C-glycosyl transferase mutant with improved thermal stability and application of C-glycosyl transferase mutant
By performing multi-site mutations on the C-glycosyltransferase GgCGT, a thermostable C-glycosyltransferase mutant Mut10 was constructed, solving the problems of poor thermal stability and high cost, and realizing the efficient synthesis of phlorizin-di-C-glucoside, which is suitable for pharmaceutical production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-05
- Publication Date
- 2026-03-24
AI Technical Summary
The poor thermostability of existing C-glycosyltransferases and the high price of UDP-glucose limit the industrial production of phlorizin-di-C-glucosinolate.
By performing multi-site combinatorial mutations on the C-glycosyltransferase GgCGT from Glycyrrhiza glabra, a thermostable C-glycosyltransferase mutant Mut10 was constructed, and the sugar donor synthesis pathway was optimized to achieve efficient synthesis of phlorizin-di-C-glucoside.
The mutant Mut10 exhibits extremely high stability and catalytic efficiency at high temperatures, significantly reducing production costs and making it suitable for fields such as pharmaceutical production.
Smart Images

Figure CN121718518A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of enzyme engineering technology, specifically relating to a C-glycosyltransferase mutant and its applications. Background Technology
[0002] C-glycosides are a class of natural products widely found in plants and microorganisms, possessing diverse pharmacological activities and high metabolic stability, and are gradually becoming an important source for new drug development. Among them, phlorizin-di-C-glucoside, as a typical C-glycoside compound, has shown significant medicinal value in anti-diabetic, antioxidant, and myelin disease treatment, with continuously growing market demand. However, the efficient preparation of this class of compounds faces many challenges, and traditional preparation methods have obvious limitations: plant extraction methods are limited by long cultivation cycles, low target product content, and complex extraction processes, making it difficult to achieve industrial-scale production; chemical synthesis methods are not only cumbersome in reaction steps and demanding in conditions, but the cumbersome hydroxyl / carboxyl group protection-deprotection process cannot meet the requirements of regioselective and precise glycosylation modification. In contrast, enzymatic methods have advantages such as high catalytic efficiency, mild reaction conditions, and environmental friendliness. In particular, the specific catalysis of enzymes can achieve precise transfer of glycosyl groups to specific sites on the acceptor substrate, achieving highly regioselective glycosylation modification, and has become the preferred technical route for the preparation of glycoside derivatives.
[0003] UDP-glycosyltransferases (UGTs), as key enzymes in the glycosylation modification of natural products, use uridine diphosphate-sugar (UDP-Sugar) as a sugar donor and catalyze the transfer of glycosyl groups to active sites such as hydroxyl, carboxyl, and amino groups on the acceptor. Based on the type of glycosidic bond, they can be classified into O-, C-, S-, and N-glycosyltransferases. Among them, C-glycosyltransferases are the key enzymes catalyzing the synthesis of C-glycosides, but their industrial application is constrained by two major problems: first, the reported C-glycosyltransferases generally suffer from poor thermostability; second, the sugar donors such as UDP-glucose (UDP-Glc) required for glycosylation modification are expensive, significantly increasing the cost of large-scale production. Therefore, there is an urgent need to construct efficient UDP-Glc synthetic pathways to reduce costs.
[0004] To overcome the aforementioned technical bottlenecks and achieve efficient preparation of phlorizin-di-C-glucoside, this invention addresses the core issue of insufficient thermostability of C-glycosyltransferases by employing a multi-site combined mutagenesis strategy to obtain a thermostable C-glycosyltransferase mutant. Based on this mutant, a high-temperature enzymatic synthesis process is constructed. Simultaneously, production costs are reduced by optimizing the sugar donor synthesis pathway, ultimately achieving efficient synthesis of phlorizin-di-C-glucoside. Summary of the Invention
[0005] This invention provides a thermostable C-glycosyltransferase mutant and its applications. Specifically, this invention obtains a mutant with significantly improved thermostability by further mutating the C-glycosyltransferase GgCGT (GenBank ID: MH998596) derived from Glycyrrhiza glabra. This invention also includes the application of this thermostable C-glycosyltransferase mutant in the synthesis of phlorizin-di-C-glucoside.
[0006] Specifically, the present invention includes, but is not limited to, the following technical solutions: The present invention provides a C-glycosyltransferase mutant, the mutant being based on, as shown in SEQ ID NO. The wild-type GgCGT (WT) sequence shown in NO:1 was subjected to site-directed mutations at positions 155, 194, 200, 227, 381, 411, 424, 437, 456, and 457 as follows: (1) S155A; (2) V194D; (3) G200Y; (4) L227E; (5) K381P; (6) D411G; (7) G424A; (8) V437R; (9) G456S; (10) C457Q; (11) S155A+V194D+G200Y+L227E+K381P+D411G+G424A+V437R+G456S+C457Q. The above 10-site combination mutation is denoted as Mut10.
[0007] The present invention provides a polynucleotide encoding the nucleotide sequence of the C-glycosyltransferase mutant described in the present invention.
[0008] The present invention provides a recombinant vector comprising the nucleotide sequence described herein.
[0009] This invention provides a recombinant strain comprising the recombinant vector described herein.
[0010] The present invention provides a host cell comprising the polynucleotides described herein or the recombinant vectors described herein.
[0011] This invention provides the application of the mutant Mut10 recombinant strain in the efficient preparation of phlorizin-di-C-glucoside (Formula 1). The application aims to catalyze the formation of phlorizin-di-C-glucoside from phlorizin. The specific system includes sucrose synthase, a glycosyltransferase mutant, sucrose, uridine diphosphate, and phlorizin.
[0012]
[0013] Formula 1
[0014] Beneficial effects: This invention provides C-glycosyltransferase mutants with improved thermostability. Among them, 10 single-point mutants... 1 / 2 The value was 4.54–23.39 times higher than WT. The T value of the 10-site combinatorial mutant Mut10... m The value reached 90.7 ℃. Half-life t 1 / 2 The thermal stability value at 50 °C is 46.22 d, making it the most thermally stable UGT reported to date. The mutant Mut10 also exhibits good stability at 60 °C, 70 °C, and 80 °C, with a t value of 46.22 d. 1 / 2 The time limits were 4.70 days, 1.19 days, and 83.51 min, respectively. The mutant Mut10 showed 0.82–3.83 times greater tolerance to methanol, ethanol, isopropanol, and acetone compared to the WT mutant, and 9.94–12.63% greater tolerance to acidic conditions (pH 5.0 and pH 6.0). The mutant Mut10 maintained approximately 100% activity at 40–100 °C, over 97% activity at pH 6.0–9.0, and over 90% enzyme activity at pH 9.0–11.0. Furthermore, the catalytic efficiency (kJ) of the mutant Mut10 for phlorizin was [not specified]. cat / K m The yield is 1.20 times that of WT. In a reaction system at 50 °C, the space-time yield of phlorizin-di-C-glucoside per unit catalyst is 6.46 mM h⁻¹ g⁻¹, with a selectivity of 96.90%. In summary, the mutant Mut10 exhibits strong thermal stability while also demonstrating improved catalytic efficiency, organic solvent tolerance, and acid resistance. This C-glycosyltransferase, with its high catalytic activity and excellent thermal stability under industrial production conditions, has great application potential in fields such as pharmaceutical production. Attached Figure Description
[0015] Figure 1 This is an SDS-PAGE image of the recombinant proteins expressed by mutants S155A, V194D, G200Y, L227E, K381P, D411G, G424A, V437R, G456S, C457Q and Mut10 in Example 3 of the present invention.
[0016] Figure 2 This is a first-order kinetic fitting diagram of thermal inactivation of WT, mutant S155A, mutant V194D, mutant G200Y, mutant L227E, mutant K381P, mutant D411G, mutant G424A, mutant V437R, mutant G456S and mutant C457Q at 50 °C in Example 4 of the present invention.
[0017] Figure 3The figures show the first-order kinetic fit (a) and differential scanning calorimetry (DSC) curves of the mutant Mut10 in Example 4 of this invention at 50 °C.
[0018] Figure 4 The diagram shows the first-order kinetics of inactivation of the mutant Mut10 in Example 4 of this invention at 60 °C (a), 70 °C (b), and 80 °C (c).
[0019] Figure 5 The graphs show the thermal stability of the mutant Mut10 in Example 4 of this invention after incubation at 90 °C (a) and 100 °C (b).
[0020] Figure 6 This is a graph showing the acid-base tolerance test results of WT and the mutant Mut10 in Example 4 of the present invention.
[0021] Figure 7 This is a graph showing the organic solvent tolerance test results of WT and the mutant Mut10 in Example 4 of this invention.
[0022] Figure 8 This is a diagram showing the optimal temperature for the reaction of phloretin and UDP-Glc catalyzed by the mutant Mut10 in Example 4 of this invention.
[0023] Figure 9 This is a diagram showing the optimal pH for the reaction of phlorizin and UDP-Glc catalyzed by the mutant Mut10 in Example 4 of this invention.
[0024] Figure 10 This is a fitting graph of the Michaelis-Menten kinetic curves of WT(a) and mutant Mut10(b) in Example 4 of the present invention.
[0025] Figure 11 This is a flowchart illustrating the reaction process of glycosyl modification for UDP-glucose cycle regeneration achieved by coupling mutant Mut10 with sucrose synthase GmSUS in Example 5 of the present invention.
[0026] Figure 12 The image shows the LC-MS results of phlorizin-di-C-glucoside in Example 6 of this invention. Detailed Implementation
[0027] The specific embodiments of the present invention will be further described in detail below with reference to the examples. These examples are for illustrative purposes only and are not intended to limit the scope of the invention.
[0028] Example 1: Construction of Wild-type and Mutant Engineered Bacteria
[0029] The amino acid sequence of GgCGT is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2. The amino acid sequence of GmSUS is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.4. To construct an engineered *E. coli* strain expressing the GgCGT mutant, pET28a-GgCGT was used as a template, and stepwise single-point mutagenesis was performed using overlapping forward and reverse primers to complete 10-site combinational mutagenesis. The PCR reaction system consisted of: 0.7 μL template plasmid, 2 μL each of forward and reverse primers (Table 1), 25 μL Phanta Flash Master Mix, and double-distilled water to a final volume of 50 μL. After PCR amplification, the product was treated with DpnI enzyme to specifically degrade the template plasmid. The enzyme digestion reaction system consisted of: 5 μL PCR product, 2 μL DpnI enzyme, 2 μL DpnI enzyme buffer, and double-distilled water to a final volume of 20 μL. The reaction was carried out in a 37 ℃ water bath for 2 h. The PCR product treated with DpnI was transformed into *E. coli* DH5α competent cells using the standard heat shock method. The cells were plated on solid LB medium containing 100 mg / L kanamycin and incubated upside down at 37 °C for 12–16 h. Several single colonies were picked and inoculated into LB liquid medium containing antibiotics. Plasmids were extracted and their DNA was sequenced for verification. The correctly sequenced GgCGT mutant and GmSUS recombinant plasmid powder were dissolved in ddH2O and transformed into *E. coli* BL21(DE3) competent cells. The transformed BL21(DE3) competent cell solution was evenly spread on solid LB medium plates containing kanamycin and incubated at 37 °C for 12 h.
[0030] Table 1. Mutation primers using GgCGT as a template
[0031] Mutant site Primer S155A-F GTTTAGCTTTTTTGCGTATTTTCCGACCCTGGCGAA S155A-R TACGCAAAAAAGCTAAACATGGTCGCGCT V194D-F CACTGCTGGATCCGAACAGCCTGTTTGGCAAACT V194D-R TGTTCGGATCCAGCAGTGGCGGCGGAA G200Y-F CCTGTTTTATAAACTGTTTATGGAAGATAGCCCGA G200Y-R AACAGTTTATAAAACAGGCTGTTCGGCACC L227E-F GCATTGAAAAAGAGAGCCTGGAAGCGCTGAACG L227E-R CAGGCTCTCTTTTTCAATGCCTTCAAAGGTGTTCACCAGC K381P-F TGGCGTGCCAATTCTGGGCTGGCCGCTGCAT K381P-R AGCCCAGAATTGGCACGCCAAACCACGCCGCT D411G-F GAAAGAAGGCTGGGGCTGGGAAGGCGAA D411G-R AGCCCCAGCCTTCTTTCCACACGCCCCA V437R-F AGCCTGCGCATGAAAGCGACCCAAGTGAAAAAAGAT V437R-R TCGCTTTCATGCGCAGGCTTTCATCGTTCATCACTTCG G456S-F TGGGCGGTAGCTGCGAAGTGGCGCTGCA G456S-R TCGCAGCTACCGCCCACGCTAATCGCT C457Q-F GGTGGCCAAGAAGTGGCGCTGCAGAAACT C457Q-R CCACTTCTTGGCCACCGCCCACGCTAATC
[0032] Example 2: Fermentation of engineered Escherichia coli
[0033] Single colonies were picked and inoculated into 40 mL of LB liquid medium containing 1‰ kanamycin. The culture was incubated overnight at 37 °C and 200 rpm in a shaking incubator to obtain the seed culture. 4 mL of the seed culture was then inoculated into 400 mL of antibiotic-free LB liquid medium and incubated at 37 °C and 200 rpm for approximately 3 hours until OD (Organic Depth) was reached. 600 The concentration was increased to 0.6–0.8, and then isopropyl thiogalactoside (final concentration 0.1 mM) was added. The fermentation broth was then incubated overnight at 16 °C and 200 rpm with shaking for 16 h.
[0034] Example 3: Isolation and purification of the target protein
[0035] The fermentation broth was centrifuged at 8000 rpm for 5 min to collect bacterial cells containing the target protein. The cells were then resuspended in 50 mL of phosphate buffer (50 mM, pH 7.5) and disrupted three times using a high-pressure cell disruptor at 4 °C. The supernatant was obtained by centrifugation at 12000 rpm for 25 min and stored as the crude enzyme solution at 4 °C. The crude enzyme was purified by affinity chromatography using a 5 mL pre-packed HisTrap FF column. After washing the affinity chromatography column with 2–5 column volumes of deionized water, the column was equilibrated with 2–5 column volumes of 100% protein purification solution A (50 mM phosphate buffer, 150 mM sodium chloride, 25 mM imidazole, pH 7.5). The crude enzyme was loaded onto the column at a flow rate of 1.0 mL / min, and unbound proteins were removed with 20 column volumes of protein purification solution A. Then, a mixture of 95% protein purification buffer A and 5% protein purification buffer B (1 M imidazole) was used to remove weakly bound proteins from the chromatography column. Finally, the target protein was collected using a mixture of 80% protein purification buffer A and 20% protein purification buffer B. The collected protein samples were analyzed by SDS-PAGE, and the results are shown in the figure. Figure 1 .
[0036] Example 4: Determination of the enzymatic properties of mutants
[0037] (1) Enzyme activity assay
[0038] The enzyme activity of untreated WT (wt) cells reacted in a metal bath at 50 °C was used as a control, and the relative enzyme activity of mutant cells reacted in a metal bath at 50 °C was calculated. One unit of enzyme activity was defined as the amount of enzyme required to consume a unit concentration (1 mM) of substrate per unit time (1 min). Enzyme activity assay: A 200 μL reaction system was prepared, containing 10 μg of enzyme (phosphate buffer), UDP-Glc (final concentration 0.50 mM), and phlorizin (final concentration 0.25 mM). After reacting for 3 min, 200–1000 μL of methanol was added to terminate the reaction. The mixture was centrifuged at 12000 rpm for 1 min, and the supernatant was filtered through a 0.22 μm organic filter membrane to prepare the sample. The reaction products were detected using a Shimadzu C18 column (250 × 4.6 mm, 5 μm) with an HPLC instrument. The flow rate was 1.0 mL / min, and the column temperature was 40 °C. Gradient elution was used, and the specific method is as follows: mobile phase A: acetonitrile, mobile phase B: 1‰ formic acid; 0 min 15% A; 2 min 15% A; 3 min 30% A; 8 min 50% A; 12 min 95% A; 20 min 15% A, detection wavelength 270 nm.
[0039] (2) Thermal stability determination
[0040] The enzyme activity measured at different temperatures without heat treatment was taken as 100% (initial enzyme activity). The enzyme was placed in metal baths at different temperatures, and samples were taken at different time points, followed by a reaction in a 50 °C metal bath for 3 min. The residual enzyme activity of the mutants after heat treatment for different times was measured. The logarithm of the ratio of residual enzyme activity to initial enzyme activity was plotted against time t, and the inactivation kinetic constant k was obtained by fitting the curve. d Half-life via t 1 / 2 =ln(2) / k d Calculations were performed. The enzyme concentration was diluted to 0.50 mg / mL (phosphate buffer, pH 7.5), with phosphate buffer as a blank control, and detected using MicroCal PEAQ-DSC. The scanning temperature range was 30–100 °C, with a temperature change rate of 2 °C / min. T was analyzed using MicroCal PEAQ-DSC software. m Value. See results. Figure 2 -5, t of 10 single-point mutants S155A, V194D, G200Y, L227E, K381P, D411G, G424A, V437R, G456S and C457Q 1 / 2 The value was 4.54–23.39 times higher than that of WT. The t-value of the 10-site combined mutant Mut10... 1 / 2 The value at 50 °C is 46.22 d, T m The thermal stability value reached 90.7 °C, making it the most thermally stable UGT reported to date. The mutant Mut10 also exhibited good stability at 60 °C, 70 °C, and 80 °C, with its t... 1 / 2 The incubation times were 4.70 days, 1.19 days, and 83.51 minutes, respectively. After brief incubation at 90 °C and 100 °C, the mutant Mut10 still retained some enzyme activity.
[0041] (3) Determination of acid-base tolerance and organic tolerance
[0042] The enzyme was incubated in different pH buffers for 2 h. Enzyme activity measured directly in phosphate buffer at pH 7.5 was taken as 100%, and residual enzyme activity was calculated to determine the acid-base tolerance of the mutant enzyme. The enzyme was also incubated in phosphate buffers containing different organic solvents (30% v / v) for 1 h. Enzyme activity measured directly without added organic solvent was taken as 100%, and residual enzyme activity was calculated to determine the organic tolerance of the mutant enzyme. Results are shown below. Figure 6 and Figure 7 The mutant Mut10 showed 0.82–3.83 times greater tolerance to methanol, ethanol, isopropanol, and acetone than the WT mutant, and 9.94–12.63% greater tolerance to acidic conditions (pH 5.0, pH 6.0) than the WT mutant.
[0043] (4) Determination of optimal temperature and optimal pH
[0044] The reaction system was reacted in metal baths at 20–100 °C for 3 min (same as (1)) to calculate the relative enzyme activity at different temperatures. The reaction system was also reacted in metal baths with different pH buffers for 3 min (same as (1)) to calculate the relative enzyme activity at different temperatures. The buffers used were citrate buffer (pH 3.0, 4.0, 5.0, 6.0), phosphate buffer (pH 6.0, 7.0, 7.5, 8.0), Tris-HCl buffer (pH 8.0, 9.0), and carbonate buffer (pH 9.0, 10.0, 11.0). The results are shown in […]. Figure 8 and Figure 9 The mutant Mut10 retains approximately 100% activity at 40–100 °C, over 97% activity at pH 6.0–9.0, and over 90% enzyme activity at pH 9.0–11.0.
[0045] (5) Measurement of dynamic parameters
[0046] A 200 μL reaction system was prepared containing 100 ng of purified enzyme (phosphate buffer), UDP-Glc (final concentration 0.5 mM), and phlorizin (final concentration 1.25–8.00 μM). The reaction was carried out in a 50 °C metal bath for 3 min to calculate the relative enzyme activity. Kinetic parameters were obtained by fitting the Michaelis-Menten equation. The Michaelis-Menten kinetic curve fitting results for the wild-type enzyme GgCGT and the mutant Mut10 are shown in [Figure number missing]. Figure 10 This indicates that the mutant Mut10 has higher catalytic efficiency (k). cat / K m ).
[0047] Example 5: UDP cycling regeneration system coupled with sucrose synthase and glycosyltransferase
[0048] The reaction was carried out in HEPES buffer (50 mM) containing KCl (50 mM), MgCl2 (13 mM), and BSA (0.13%), with a final volume of 20 mL. Phloretin (20 mM), 2-mercaptoethanol (10 mM), and sucrose (500 mM) were dissolved in the reaction buffer, followed by the addition of a mutant enzyme (0.5 mg / mL) and GmSuSy (0.25 mg / mL). The reaction was initiated by adding UDP (2.0 mM) at 50 °C and pH 6.5. A second batch of 2-mercaptoethanol (10 mM) was added after 8 h. Samples were taken periodically during the reaction, and the conversion of phloretin was monitored by HPLC. The results are as follows: Figure 11As shown, in the reaction system at 50 °C, the space-time yield per unit catalyst for phlorizin-di-C-glucoside was 6.46 mM h⁻¹ g⁻¹, with a reaction selectivity of 96.90%. Phlorizin was efficiently converted into the target product phlorizin-di-C-glucoside, demonstrating that this coupling system has a high efficiency in UDP-glucose recycling and synthesis.
[0049] Example 6: Product Mass Spectrometry Determination
[0050] The reaction end products of Examples 4 and 5 were taken and detected by HPLC according to the method described in Example 4 (1), and mass spectrometry was performed using an Agilent 6460 Triple Quad LC-MS instrument. The mass spectrometry conditions were: negative ion mode scanning, scan range m / z 100-1000. The results are as follows. Figure 12 As shown, its [MH] was discovered. - The m / z value is 597.1808, which is similar to that of phlorizin-di-C-glucoside ([MH)). - This is consistent with the theoretical calculation (m / z = 598.27). The secondary fragment peaks in the mass spectrometry indicate that the target product's secondary fragment peak is [MH-240]. - m / z 357.0953, [MH-210] - m / z 387.1051, [MH-180] - The m / z value of 417.1148 matches the characteristics of a secondary fragment peak of a C-glycoside, and is consistent with the secondary fragment peak of its standard. Therefore, the target product is identified as phlorizin-di-C-glucoside.
Claims
1. A C-glycosyltransferase mutant, characterized in that, The mutant was obtained by mutating the wild-type GgCGT amino acid sequence as shown in SEQ ID NO.1 at the following sites: S155A; V194D; G200Y; L227E; K381P; D411G; G424A; V437R; G456S; C457Q.
2. The C-glycosyltransferase mutant according to claim 1, characterized in that, The mutant contains mutations at the following 10 sites: S155A+V194D+G200Y+L227E+K381P+D411G+G424A+V437R+G456S+C457Q. This 10-site combination mutant is named Mut10.
3. A polynucleotide, characterized in that, Encodes the C-glycosyltransferase mutant according to claim 1 or 2.
4. A recombinant vector, characterized in that, It contains the polynucleotide as described in claim 3.
5. A host cell, characterized in that, It contains the polynucleotide according to claim 3 or the recombinant vector according to claim 4.
6. The host cell according to claim 5, characterized in that, The host cell is an Escherichia coli cell.
7. The use of the C-glycosyltransferase mutant according to claim 1 or 2 or the host cell according to any one of claims 5-6 in the synthesis of phlorizin-di-C-glucoside (Formula 1). Formula 1.
8. The application according to claim 7, characterized in that, The application is in the catalysis of phlorizin to form phlorizin-di-C-glucoside, and its specific system includes sucrose synthase, a glycosyltransferase mutant, sucrose, uridine diphosphate, and phlorizin.
9. A method for preparing the C-glycosyltransferase mutant according to claim 1 or 2, characterized in that, The method includes the following steps: (a) Culture the host cells according to claim 5 or 6 under conditions suitable for the expression of the C-glycosyltransferase mutant; and (b) The C-glycosyltransferase mutant is isolated and purified from the host cell or culture.