiltration in the liver of mice in the treatment group was significantly less than that in the model control group. Figure 14 (E, F).
[0108] qRT-PCR: Detection of mRNA expression of inflammatory factors in liver tissue, in mice of the treatment group. Il1b , Il6 , Il18 , Tnfa The expression levels were significantly lower than those in the model control group ( Figure 14 (G).
[0109] d) Liver fibrosis remission status: Serum fibrosis markers: ELISA analysis showed that the levels of hyaluronic acid (HA), laminin (LN), type III procollagen (HPCIII), and type IV collagen (Col IV) in the serum of mice in the treatment group were significantly reduced. Figure 15 (A)
[0110] Sirius red staining and quantification: Image analysis showed that the percentage of collagen area in the liver of mice in the treatment group was significantly lower than that in the model control group. Figure 15 (B, C)
[0111] Fibrosis-related gene expression: qRT-PCR analysis showed that in the liver tissue of mice in the treatment group... Col1a1 , Acta2 (α-SMA), Tgfb1 , Timp1 mRNA expression was significantly downregulated ( Figure 15 (D).
[0112] Conclusion: This experiment, using the fragment deletion mouse model constructed in this application, not only confirmed the key role of the NLRP3 inflammasome in WD liver lesions, but more importantly, demonstrated the liver-specific role mediated by AAV. Nlrp3 The knockdown successfully validated that targeted inhibition of hepatic NLRP3 inflammasome activation can effectively alleviate WD-related liver inflammation and fibrosis. This fully demonstrates that this model is an efficient and reliable tool for in-depth research into the pathogenesis of WD and for preclinical evaluation of novel treatment strategies.
[0113] Although this application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of this application.
Claims
1. A method for constructing an animal model of Wilson's disease, characterized in that, Using CRISPR / Cas9 gene editing technology in animals Atp7b A specific deletion mutation was introduced into exon 8 of the gene; The specific fragment deletion mutation is c.2333_2340delGACGGTGG deletion mutation.
2. The method for constructing an animal model of Wilson's disease according to claim 1, characterized in that, The animal in question is a mouse.
3. The method for constructing an animal model of Wilson's disease according to claim 1 or 2, characterized in that, The construction method includes the following steps: Design and prepare target animals Atp7b The sgRNA, Cas9 mRNA, and ssODN homologous recombination template containing the target deletion mutation are located flanking the target region of exon 8 of the gene. The prepared sgRNA, Cas9 mRNA and ssODN homologous recombination template were mixed to form a microinjection mixture, which was then injected into mouse single-cell stage embryos. The injected embryos were transferred into pseudopregnant recipient animals and cultured to obtain F0 generation animals; Genotyping of F0 generation and subsequent generations of animals was performed to screen and breed new species. Atp7b Animal strains with stable inheritance of gene-specific deletion mutations.
4. The method for constructing an animal model of Wilson's disease according to claim 3, characterized in that, The animal is a mouse, and the sgRNA sequence includes sgRNA1 and sgRNA2; The nucleotide sequence of sgRNA1 is shown in SEQ NO.1; The nucleotide sequence of sgRNA2 is shown in SEQ NO.
2.
5. The method for constructing an animal model of Wilson's disease according to claim 3, characterized in that, The ssODN homologous recombination template is 120 bp in length, and is formed by direct connection of 40nt upstream and 40nt downstream of the target deletion site, and is modified by phosphorylation and thiolation.
6. The use of the animal model prepared by the construction method according to any one of claims 1-5 in screening drugs for the prevention or treatment of Wilson's disease.
7. The application of the animal model prepared by the construction method according to any one of claims 1-5 in screening biomarkers for the treatment of Wilson's disease.
Citation Information
Patent Citations
SgRNA combination and application thereof
CN117625613A
Immunodeficient mice as well as preparation method and application thereof
CN110951787A
Construction method and application of PCSK9 humanized mouse model
CN111979266A
gRNA targeting mouse Atp7b gene and method for constructing Wilson disease mouse model
CN113736787A
Construction method of ATP7B gene knockout mouse model
CN113862305A