Application of QPRT inhibitor in improvement of colorectal cancer immunotherapy sensitivity
The combined treatment of targeted QPRT inhibitors and anti-PD1 antibodies has solved the problem of poor response to immunotherapy in colorectal cancer, significantly improved treatment efficacy, inhibited tumor metastasis and improved prognosis, and provided a new treatment strategy.
Patent Information
- Application Number
- CN202511602442.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-04
- Publication Date
- 2026-03-24
AI Technical Summary
Immunotherapy for colorectal cancer has poor response rates and a high tendency to metastasize. Existing treatment regimens are not very effective, especially for patients with microsatellite stable colorectal cancer who have a low response rate to immune checkpoint blockade therapy. There is an urgent need for new treatment strategies.
By developing QPRT inhibitors, especially siRNA, shRNA, and sgRNA designed based on the QPRT gene, and combining them with anti-PD1 antibodies, we can target and inhibit QPRT expression to enhance the efficacy of immunotherapy and assess patient prognosis by detecting QPRT expression levels.
It significantly improved the sensitivity of colorectal cancer to immunotherapy, inhibited tumor metastasis, improved patient prognosis, enhanced the efficacy of anti-PD1 antibody therapy, and provided a new combination therapy strategy, especially with potential translational value for patients resistant to immunotherapy.
Smart Images

Figure CN121714701A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology and relates to the application of QPRT inhibitors in improving the sensitivity of colorectal cancer to immunotherapy. Background Technology
[0002] Colorectal cancer (CRC) ranks third in incidence worldwide, with 1.9 million new cases and 900,000 deaths annually. CRC has an insidious onset, and approximately 50% of patients have synchronous or metachronous distant metastases. Traditional treatments such as surgery, radiotherapy, and chemotherapy are ineffective for metastatic CRC, with a 5-year survival rate of only 6%. Immune checkpoint blockade therapy, represented by anti-PD-L1 / PD1, has revolutionized cancer treatment. Currently, only microsatellite instability (MSI) CRC patients can benefit from immune checkpoint blockade therapy (ICI), while up to 95% of microsatellite stable (MSS) CRC patients do not respond well to immunotherapy. There are currently no approved drugs for this treatment, and the response rate of standard treatment regimens is only 1-2%, highlighting the urgent clinical need for more effective immunotherapy options.
[0003] Quinolinate phosphoribosyltransferase (QPRT) is a key enzyme in the degradation of tryptophan to nicotinamide adenine dinucleotide (NAD+), and is the rate-limiting enzyme in the kynurenine pathway. NAD+ is a coenzyme for many coenzymes in the human body, transferring electrons and connecting the tricarboxylic acid cycle and the respiratory chain. Recent studies have shown that overexpression of QPRT increases the resistance of leukemia cells to imatinib; in addition, QPRT is significantly overexpressed in aggressive glioblastoma and breast cancer, and can enhance the invasiveness of breast cancer. However, the role of QPRT in colorectal tumors is currently poorly studied. Therefore, it is urgent to identify molecules that inhibit immunotherapy during the development and progression of CRC, clarify the potential inhibitory mechanisms, develop effective immunotherapies, and improve the prognosis of CRC patients. Summary of the Invention
[0004] The purpose of this invention is to address the problems existing in targeted therapy and immunotherapy for colorectal cancer in the prior art. In response to the poor response rate and high metastatic tendency of colorectal cancer immunotherapy, this invention conducts an in-depth study on the pathogenesis and development mechanism of colorectal cancer, clarifying QPRT as an important target for colorectal cancer metastasis. By assessing the expression level of QPRT in the patient's tumor tissue, patient prognosis can be effectively evaluated. Furthermore, inhibiting QPRT expression helps enhance the therapeutic effect of anti-PD1 antibody therapy and improve patient prognosis.
[0005] To solve the above-mentioned technical problems, the present invention is achieved through the following technical solution.
[0006] The first aspect of this invention provides the use of QPRT inhibitors in the preparation of drugs that improve the sensitivity of colorectal cancer to immunotherapy.
[0007] Preferably, the QPRT inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the QPRT gene.
[0008] Preferably, the QPRT inhibitor is selected from shRNAs designed based on the QPRT gene.
[0009] Preferably, the sequence of the shRNA designed based on the QPRT gene is selected from one or more of SEQ ID NO: 1 (5'-AGCCCTTGATTTCTCCCTCAA-3') and SEQ ID NO: 2 (5'-GTGATGGTGAAGGATAACCAT-3').
[0010] Preferably, the immunotherapy is anti-PD1 antibody therapy.
[0011] A second aspect of the present invention provides the use of QPRT inhibitors and anti-PD1 antibodies in the preparation of medicaments for treating colorectal cancer.
[0012] Preferably, the QPRT inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the QPRT gene.
[0013] Preferably, the QPRT inhibitor is selected from shRNAs designed based on the QPRT gene.
[0014] Preferably, the sequence of the shRNA designed based on the QPRT gene is selected from one or more of SEQ ID NO: 1 and SEQ ID NO: 2.
[0015] A third aspect of the present invention provides a pharmaceutical composition for treating colorectal cancer, comprising a QPRT inhibitor and an anti-PD1 antibody.
[0016] Preferably, the QPRT inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the QPRT gene.
[0017] Preferably, the QPRT inhibitor is selected from shRNAs designed based on the QPRT gene.
[0018] Preferably, the sequence of the shRNA designed based on the QPRT gene is selected from one or more of SEQ ID NO: 1 and SEQ ID NO: 2.
[0019] Preferably, the pharmaceutical composition may optionally contain a pharmaceutically acceptable carrier.
[0020] Preferably, the pharmaceutically acceptable carrier includes one or more of fillers, disintegrants, binders, lubricants, flavoring agents, preservatives, antioxidants, and colorants.
[0021] The fourth aspect of this invention provides the use of reagents for detecting QPRT expression levels in the preparation of products for predicting and / or assessing the efficacy of immunotherapy for colorectal cancer.
[0022] Preferably, the reagent for detecting QPRT expression level includes primers for detecting QPRT gene expression level and / or reagents for detecting QPRT protein content.
[0023] Preferably, the primers for detecting the QPRT gene expression level are selected from the following primer pairs, wherein the upstream sequence of the primer pair is shown in SEQ ID NO: 3 (5'-GTGAAGGATAACCATGTGGTGGC-3') and the downstream sequence is shown in SEQ ID NO: 4 (5'-CTGCTGCATTCCACTTCCACCT-3').
[0024] Preferably, the reagent for detecting QPRT protein content is selected from anti-QPRT antibodies; for example, it can be selected from ab171944 (abcam), 25174-1-AP (proteintech), etc.
[0025] Preferably, the immunotherapy is anti-PD1 antibody therapy.
[0026] The fifth aspect of this invention provides the use of QPRT inhibitors in the preparation of medicaments for treating colorectal cancer.
[0027] Preferably, the QPRT inhibitor is selected from one or more shRNAs designed based on the QPRT gene.
[0028] Preferably, the QPRT inhibitor is selected from shRNAs designed based on the QPRT gene.
[0029] Preferably, the sequence of the shRNA designed based on the QPRT gene is selected from one or more of SEQ ID NO: 1 and SEQ ID NO: 2.
[0030] It should be understood that, unless otherwise specified, in the context of this invention, the QPRT inhibitor refers to a substance capable of specifically downregulating the expression level of QPRT and / or the transcriptional level of its mature mRNA and / or the expression level or activity of the QPRT protein. For example, methods such as antisense oligonucleotides, siRNA, shRNA, sgRNA, antagomiRs, miRNA sponges, miRNA erasers, target masking, and / or multi-target methods can be used to downregulate the expression level and / or activity of QPRT; any method that can reduce the level and / or activity of QPRT is acceptable. The primers and / or primer pairs refer to PCR primers used to synthesize the QPRT gene cDNA strand in PCR, thereby detecting the expression level of the QPRT gene mRNA. In addition to the primers and / or primers listed in this invention, those skilled in the art are fully capable of designing corresponding primers, primer pairs, and antibodies based on the QPRT gene sequence using conventional methods and techniques in the field, including but not limited to molecular biology, and screening the designed primers and / or primer pairs through conventional experimental methods, or obtaining commercially available primers, as long as they can specifically detect the QPRT expression level; other conventional reagents and methods in the field can also be used to detect the QPRT protein expression level.
[0031] This invention, through extensive research, has found that QPRT expression in colorectal cancer tissues is significantly higher than in normal intestinal mucosa tissues, and the QPRT expression level in liver metastases is further higher than in primary tumor lesions, suggesting that QPRT may drive the metastatic process by promoting tumor cell migration and distant colonization. Clinical sample analysis revealed that high QPRT expression is an independent predictor of poor prognosis in colorectal cancer patients, with patients exhibiting high expression having significantly lower overall survival (OS) than those with low expression; patients with low QPRT expression showed a more significant survival benefit, indicating that low QPRT expression is a protective prognostic factor for colorectal cancer. In vitro experiments showed that inhibiting QPRT can suppress colorectal cancer cell migration, while overexpression of QPRT promotes migration, directly confirming its pro-metastatic effect.
[0032] Further mechanistic analysis revealed that QPRT negatively regulates the type I interferon signaling pathway and remodels immune cell infiltration. Inhibition of QPRT expression significantly upregulated the expression of type I interferon target genes (such as ISG15, IFIT1, MX1, OASL1, and DDX58) in colorectal cancer cells, indicating that QPRT weakens the anti-tumor immune response by inhibiting the type I interferon pathway, thereby promoting immune escape. In a mouse model of colorectal cancer, inhibition of QPRT expression significantly increased the number of CD8⁺ T cells in the tumor microenvironment. Inhibition of QPRT expression relieved the inhibition of type I interferon, enhanced antigen presentation and T cell activation, thereby improving the "cold tumor" microenvironment. Further research showed that targeting QPRT can enhance the synergistic effect of immunotherapy; combining QPRT inhibition with anti-PD1 antibodies can significantly inhibit tumor growth rate and volume and prolong survival.
[0033] In summary, QPRT, as a tumor-promoting factor in colorectal cancer, is closely associated with tumor metastasis and poor prognosis due to its high expression. Mechanistically, QPRT mediates immune microenvironment suppression by inhibiting the type I interferon signaling pathway, thereby weakening the anti-tumor immune response. Its high expression is a key driver of colorectal cancer metastasis and poor prognosis. Targeting QPRT can not only inhibit tumor migration but also reshape the immune microenvironment, upregulate tumor cell MHC-I expression, and promote chemokine secretion, significantly improving the efficacy of anti-PD-1 therapy. This discovery provides a new combination therapy strategy for colorectal cancer, especially with potential translational value for patients resistant to immunotherapy.
[0034] The present invention has the following advantages over the prior art: (1) This invention found that QPRT was significantly highly expressed in colorectal cancer tissues and liver metastases through clinical colorectal cancer patient specimens and public cohort follow-up data. Its high expression was significantly positively correlated with poor prognosis of colorectal cancer patients. High expression of QPRT promotes the metastasis of colorectal cancer cells, which can be used to assess the metastasis risk and prognosis of colorectal cancer patients and guide the formulation of treatment plans.
[0035] (2) This study demonstrated through a series of in vivo and in vitro experiments that QPRT can inhibit immune infiltration and reduce the therapeutic efficiency of immune checkpoint inhibitors. By targeting QPRT to inhibit colorectal cancer metastasis and improve the efficacy of immunotherapy, it provides effective support for the treatment of colorectal cancer. This invention, by revealing the correlation between QPRT and colorectal cancer treatment, has significant practical implications for achieving precision medicine. This invention provides a new drug therapeutic target for conquering colorectal cancer, offers a new immunotherapy strategy and scientific basis for the treatment and prognostic assessment of colorectal cancer, and provides a new direction for subsequent drug development and clinical treatment, possessing extremely high social value and market application prospects. Attached Figure Description
[0036] Figure 1 This is a schematic diagram showing the results of immunohistochemical detection of QPRT expression in cancerous and adjacent tissues of colorectal cancer patients. Scale bar: 100μm.
[0037] Figure 2 This is a schematic diagram of the QPRT expression results in the public datasets GSE18549 and GSE68468.
[0038] Figure 3 This diagram illustrates the impact of QPRT expression levels on prognosis in the TCGA colorectal cancer database, and shows the construction of a Nomogram prediction model related to QPRT expression.
[0039] Figure 4 This is a schematic diagram illustrating the impact of QPRT expression in colorectal cancer patients' tumor tissue on patient survival in the SYSU-FAH cohort.
[0040] Figure 5 This diagram illustrates the knockdown efficiency of shRNA on QPRT and the overexpression efficiency of the overexpression vector on QPRT.
[0041] Figure 6 This is a schematic diagram illustrating the effects of Transwell migration on stable colorectal cancer cell lines.
[0042] Figure 7 This is a schematic diagram illustrating the effect of QPRT knockdown on a mouse spleen-injected liver metastasis model.
[0043] Figure 8 GSEA enrichment analysis of QPRT high / low expression data in the TCGA dataset.
[0044] Figure 9 This is a schematic diagram showing the effect of QPRT expression level on the expression level of interferon-related genes.
[0045] Figure 10 This is a schematic diagram illustrating the effect of QPRT on the activity of anti-PD1 antibody therapy. Detailed Implementation
[0046] To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
[0047] The cell lines listed in this invention, including HEK293T, HCT116, MC38, and SW1116, were all purchased through legitimate channels from the American Type Culture Collection (ATCC) or the Shanghai Institute of Cell Biology, Chinese Academy of Sciences, and cultured according to existing techniques. All cell lines were identified by short tandem repeat analysis at the Forensic Identification Center of Sun Yat-sen University, and the presence of mycoplasma contamination was verified using a PCR detection kit (Shanghai Biothrive Sci). They were also cryopreserved in liquid nitrogen for subsequent experiments. All reagents used in this invention were commercially available. All clinical specimens were obtained from the First Affiliated Hospital of Sun Yat-sen University; informed consent was obtained from patients for all clinical specimens, and the relevant procedures and methods complied with medical ethics requirements and Good Clinical Practice (GCP) guidelines. The experimental methods used in this invention are conventional methods and techniques in the field. For in vitro and in vivo QPRT expression levels, conventional methods in the art (such as qPCR, Western blot, etc.) can be used for detection. This invention has verified the specificity of the primer pairs (upstream sequence as shown in SEQ ID NO: 3 (5'-GTGAAGGATAACCATGTGGTGGC-3'), downstream sequence as shown in SEQ ID NO: 4 (5'-CTGCTGCATTCCACTTCCACCT-3') and antibodies ab171944 (abcam) and 25174-1-AP (proteintech) for detecting QPRT expression levels through specific experiments. For QPRT inhibition, this invention has also verified the specificity using the designed shRNAs (#1-#2), both of which can specifically inhibit QPRT expression levels. Representative experimental results are selected and presented in this invention. However, given that the detection and inhibition of specific gene / protein expression levels are conventional methods in the art and not the main focus of this invention, some detection results are not specifically presented in this invention. Technical personnel can perform detection and verification according to the experimental methods described in this invention or other conventional methods in the prior art, as needed. Furthermore, in addition to the primer pairs, antibodies, and shRNAs listed in this invention, those skilled in the art can also design relevant primer pairs / antibodies and shRNAs based on the QPRT gene sequence and / or protein structure, or obtain commercially available reagents to detect or inhibit QPRT expression levels. Therefore, the specific information regarding primer pairs, antibodies, shRNAs, etc., listed in the context of this invention does not constitute a limitation on the actual scope of protection of this invention. Representative results selected from biological experimental replicates are presented in the accompanying drawings, and data are displayed as mean ± SD and mean ± SEM as specified in the figures.All in vitro experiments were repeated at least three times, and animal experiments were repeated twice. Data were analyzed using GraphPadPrism 8.0 software. Standard medical statistical methods such as t-tests, chi-square tests, and analysis of variance were used to compare differences in means between two or more groups. * p <0.05 is considered a significant difference.
[0048] Example 1 First, biopsy samples from colorectal cancer patients were selected from the First Affiliated Hospital of Sun Yat-sen University, Huizhou Hospital. The inclusion criteria for patients were as follows: (1) age 18 years or older (including 18 years old), both male and female; (2) patients with colorectal cancer or rectal cancer confirmed by histology or pathology, stage I-IV; (3) paraffin sections prepared from fresh tumor biopsy tissue; (4) expected survival of 3 months or more.
[0049] Immunohistochemistry was used to detect the expression level of QPRT in tumor tissues and adjacent normal tissues. The specific steps are as follows: (1) Sample fixation and embedding: After the tissue sample obtained from the biopsy is fixed, it is embedded in paraffin and cut into white slices for later use.
[0050] (2) Baking the slides: Place the paraffin slices in a 60°C oven and bake for about 2 hours to make the slices adhere firmly to the glass slide.
[0051] (3) Dewaxing and hydration: The sections were immersed in xylene I and xylene II for 10 minutes each, and then treated in anhydrous ethanol I, anhydrous ethanol II, 90% ethanol, 80% ethanol and 70% ethanol for 5 minutes each. Finally, they were washed three times with PBS for 3 minutes each time.
[0052] (4) Antigen retrieval: Immerse the slide in EDTA antigen retrieval solution and heat it in a microwave oven on high for 15 minutes to perform antigen retrieval. After cooling naturally to room temperature, wash with PBS three times for 3 minutes each time.
[0053] (5) Organize the circle: Use the grouping pen to organize the circle, ensuring that the circle is complete for subsequent operations.
[0054] (6) Endogenous enzyme blocking: Place the slides in a humidified chamber, add 3% hydrogen peroxide to cover the tissue, and incubate at room temperature for 20 minutes to remove endogenous peroxidase. Then wash with PBS three times for 3 minutes each time.
[0055] (7) Blocking treatment: Add goat serum blocking solution to cover the tissue, place it in a humidified box and incubate at room temperature for 30 minutes to reduce the non-specific binding of the primary antibody.
[0056] (8) Primary antibody incubation: After discarding the blocking solution, add primary antibody to cover the tissue and place it in a humidified chamber for overnight incubation at 4°C (determine the primary antibody concentration according to the antibody instructions).
[0057] (9) Washing and warming: On the second day, the slides were removed from the wet box, warmed to room temperature for 30 minutes, and then washed three times with PBS for 3 minutes each time.
[0058] (10) Secondary antibody incubation: Add biotin-labeled secondary antibody, incubate at room temperature for 30 minutes, and then wash three times with PBS for 3 minutes each time.
[0059] (11) DAB staining: Add DAB solution for staining, observe the staining effect under a microscope, control the staining time to 3–10 minutes, and terminate the reaction with tap water when the staining is appropriate.
[0060] (12) Counterstaining and differentiation: After counterstaining with hematoxylin for 3 minutes, place in water to stop the staining; then add 1% hydrochloric acid alcohol for differentiation for 3 seconds, and rinse with tap water for 3 minutes. Rinse in running water for 30 minutes until the color is stable, in order to perform the reverse blue treatment.
[0061] (13) Gradient dehydration and mounting: The slides were immersed in 70%, 80%, 90%, anhydrous ethanol No. 1, anhydrous ethanol No. 2, xylene No. 1 and xylene No. 2 in sequence for 5 minutes each time to complete the dehydration treatment, and finally mounted for observation.
[0062] Two independent researchers scored the clinicopathological immunohistochemical slides of the patients without prior knowledge of their condition. The staining score was determined based on staining intensity and the proportion of positive cells. Staining intensity was scored as follows: 0 (no staining), 1 (light), 2 (moderate), and 3 (strong). The proportion of QPRT-positive cells was scored as follows: 1 (<25%), 2 (25-50%), 3 (50-75%), and 4 (75-100%). The final score was obtained by multiplying the staining intensity by the proportion of positively stained cells. The results are shown below. Figure 1 As shown in the figure. The results showed that the expression level of QPRT in the cancerous tissue of colorectal cancer patients was significantly higher than that in normal tissue (*** p <0.001).
[0063] Subsequently, analyses were performed using the public datasets GSE18549 and GSE68468 (containing normal intestinal mucosa, primary intestinal lesions, and liver metastases of colorectal cancer), and the results are as follows: Figure 2 As shown in the figure. The results showed that the expression level of QPRT in colorectal cancer tissue was significantly higher than that in normal intestinal mucosa tissue. Importantly, the expression level of QPRT in liver metastases was significantly higher than that in primary colorectal cancer lesions, suggesting that it may be involved in the metastasis of colorectal cancer.
[0064] The aforementioned experiments clearly demonstrated that QPRT is highly expressed in colorectal cancer tissues and liver metastases, but lowly expressed in normal tissues, and that the expression level of QPRT in colorectal cancer tissues is positively correlated with liver metastases. Therefore, to clarify the impact of QPRT on the survival rate of colorectal cancer patients, a survival analysis was performed on the TCGA-COAD cohort (follow-up time greater than 1 year). The results showed that patients with high QPRT expression in colorectal cancer tissues had a significantly lower overall survival (OS) than patients with low QPRT expression (*). p <0.05). Furthermore, to better predict the prognosis of colorectal cancer patients, QPRT expression levels, along with important clinical indicators such as T stage, Stage stage, age, and lymph node invasion, were integrated to construct a nomogram prediction model for assessing the 3-year and 5-year survival rates of colorectal cancer patients. The fitting curve and c-index (c-index = 0.676) reflect the good accuracy of the nomogram model designed in this invention. These results demonstrate that QPRT expression levels have significant predictive value for the survival rate of colorectal cancer patients (see...). Figure 3 ).
[0065] Furthermore, analysis of follow-up data from colorectal cancer patients treated at the First Affiliated Hospital of Sun Yat-sen University revealed that patients significantly benefited from low QPRT expression. Patients exhibiting low QPRT expression in colorectal cancer tissues had significantly higher overall survival (OS) than those with high QPRT expression (***). p <0.001) (see Figure 4 ).
[0066] Example 2 The foregoing examples clarified the impact of QPRT expression levels on survival and treatment outcomes in colorectal cancer patients using clinical samples. To further investigate the effects of QPRT on colorectal cancer, a series of in vitro experiments were conducted.
[0067] First, shRNAs to reduce intracellular QPRT expression levels and overexpression plasmids to increase intracellular QPRT expression levels were designed, and their respective activities were verified. The shRNA construction steps are as follows: (1) Design shRNA knockdown sequences on the Sigma website, design and synthesize primers based on the hairpin structure of shRNA, dilute the synthesized shRNA primers with water to 100 μM, take 10 μL of each of the upstream and downstream primers, mix them evenly, and use a PCR instrument to gradually cool from 100℃ to room temperature and anneal to synthesize double strands; In this example, two shRNAs were used as examples, namely shQPRT#1 (sequence as shown in SEQ ID NO: 1, 5'-AGCCCTTGATTTCTCCCTCAA-3') and shQPRT#2 (sequence as shown in SEQ ID NO: 2, 5'-GTGATGGTGAAGGATAACCAT-3').
[0068] (2) The pLKO.1 lentiviral vector was digested with EcoRI and AgeI restriction enzymes. After digestion, two single bands were obtained by gel running. The larger band was cut and recycled. Then, the annealed double strands were ligated into the vector after gel recycling.
[0069] The steps for constructing the QPRT overexpression plasmid are as follows: Clone the QPRT sequence into the PCDH eukaryotic overexpression vector digested with the double enzymes EcoRI and AgeI. Its sequence is as shown in SEQ ID NO: 5 (atggacgctgaaggcctggcgctgctgctgccgcccgtcaccctggcagccctggtggacagctggctccgagaggactgcccagggctcaactacgcagccttggtcagcggggcaggcccctcgcaggcggcgctgtgggccaaatcccctggggtactggcagggcagcctttcttcgatgccatatttacccaactcaactgccaagtctcctggttcctccccgagggatcgaagctggtgccggtggccagagtggccgaggtccggggccctgcccactgcctgctgctgggggaacgggtggccctcaacacgctggcccgctgcagtggcattgccagtgctgccgccgctgcagtggaggccgccaggggggccggctggactgggcacgtggcaggcacgaggaagaccacgccaggcttccggctggtggagaagtatgggctcctggtgggcggggccgcctcgcaccgctacgacctgggagggctggtgatggtgaaggataaccatgtggtggccgccggtggcgtggagaaggcggtgcgggcggccagacaggcggctgacttcactctgaaggtggaagtggaatgcagcagcctgcaggaggccgtgcaggcagctgaggctggtgccgaccttgtcctgctggacaacttcaagccagaggagctgcaccccacggccaccgtgctgaaggcccagttcccgagtgtggctgtggaagccagtgggggcatcaccctggacaacctcccccagttctgcgggccgcacatagacgtcatctccatggggatgctgacccaggcggccccagcccttgatttctccctcaagctgtttgccaaagaggtggctccagtgcccaaaatccactag).
[0070] The steps for virus preparation and stable cell line construction are as follows: (1) 293T cells in logarithmic growth phase were seeded in 10cm culture dishes at a seeding density of 60%-70%; 6000ng of target plasmid loaded with shQPRT#1, shQPRT#2 or QPRT, 4500ng of PSPAX2 and 1500ng of PMD2.G were transfected into 293T cells and cultured for 48h.
[0071] (2) After 48 hours, collect the culture medium and filter out the cell debris with a 0.45 μm filter to obtain the virus solution, which is then aliquoted and stored at -80℃.
[0072] (3) One day before infection, the colorectal cancer cells (SW1116, HCT116) in the logarithmic growth phase were inoculated into a 6cm culture dish, the original culture medium was discarded, 3mL of virus solution and 3mL of fresh culture medium were added, and 6ul of polybrene was added at the same time to promote virus infection (the ratio of polybrene to culture medium was 1:1000). After 24 hours, the virus solution was discarded and fresh culture medium was replaced to continue culturing.
[0073] (4) Discard the culture medium 48 hours after infection and add a culture medium with an appropriate concentration of puromycin. At this time, the cells that have successfully integrated the foreign gene have puromycin resistance and can survive. After continuous screening for 7-10 days, a stable cell line can be obtained, and the QPRT expression level can be detected by WB to determine whether the knockdown has been successful.
[0074] The expression level of QPRT in colorectal cancer cells was validated using Western blotting, and the specific steps are as follows: (1) Dissolve the RIPA lysis buffer and mix well. Take an appropriate amount of lysis buffer and add PMSF a few minutes before use to make the final concentration of PMSF 1mM.
[0075] (2) Remove the cell culture medium and wash twice with pre-cooled PBS. Add lysis buffer at a ratio of 150-250 μL per well of a 6-well plate. Swish the plate several times with a pipette to ensure that the lysis buffer and cells are in full contact.
[0076] (3) Place on ice to lyse for 30 minutes, shaking once every 10 minutes.
[0077] (4) After complete lysis, centrifuge at 4°C and 14,000 rpm for 15 min, and immediately transfer the supernatant into a new centrifuge tube.
[0078] (5) After protein quantification, add 5× protein loading buffer according to the sample volume, mix well, and incubate in a 95℃ water bath for 5 min.
[0079] (6) Separate the protein samples obtained in step (5) by electrophoresis on denaturing SDS-PAGE gel.
[0080] (4) After the protein electrophoresis, the protein in the gel is transferred to the PVDF membrane. The transfer conditions are 300mA constant current for 1h.
[0081] (5) After the transfer is complete, seal the membrane with 5% milk on a shaker at room temperature for 1 hour.
[0082] (6) Cut the required strips, add the corresponding primary antibody (diluted according to the recommended ratio in the instructions), and place on a shaker at 4°C overnight.
[0083] (7) Recover the primary antibody and wash the membrane three times with TBST for 5 minutes each time.
[0084] (8) The membrane was incubated with the recommended dilution of the conjugated secondary antibody in blocking buffer at room temperature for 1 hour, and then washed three times with TBST buffer for 5 minutes each time.
[0085] (9) After washing the film, chemiluminescence can be performed. Prepare ECL luminescent solution (A:B=1:1) and perform luminescence development using a Biorad chemiluminescence analyzer.
[0086] Test results as follows Figure 5 As shown in the figure. The results show that both shRNAs designed according to the present invention can significantly inhibit QPRT and reduce the expression level of QPRT protein in colorectal cancer cells, while the QPRT overexpression vector can significantly increase the expression level of QPRT protein in colorectal cancer cells.
[0087] The subsequent study investigated the effect of QPRT expression levels on colorectal cancer cell metastasis, and the specific steps were as follows: (1) After digesting the shNT, shQPRT#1, shQPRT#2, Vector, and QPRT OE colorectal cancer cells constructed according to the above method, the cells were resuspended in serum-free culture medium, counted, and the cell density was adjusted to 1 million / mL.
[0088] (2) Place the 8.0 μm pore size Transwell culture chamber into a 24-well plate, add 600 μL of culture medium containing 10% fetal bovine serum to the bottom layer of the chamber, and add 100 μL of serum-free cell suspension after counting in step (1) to the chamber. One group is cultured under normal conditions (37 degrees 5% CO2 incubator), and the other group is cultured in an anaerobic incubator for 48 h.
[0089] (3) Take out the Transwell chamber, fix it with 4% paraformaldehyde for 15 min, stain it with 0.1% crystal violet for 20 min, carefully wipe away the upper layer of cells of the microporous membrane with a cotton swab, wash it twice with PBS, and then take pictures under a microscope to count the lower layer of cells.
[0090] Test results as follows Figure 6 As shown in the figure. The results showed that shQPRT significantly inhibited tumor cell migration, while QPRT OE significantly promoted tumor cell migration (*** p <0.001).
[0091] Example 3 The foregoing examples demonstrated through a series of in vitro experiments that QPRT knockdown can significantly inhibit the migration of colorectal cancer cells. To further confirm the effect of QPRT on colorectal cancer metastasis using a mouse in vivo liver metastasis model, the specific steps are as follows: (1) Selection and feeding of experimental animals: Female C57BL / 6J mice aged 4–6 weeks were selected and fed in a barrier environment to ensure the sterility and stability of the experimental conditions.
[0092] (2) Preparation of experimental instruments: Prepare the necessary instruments in advance, including sterile surgical forceps, scissors, suture needles, sutures, needle holders, cotton swabs and insulin injection needles, etc., to ensure that the instruments are sterile.
[0093] (3) Cell preparation: After digesting MC38 colorectal cancer cells from shNT and shQPRT, the cells were resuspended in PBS and counted. The concentration of the cell suspension was adjusted to 5 million / mL.
[0094] (4) Surgical incision: Make a transverse incision of about 1 cm in the skin area about 1–2 cm below the left rib of the mouse, and cut open the skin and muscle layers to expose the abdominal cavity.
[0095] (5) Exposure of the spleen: Use tweezers to grasp the tail of the pancreas that connects to the spleen and gently pull the spleen and its surrounding tissues out of the body to avoid damaging the spleen and surrounding tissues.
[0096] (6) Cell injection: Take 100 μL of well-mixed cell suspension using an insulin injection needle and slowly inject it into the spleen. After the spleen becomes lighter in color, gradually withdraw the needle to reduce tissue damage.
[0097] (7) Spleen repositioning: Gently push the spleen and its surrounding adipose tissue back into the abdominal cavity to ensure proper organ repositioning.
[0098] (8) Incision suturing: Suture the muscle layer and skin layer separately to ensure that the incision is tightly closed in order to avoid infection.
[0099] (9) Follow-up observation: The mice were fed for about two months after the operation, during which the health status of the mice was observed; then the mice were anesthetized, euthanized and dissected, and liver tissue was taken to observe the experimental results.
[0100] Test results as follows Figure 7 As shown in the figure. The results showed that inhibiting QPRT expression with shQPRT significantly suppressed liver metastasis of colorectal cancer cells.
[0101] Example 4 According to the TCGA colorectal cancer (COAD) database in the aforementioned embodiments, the patient cohort was divided into a QPRT high expression group (n=238) and a QPRT low expression group (n=238). GSEA analysis revealed that the QPRT high expression group was significantly negatively correlated with the interferon α (IFNα) response and interferon γ (IFNγ) response pathways (see [link to relevant documentation]). Figure 8 This indicates that QPRT may be involved in the negative regulation of the type I interferon pathway. Furthermore, qPCR was used to detect the effect of QPRT expression levels under IFNγ stimulation on interferon-stimulated gene expression levels. The specific steps are as follows: (1) After washing colorectal cancer cells with PBS, 1 mL of Trizol was added to each well and the cells were placed horizontally at room temperature for 2 min to allow the lysis buffer to be evenly distributed on the cell surface and to lyse the cells. The cells were then detached by pipetting and the lysis buffer was transferred to a 1 mL centrifuge tube without RNase.
[0102] (2) Let stand at room temperature for 5 minutes, centrifuge at 4℃ and 10000×g for 15 minutes, take out the supernatant, add chloroform, shake vigorously and let stand at room temperature for 3 minutes.
[0103] (3) Centrifuge at 4℃ and 10000×g for 15 min, carefully remove the aqueous phase, add an equal volume of isopropanol, mix well and let stand at room temperature for 10 min.
[0104] (4) Centrifuge at 4℃ and 10000×g for 10 min, remove the supernatant, and wash with 1 mL of 75% ethanol (prepared with DEPC water).
[0105] (5) Centrifuge at 7500×g for 5 min at 4℃, discard the supernatant, open the cap to dry the precipitate, add 12 μL of DEPC water, and incubate at 60℃ for 10 min to dissolve the RNA and detect the concentration. Total RNA was reverse transcribed into cDNA using HiScript II reverse transcriptase (Vazyme #R201-01), while genomic DNA was removed. The reaction system was calculated based on the measured RNA concentration, as shown in Table 1 below.
[0106] Table 1 Reverse transcription reaction system
[0107] (6) cDNA was diluted at a ratio of 1:5 as a template, and qPCR was performed using the ChamQ SYBR qPCR Master Mix (Vazyme #Q712) from Novizan; the 96 / 384-well real-time PCR instrument was Biorad. The reaction system configuration (taking a total volume of 20µL as an example) is as follows: 10µL of 2×Taq Pro Universal SYBR qPCR Master Mix, 0.4µL of upstream primer, 0.4µL of downstream primer, 2µL of cDNA, and 7.2µL of ddH2O; the primer sequences and amplification programs used are shown in Tables 2 and 3 below, respectively.
[0108] Table 2 Primer sequences and amplification procedures
[0109] Table 3 qPCR amplification program
[0110] The results are as follows Figure 9 As shown in the figure. The results showed that after inhibiting QPRT expression in colorectal cancer cells using shRNA (shQPRT#1 or shQPRT#2), the expression of type I interferon target genes ISG15, IFIT1, MX1, DDX58, and OASL1-related genes was effectively increased. This suggests that QPRT may participate in the regulation of the colorectal cancer immune microenvironment by regulating the type I interferon signaling pathway (*). p <0.05,** p <0.01, *** p <0.001).
[0111] Furthermore, the effect of QPRT on the therapeutic effect of PD1 antibody was investigated through in vivo experiments. The specific steps are as follows: Four-week-old C57BL / 6J mice were randomly divided into four groups, designated as groups 1-4, with ten mice in each group. A mouse liver metastasis model was established using the method described above. Groups 1 and 3 were shNT groups, and groups 2 and 4 were shRNA (shQPRT#2) groups.
[0112] Starting from day 5 post-inoculation, mice in groups 1 and 2 were injected intraperitoneally with 200 μg of IgG isotype control antibody three times a week, while mice in groups 3 and 4 were injected intraperitoneally with 200 μg of anti-PD1 antibody (BioXcell). Tumor volume in each group was monitored periodically. Two weeks after inoculation, the mice were sacrificed and tumor tissue was collected.
[0113] Experimental results are as follows Figure 10As shown in the figure. The results showed that inhibiting the expression level of QPRT in tumor cells or treating with anti-PD1 antibodies could suppress tumor growth and prolong the survival time of mice. Furthermore, the combined use of shQPRT and anti-PD1 antibodies significantly enhanced the therapeutic activity of anti-PD1 antibodies against colorectal cancer by inhibiting QPRT expression, showing a significant improvement compared to treatment with either QPRT inhibition or anti-PD1 antibody alone. Therefore, inhibiting the expression level of QPRT in colorectal cancer cells can significantly enhance the therapeutic effect of anti-PD1 antibodies against colorectal cancer, producing a synergistic therapeutic activity.
[0114] As clearly demonstrated above, QPRT is a gene highly associated with colorectal cancer. QPRT expression in colorectal cancer tissues is significantly higher than in normal intestinal mucosa, and the expression level in liver metastases is further higher than in primary tumors, suggesting that QPRT may drive metastasis by promoting tumor cell migration and distant colonization. Clinical sample analysis revealed that high QPRT expression is an independent predictor of poor prognosis in colorectal cancer patients, with patients exhibiting high expression having significantly lower overall survival (OS) than those with low expression. Patients with low QPRT expression showed a more significant survival benefit, indicating that low QPRT expression is a protective prognostic factor for colorectal cancer. In vitro experiments showed that inhibiting QPRT inhibits colorectal cancer cell migration, while overexpression promotes migration, directly confirming its prostatic effect. In other words, a high level of QPRT expression is significantly positively correlated with poor prognosis and can be used to assess the prognosis of colorectal cancer patients.
[0115] Further mechanistic studies revealed that QPRT plays a crucial role in the expression of interferon-stimulated genes and the therapeutic activity of anti-PD1 antibodies in vivo. Correspondingly, inhibiting QPRT expression levels in vivo can enhance the therapeutic effect of anti-PD1 antibodies against colorectal cancer. Specifically, QPRT can inhibit the type I interferon signaling pathway and remodel immune cell infiltration. Inhibition of QPRT expression significantly upregulated the expression of type I interferon target genes (such as ISG15, IFIT1, MX1, OASL1, and DDX58) in colorectal cancer cells, indicating that QPRT weakens the anti-tumor immune response by inhibiting the type I interferon pathway, thereby promoting immune escape. In a mouse model of colorectal cancer, inhibiting QPRT expression or combining it with anti-PD1 antibody therapy significantly increased the number of CD8⁺ T cells in the tumor microenvironment and reduced the infiltration of immunosuppressive cells. QPRT silencing can relieve the inhibition of type I interferon, enhance antigen presentation and T cell activation, thereby improving the "cold tumor" microenvironment. Further research has found that targeting QPRT can enhance the synergistic effect of immunotherapy. Combining QPRT inhibition with anti-PD1 antibodies can significantly inhibit tumor growth rate and volume, prolong survival, and increase the number of CD8⁺ T cells infiltrating the tumor microenvironment.
[0116] In summary, QPRT, as a tumor-promoting factor in colorectal cancer, is closely associated with tumor metastasis and poor prognosis due to its high expression. Mechanistically, QPRT mediates immune microenvironment suppression by inhibiting the type I interferon signaling pathway, thereby weakening the anti-tumor immune response. Its high expression is a key driver of colorectal cancer metastasis and poor prognosis. Targeting QPRT can not only inhibit tumor migration but also reshape the immune microenvironment, upregulate tumor cell MHC-I expression, and promote chemokine secretion, thereby enhancing the T-cell recruitment capacity of PD-1 blockers and significantly improving the efficacy of anti-PD-1 therapy. This invention, by revealing the association between the QPRT gene and the occurrence and development of colorectal cancer as well as anti-PD-1 antibody therapy, has significant practical implications for addressing the challenges of inter-individual differences in clinical efficacy and the gaps in prognostic assessment, and for better achieving precision medicine. It provides a new drug therapeutic target for conquering colorectal cancer, thus offering a new direction for subsequent drug development and clinical treatment, and has extremely high social value and market application prospects.
[0117] The above detailed embodiments provide a specific description of the analytical methods involved in this invention. It should be noted that the above description is only intended to help those skilled in the art better understand the methods and ideas of this invention, and is not intended to limit the scope of the invention. Without departing from the principles of this invention, those skilled in the art can make appropriate adjustments or modifications to this invention, and such adjustments and modifications should also fall within the protection scope of this invention.
Claims
1. Application of QPRT inhibitors in the preparation of drugs that improve the sensitivity of colorectal cancer to immunotherapy.
2. Use according to claim 1, characterized in that, The QPRT inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the QPRT gene.
3. The application according to claim 1, characterized in that, The immunotherapy mentioned is anti-PD1 antibody therapy.
4. Application of QPRT inhibitors and anti-PD1 antibodies in the preparation of drugs for treating colorectal cancer.
5. The application according to claim 4, characterized in that, The QPRT inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the QPRT gene.
6. A pharmaceutical composition for treating colorectal cancer, characterized in that, This includes QPRT inhibitors and anti-PD1 antibodies.
7. The pharmaceutical composition according to claim 6, characterized in that, The QPRT inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the QPRT gene.
8. Application of reagents for detecting QPRT expression levels in the preparation of products for predicting the efficacy and / or prognostic assessment of immunotherapy for colorectal cancer.
9. The application according to claim 8, characterized in that, The immunotherapy mentioned is anti-PD1 antibody therapy.
10. Application of QPRT inhibitors in the preparation of drugs for treating colorectal cancer.