Application of collagen gene Col15 in regulation and control of chilo suppressalis female sterility and green prevention and control

Abstract

The invention belongs to the technical field of biological prevention and control of agricultural pests, and particularly relates to application of a collagen gene Col15 in regulation and control of chilo suppressalis female sterility and green prevention and control. The key effect of Col15 in development of ovaries of chilo suppressalis is disclosed for the first time through bioinformatics identification, expression profile analysis, RNA interference and CRISPR / Cas9 gene editing technologies. Through targeted inhibition or interference of gene expression, ovarian development can be severely blocked, collagenous fiber deposition is reduced, oocyte maturation is blocked, the mating rate, the egg laying amount and the egg hatching rate of female insects are remarkably reduced, and finally female sterility is achieved. The invention provides a brand new target and technical support for developing a novel green pest prevention and control technology based on female reproduction regulation, has the characteristics of accurate technical effect, environment friendliness and strong sustainability, and has wide application prospects in biological treatment of pests.

Description

Technical Field

[0001] This invention belongs to the field of biological control technology, specifically involving the application of the collagen gene Col15 in regulating female sterility in the rice stem borer and in green control. Background Technology

[0002] The rice stem borer (Chilo suppressalis) is a highly destructive borer in rice production, posing a persistent threat to my country's food security. Currently, its control still heavily relies on chemical pesticides, which not only leads to increasingly serious pesticide resistance in the borer but also triggers a series of ecological and environmental problems and agricultural product safety issues. Therefore, developing efficient and green targeted control strategies has become an urgent need for sustainable agricultural development.

[0003] Against this backdrop, sterilization techniques targeting the insect reproductive system are considered one of the most promising directions for next-generation pest control due to their strong species specificity and environmental friendliness. The core of this technology lies in precisely interfering with the development of the female insect's ovary, thereby fundamentally curbing the pest population's reproduction. Normal ovarian development is a highly complex morphogenesis process, heavily reliant on the precise structural support and signaling communication between cells and the extracellular matrix. Collagen, as a key structural component of the extracellular matrix, plays a central role in maintaining tissue integrity and regulating cell behavior. However, although the functions of XV-type collagen in mammals and model organisms have been reported, its specific functional mechanism in the female reproductive system of major agricultural pests (especially the rice stem borer) remains unknown, severely hindering the development of novel control technologies targeting it. Summary of the Invention

[0004] This invention addresses a gap in existing technologies by providing a method for regulating female sterility in the rice stem borer (Col15) and its application in green pest control. This invention is the first to reveal and verify the indispensable role of the Col15 gene in the ovarian development of the rice stem borer. This discovery not only fills a research gap in the reproductive biology of XV-type collagen in lepidopteran pests, but more importantly, it provides a novel theoretical basis and molecular target for developing green pest control technologies targeting Col15, characterized by female sterility.

[0005] One objective of this invention is to provide the application of the *Col15* collagen gene from the rice stem borer as a target in at least one of the following A1)-A5): A1) Application in regulating female sterility in rice stem borer; A2) Application in the preparation of products that regulate female sterility in rice stem borer; A3) Application in regulating ovarian development in rice stem borer; A4) Application in the preparation of products that regulate the development of the ovaries of the rice stem borer; A5) Application in the control of rice stem borer; The amino acid sequence encoded by the collagen gene Col15 of the rice stem borer is shown in SEQ ID NO.2.

[0006] Furthermore, the regulation or prevention is achieved by reducing and / or interfering with the expression of the collagen gene Col15 of the rice stem borer or reducing its protein activity.

[0007] Furthermore, the nucleotide sequence of the *Col15* collagen gene from the rice stem borer is shown in SEQ ID NO.1.

[0008] A second objective of this invention is to provide an inhibitor of the Col15 collagen gene from the rice stem borer. The inhibitor is a substance that reduces the expression level or protein activity of the Col15 collagen gene from the rice stem borer, wherein the amino acid sequence encoded by the Col15 collagen gene from the rice stem borer is shown in SEQ ID NO.2.

[0009] Further, the inhibitor comprises: dsRNA consisting of a nucleotide sequence as shown in SEQ ID NO.3 and its reverse complementary sequence; and / or sgRNA as shown in any one or more of SEQ ID NO.4 to SEQ ID NO.7.

[0010] A third objective of this invention is to provide the application of the above-mentioned inhibitor in at least one of the following B1)-B6): B1) Application in the control of rice stem borer; B2) Application in the preparation of products for controlling rice stem borer; B3) Application in inhibiting ovarian development in rice stem borer; B4) Application in the preparation of products that inhibit the development of the ovaries of the rice stem borer; B5) Application in reducing the mating rate and / or egg production of female rice stem borers; B6) Application in the preparation of products that reduce the mating rate and / or egg production of female rice stem borers.

[0011] Furthermore, the inhibition of ovarian development in *Taenia solium* manifests as: reduced ovarian tube length, reduced oocyte width, reduced oocyte number, reduced yolk deposition, and / or reduced collagen fiber deposition in the ovary.

[0012] The fourth objective of this invention is to provide a method for preventing and / or inhibiting the ovarian development of the rice stem borer, by reducing and / or interfering with the expression of the rice stem borer collagen gene Col15 or reducing its protein activity, thereby inhibiting the ovarian development of the rice stem borer and / or preventing and controlling the rice stem borer.

[0013] Furthermore, the expression of the collagen gene Col15 in *Taxarius dioica* was reduced and / or interfered with using CRISPR / Cas9 gene editing technology or RNA interference technology.

[0014] Furthermore, the sgRNA sequences used in CRISPR / Cas9 gene editing technology are shown as any one or more of SEQ ID NO.4 to SEQ ID NO.7.

[0015] Furthermore, a method for reducing the expression of the collagen gene Col15 in rice stem borer using CRISPR / Cas9 gene editing technology includes: mixing any one or more of the sgRNAs shown in SEQ ID NO.4~SEQ ID NO.7 with Cas9 protein and then microinjecting them into the rice stem borer.

[0016] Furthermore, 150 ng / μL of sgRNA was mixed with 300 ng / μL of Cas9 protein and then microinjected at a volume of 1 nL per egg.

[0017] Furthermore, the dsRNA used in the RNA interference technology is a double-stranded RNA composed of the nucleotide sequence shown in SEQ ID NO.3 and its reverse complementary sequence.

[0018] Furthermore, the above-mentioned dsRNA was synthesized using primers as shown in SEQ ID NO.8 and SEQ ID NO.9.

[0019] Furthermore, methods for interfering with the expression of the collagen gene Col15 in rice stem borer using RNA interference technology include microinjecting dsRNA into the rice stem borer.

[0020] Furthermore, the concentration of the dsRNA is 5 μg / μL, and the injection volume is 500 nL.

[0021] Beneficial effects: 1. This invention reveals and verifies for the first time the indispensable role of the XV type collagen gene Col15 in the ovarian development of the rice stem borer, filling the research gap of XV type collagen in the reproductive biology of lepidopteran pests, and providing a new theoretical basis and molecular target for developing green control technology for the rice stem borer that targets Col15 and is characterized by "female sterility".

[0022] 2. This invention targets the Col15 gene through RNAi interference or gene knockout, which can cause severe abnormal ovarian development in female rice stem borers, resulting in a significant reduction in mating rate to 58.3%, a 70.2% reduction in egg production, and a sharp decrease in the hatching rate of the eggs to 32.5%, thus producing a highly effective inhibitory effect on population reproduction.

[0023] 3. The RNAi and CRISPR / Cas9 technologies used in this invention have high gene specificity. Through rationally designed sgRNA or dsRNA, the Col15 gene of the rice stem borer can be precisely targeted, minimizing the potential impact on non-target organisms and the ecological environment. This overcomes the drawbacks of indiscriminate toxicity and high pollution of traditional chemical pesticides, and has the characteristics of precise technical action and environmental friendliness.

[0024] 4. The implementation of this invention does not rely on the construction of complex transgenic insect strains. It can achieve sterility through feeding or microinjection of dsRNA or sgRNA, and also lays a core foundation for the future development of new green control products and Col15 gene-targeted control technology based on spraying or transgenic plants. It is in line with the research and development trend of green pesticides, and provides a new path to solve the problem of rice stem borer resistance. It has broad application prospects. Attached Figure Description

[0025] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 Figure 2 illustrates the expression pattern of Col15 in different developmental stages (A) and tissues (B) of the rice stem borer, as well as the phylogenetic tree (C) of Col15. Figure (A) shows the expression level of the Col15 gene at different developmental stages; Figure (B) shows the distribution of Col15 transcripts in various tissues of the female pupa; Figure (C) is a phylogenetic tree constructed using the maximum likelihood method based on the amino acid sequence alignment of the ColXV protein. Each branch is color-coded according to protein type, and Col15 of the rice stem borer is marked with a red star to indicate its phylogenetic position. (The internal reference gene is CsEF. Error bars represent the standard error of the mean (SD). Different letters on the bar chart indicate statistical differences between groups (p < 0.05). Data were analyzed using Tukey's test (one-way ANOVA). Abbreviations: Egg: egg; L1-L6: 1st to 6th instar larvae; FP1-6: female pupae 1-6 days after pupation; FA: female adult; Ov: ovary; Hd: head; Fb: fat body).

[0027] Figure 2This figure shows the effects (AE) and protein level changes (FG) of interfering with the Col15 gene on ovarian development in female pupae of the rice stem borer in Example 3 of this invention. Figure (A) shows the mRNA level of Col15 after injection of dscol15 and dsEGFP; Figure (B) shows a comparison of ovarian morphology between the dscol15 treatment group and the dsEGFP control group; Figure (C) shows the number of oocytes in the dscol15 treatment group and the dsEGFP control group; Figure (D) shows the width of oocytes in the dscol15 treatment group and the dsEGFP control group; Figure (E) shows the length of ovarian ducts in the dscol15 treatment group and the dsEGFP control group; Figure (F) shows the Western blot results of ColXV and Vg in the ovaries of the dsEGFP and dscol15 treatment groups; Figure (G) shows the quantitative analysis of the Western blot results of ColXV and Vg. (The internal control was α-Tubulin; statistical analysis was performed using a two-tailed Student's t-test, and p < 0.05 was considered statistically significant; dsEGFP: enhanced green fluorescent protein double-stranded RNA; dscol15: XV type collagen double-stranded RNA.) Figure 3 This invention provides an example of Masson staining in Example 4, demonstrating the effect of interfering with the Col15 gene on collagen fiber deposition in the ovaries of the rice stem borer. Figure (A) shows Masson's trichrome staining of the ovaries of female pupae in the dscol15 treatment group and the dsEGFP control group. Yellow arrows indicate collagen fibers, and red areas indicate myofibroblasts. Abbreviations: Oc, oocyte; Fc, follicular cell; ECM, extracellular matrix; Nc, trophoblast. Figure (B) shows the quantitative analysis of ovarian collagen content in the dscol15 treatment group and the dsEGFP control group (statistical analysis was performed using a two-tailed Student's t-test, and p < 0.05 was considered statistically significant).

[0028] Figure 4 This diagram shows the results of knocking out the Col15 gene using CRISPR / Cas9-mediated multi-sgRNA genome editing technology in Example 5 of this invention. Figure (A) is a schematic diagram of the sgRNA target site and mutation type. Exon 1 was selected as the target editing site. The diagram illustrates the CRISPR / Cas9 targeting strategy, which induces mutations at specific sites using guide RNA. The first row shows the wild-type sequence, and subsequent rows show different mutant clones. Deleted bases are indicated by short horizontal lines (--), and inserted bases are marked in red. Figure (B) is an agarose gel electrophoresis image of the PCR products from 10 mutant individuals and 1 wild-type control. M = 2000 bp DNA molecular weight standard.

[0029] Figure 5In Example 5 of this invention, Col15 gene knockout resulted in impaired oocyte development (AB) and reproductive capacity (DF) in female individuals. Figure (A) shows the ovarian anatomy of wild-type (WT) and Col15 knockout (Col15-KO) female pupae on day 6; Figure (B) shows the distribution of ovarian developmental grades in wild-type and knockout females, with a significantly higher proportion of delayed or abnormal ovarian development in knockout individuals compared to wild-type individuals; Figure (C) shows the immunoblotting and quantitative results of Col15 protein in ovarian tissues of wild-type and knockout individuals, using α-tubulin as an internal reference; Figure (D) compares the reproductive capacity of mating combinations of WT♂×WT♀ and KO♂×WT♀; Figure (E) compares the reproductive capacity of mating combinations of WT♂×WT♀ and WT♂×KO♀; Figure (F) shows the mating rate statistics of wild-type and mutant individuals (data analysis was performed using an unpaired two-tailed Student's t-test, with a p-value less than 0.05 considered statistically significant).

[0030] Figure 6 The off-target site sequencing verification results in Example 5 of this invention show the off-target detection results of four target sequences, indicating no off-target mutations. Detailed Implementation

[0031] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.

[0032] Example 1: Cloning and Bioinformatics Analysis of the Col15 Gene This invention is based on the gene sequence of the silkworm collagen family. Homologous genes in the rice stem borer were identified using BLASTp, and the full-length cDNA sequence of Col15 was obtained (SEQ ID NO.1). This gene encodes 1077 amino acids (SEQ ID NO.2) and contains typical domains such as Endostatin-like, gly_rich_SclB, and Collagen_trimer.

[0033] Example 2: Phylogenetic and Spatiotemporal Expression Analysis of Col15 (1) Phylogenetic analysis Multiple sequence alignment (MSO) of collagen homologous sequences from various insects, including the rice stem borer, sugarcane borer, Asian corn borer, and meadow stem borer, was performed using MAFFT v7.505. A phylogenetic tree was constructed in IQ-TREE v2.2.0 using the maximum likelihood method, and branch support was evaluated using a 1000-run ultrafast bootstrapping method. Results are as follows: Figure 1 As shown in Figure C, the results show that CsCol15 clusters with the known XV type collagen in the phylogenetic tree, and its position is marked with a red asterisk.

[0034] (2) Spatiotemporal expression spectrum analysis Head, ovary, and fat body tissues of different developmental stages of the rice stem borer (egg, 1-6 instar larvae, female pupae 1-6 days after pupation, and adult females) and female pupae on day 6 were collected, with three biological replicates for each sample. Total RNA was extracted using the TRIzol method, and after concentration and purity were determined by NanoDrop, reverse transcription was performed using the Hifair® II 1st Strand cDNA Synthesis Kit.

[0035] Expression analysis was performed using Hieff® qPCR SYBR Green Master Mix on a CFX96 Touch™ real-time quantitative PCR system, with CsEF as an internal reference gene. Primers used for quantitative PCR are shown in Table 1. Results are as follows: Figure 1 A and Figure 1 As shown in Figure B, the results indicate that the Col15 gene expression was highest during the egg stage and increased again on day 6 of the pupal stage; in tissues, expression was higher in the head and fat body, and lowest in the ovary, but still functionally significant.

[0036] Table 1. Primers for Cscol15 real-time PCR Example 3: Effects of Col15 RNAi on ovarian development (1) dsRNA preparation and injection Using T7 RiboMAX TM The Express RNAi System synthesized dsRNA targeting Col15 (target fragment 598 bp, SEQ ID NO.3), with EGFP dsRNA as a control. Primers used for dsRNA synthesis are shown in Table 2. 500 nL of dsRNA (5 μg / μL) was microinjected into the abdomen of the female pupa at 48 h and 96 h post-pupae. The ovary was dissected 48 h post-injection for phenotypic observation and molecular validation.

[0037] Table 2. Cscol15 interference primers (2) Phenotypic and molecular verification Forty-eight hours after the last injection, nine pupae were randomly selected, with three pupae constituting one biological replicate. RNA was extracted from the whole worms for reverse transcription, and the silencing efficiency of the Col15 gene was detected by qPCR (method as in Example 2). The results are as follows. Figure 2 As shown in Figure A, the qPCR results showed that, compared with the dsEGFP control group, the expression level of the Col15 gene in the dscol15 treatment group decreased by about 79%, which was significantly different from the control group (p < 0.05), indicating that the RNAi treatment of the present invention is effective.

[0038] Nine pupae were randomly selected 48 hours after the last injection. The ovaries were dissected, and their morphology was imaged using an SMZ-161 stereomicroscope (Motic China Group Co., Ltd., Xiamen, CN) and a D3400 digital camera (Nikon, Tokyo, JP). Ovarian morphology comparisons were made. Figure 2 As shown in Figure B, the results indicated a significant reduction in yolk deposition in the ovaries of the dscol15 treatment group, with abnormal ovarian morphology manifested as decreased oocyte width and significantly shortened ovarian duct length. Further statistical analysis was performed on the oocyte count, oocyte width, and ovarian duct length in the dscol15 treatment group and the dsEGFP control group. Each treatment group had three biological replicates, with each replicate containing three individuals. The results are shown in Figure B. Figure 2 As shown in C-2E, the results showed that, compared with the control group, the dscol15 treatment group had a 78.87% reduction in ovarian tube length, an 80.25% reduction in oocyte width, and a 75.21% reduction in the number of mature oocytes, which were highly significant differences from the control group (p < 0.0001).

[0039] Western blot was used to detect the protein levels of XV type collagen (Col15) and vitellogenin (Vg), key proteins directly related to ovarian development. Ovaries were dissected on day 6 after dscol15 injection, and total ovarian protein was extracted using Western blot and IP cell lysis buffer (Coolaber, Beijing, China), following the manufacturer's standard procedure. Protein concentration was determined using a BCA protein quantification kit (Beyotime, Shanghai, China). For Western blot analysis, protein samples were separated by SDS-PAGE electrophoresis and then transferred to PVDF membranes (Bio-Rad, Hercules, CA, USA). After transfer, the membranes were blocked in blocking buffer containing 5% (w / v) skim milk powder for ≥4 hours at room temperature. After blocking, the membranes were incubated with specific primary antibodies for 2 hours. After primary antibody incubation, the membranes were washed three times and then incubated with the corresponding horseradish peroxidase (HRP)-labeled secondary antibody (Servicebio, Wuhan, China) for 1 hour at room temperature. Development was performed using ECL chemiluminescent substrate (Thermo Fisher Scientific, Waltham, MA, USA), and the grayscale values ​​of the bands were quantitatively analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA). Primary antibodies: rabbit anti-CsVg antibody (1:5,000; Genscript, Nanjing, China); rabbit anti-COLXV antibody (1:5,000; Genscript); rabbit anti-α-Tubulin antibody (1:5,000; Servicebio). Secondary antibodies: HRP-labeled goat anti-rabbit IgG (1:3,000; Genscript) was used for detecting VG, COLXV, and α-Tubulin proteins. dsEGFP was used as a control. Western blot results and quantitative analysis are as follows: Figure 2 As shown in FG, the results showed that the levels of ColXV and vitellogenin (Vg) protein in the dscol15 treatment group decreased by 84.30% and 86.54% respectively compared with the control group, indicating that Col15 silencing seriously affected ovarian development and vitellogenin deposition.

[0040] Example 4: Effects of Col15 Interference on Ovarian Collagen Structure On day 6 post-dscol15 injection, the ovaries of female *Taxodium difficile* pupae were dissected, fixed in 4% paraformaldehyde (PFA), and sent to Wuhan Pinofi Biotechnology Co., Ltd. for paraffin embedding, sectioning, and Masson's trichrome staining. Ovaries from pupae injected with dsEGFP on day 6 served as controls. Quantitative analysis of collagen deposition in the stained sections was performed using Fiji version ImageJ software. Results are as follows: Figure 3As shown, the results indicated that collagen fiber deposition in the ovaries of the interference group, i.e., the dscol15 treatment group, was significantly reduced. Figure 3 A) indicates that silencing the Col15 gene significantly inhibits collagen fiber deposition in the ovary. ImageJ quantitative analysis further confirmed that the collagen content in the dscol15 treatment group was significantly reduced by approximately 63.10% compared to the control group (p < 0.05). Figure 3 (B) The above results indicate that Col15 affects ovarian structure and development by regulating collagen deposition in the extracellular matrix.

[0041] Example 5: CRISPR / Cas9-mediated Col15 gene knockout and its effects on rice stem borer reproduction and population control (1) sgRNA design and in vitro transcription Four sgRNA targets were screened and designed in the first exon of the Col15 gene using the sgRNA cas9 software (Xie et al., 2014). The primers used to synthesize the four targets are shown in Table 3. sgcol15-1:TGAGTTGAACATAGACGATG (SEQ ID NO.4) sgcol15-2:GCGCTGTGCTTTACACCTCT (SEQ ID NO.5) sgcol15-3:CAAACTAATCTTCGTCACGT (SEQ ID NO.6) sgcol15-4:TCCACTCCTCCTTCTCAATT (SEQ ID NO.7) Table 3. Cscol15 knockout targets The sgRNA template was then synthesized using PCR technology and MEGAscript was used in accordance with the manufacturer's instructions. TM In vitro transcription was performed using a T7 RNA polymerase kit (Thermo Fisher Scientific, USA), and the quality of sgRNA was verified by gel electrophoresis.

[0042] sgRNA synthesis: Step 1 Step 2 (2) Embryo microinjection Fresh egg masses of the rice stem borer (Chilodonella esculenta) were collected within 4 hours of oviposition. After sterilization with 75% ethanol and washing with distilled water, four sgRNAs (150 ng / μL each) were mixed with 300 ng / μL Cas9 protein (Thermo Fisher Scientific, USA) and microinjected at a volume of 1 nL per egg (Sun et al., 2022). Microinjection was performed on newly laid eggs in two independent experiments. A total of 474 eggs were injected, resulting in 261 pupae, of which 25 were mutant males and 22 were mutant females.

[0043] (3) Mutant screening and genotyping During the initial emergence period, the hind legs of adult insects were collected, and genomic DNA of the mutant was extracted. Specific primers were designed targeting the flanking region of the sgRNA target: Upstream primer: AACTCAAACGCGCCTTGAACAGT Downstream primer: TTCCGACTTAGGCGTGCGTTTTG PCR amplification of the region containing the sgRNA target was performed using specific primers. The amplified products were separated by agarose gel electrophoresis, purified by gel excision, cloned into the pCE2 TA / Blunt-Zero vector, and Sanger sequencing was performed. Eight mutation types were identified: 253bp deletion, 88bp deletion, 134bp deletion, 239bp deletion with 9bp insertion, 164bp deletion, 164bp deletion with 5bp insertion, 238bp deletion with 15bp insertion, and 268bp deletion. Figure 4 (A, 4B). The number of mutated individuals after each batch of injection was counted to obtain the editing efficiency (Table 4). The results showed that the CRISPR / Cas9 system can effectively knock out the Col15 gene of rice stem borer.

[0044] Table 4. Editing efficiency of Cas9 / sgRNA-targeted knockout of the Col15 gene in the rice stem borer. a. Number of eggs injected b. Number and percentage of hatched individuals (%) c. Number and percentage of surviving larvae (%) d. Number and percentage of larvae that successfully pupated (%) e. Number, percentage (%), and sex ratio of mutant pupae (4) Off-target effect analysis Potential off-target sites for each sgRNA target were predicted using the sgRNAcas9 software, and the two sites with the highest probabilities were selected for validation. Three mutants and one wild-type individual were randomly selected, and the target region was amplified by PCR and Sanger sequencing was performed (primer sequences are shown in Table 5). The sequencing results are as follows: Figure 6 As shown, the results indicated that no off-target mutations were detected, confirming that the phenotype was indeed caused by the knockout of the Col15 gene.

[0045] Table 5. Off-target detection primers (5) Analysis of ovarian developmental abnormalities and protein expression Twelve wild-type (WT) and Col15 knockout (Col15-KO) female pupae were collected on day 6. The ovaries were dissected, observed and photographed under a microscope. The developmental grade of the female ovaries of wild-type (WT) and Col15 knockout (Col15-KO) pupae was statistically analyzed according to the grading criteria shown in Table 6.

[0046] Table 6. Ovarian Development Grades of Rice Stem Borer The results are as follows Figure 5 A and Figure 5 As shown in B, morphological observation revealed that 41.66% of the mutant individuals exhibited abnormal ovarian development (8.33% of which were severely abnormal and 33.33% were moderately abnormal), while only 16.67% of the wild-type individuals showed mild abnormalities.

[0047] Western blot was used to detect the Col15 protein level in wild-type (WT) and Col15 knockout (Col15-KO) ovarian tissues (using α-tubulin as an internal control), and ImageJ software was used for quantitative analysis of protein content. The results are as follows: Figure 5 As shown in Figure C, the results showed that the expression level of collagen XV in the mutant ovary decreased by 28.09% compared with the control group, indicating that the CRISPR / Cas9 system can effectively knock out the Col15 gene of the rice stem borer and cause its functional protein to be lost, which further leads to the abnormal development of the rice stem borer ovary.

[0048] (6) Assessment of mating behavior and reproductive capacity To comprehensively evaluate the combined effects of Col15 gene knockout on the mating behavior and reproductive capacity of rice stem borer, this invention conducted systematic mating behavior and reproductive capacity analysis experiments.

[0049] Mating Experiment: An inverted transparent plastic cup was placed on a petri dish for the mating experiment. A cotton ball moistened with honey water was placed inside the cup to provide nutrition and humidity. A mutant female moth, which had emerged one day prior and whose genotype had been identified, was paired with a wild-type male moth. A control group was also established, consisting of wild-type female moths paired with wild-type male moths. Each mating combination was repeated at least 20 times. All experiments were conducted for two days in a climate-controlled chamber and continuously recorded using a Xiaomi camera (Xiaomi Technology, Beijing). Mating success rate was determined by reviewing the recorded footage. The number of eggs laid by each female moth was recorded after the experiment.

[0050] The mating experiment results showed that the mating rate of the mutant male was 72.0%, which was not significantly different from that of the wild type (71.4%), and the egg production of the paired wild females was not affected. Figure 5 D, 5F); while the mating rate of the mutant female was significantly reduced to 58.3%, and the number of eggs laid was significantly lower than that of the control group, with a significant reduction of 70.2% ( Figure 5 The differences were highly significant (p < 0.001) at E and 5F. These results indicate that Col15 gene knockout specifically impairs the mating behavior and reproductive capacity of female rice stem borers, while having no significant effect on males. Corresponding to the findings that Col15 silencing severely affects ovarian development and yolk deposition, this suggests that silencing or knocking out Col15 can effectively affect ovarian development in rice stem borers, thereby reducing their mating rate and egg production.

[0051] (7) Evaluation of the effect of population reproduction suppression Further analysis of the hatching rates of eggs laid by wild-type and mutant females under standard culture conditions revealed that the average hatching rate of the mutant females was only 32.5%, significantly lower than the 89.6% of the wild-type group (p < 0.001). This indicates that even if a few mutant females successfully mate and lay eggs, the embryonic development capacity of their eggs is severely impaired, possibly due to insufficient deposition of intraegg substances (such as vitellin Vg) or defects in the eggshell structure. These results demonstrate that Cscol15 gene knockout can significantly inhibit the reproductive capacity of the rice stem borer population.

[0052] In summary, this invention, through RNAi interference experiments, reveals and verifies for the first time the indispensable role of the Col15 gene in the ovarian development of the rice stem borer. Interfering with the expression of this gene effectively leads to severe ovarian developmental inhibition, reduced collagen fiber deposition, and impaired oocyte maturation, thereby achieving female sterility. Further, CRISPR / Cas9-mediated Col15 gene knockout experiments verified that knocking out this gene effectively affects the ovarian development of female rice stem borers, thereby reducing their mating rate and egg production, and severely impairing the embryonic development capacity of the eggs. Based on this method, mutations in female rice stem borers significantly reduce the number of viable offspring, producing a highly effective inhibitory effect on population reproduction. This invention not only fills the research gap in XV-type collagen in the reproductive biology of lepidopteran pests but also provides a novel theoretical basis and molecular target for developing a green control technology for rice stem borers targeting Col15, characterized by female sterility, with broad application prospects.

[0053] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. Application of the *Taxarius dioica* collagen gene Col15 as a target in at least one of the following A1)-A5): A1) Application in regulating female sterility in rice stem borer; A2) Application in the preparation of products that regulate female sterility in rice stem borer; A3) Application in regulating ovarian development in rice stem borer; A4) Application in the preparation of products that regulate the development of the ovaries of the rice stem borer; A5) Application in the control of rice stem borer; in, The amino acid sequence encoded by the collagen gene Col15 of the rice stem borer is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The regulation or prevention is achieved by reducing and / or interfering with the expression of the collagen gene Col15 of the rice stem borer or reducing its protein activity.

3. The application according to claim 1, characterized in that, The nucleotide sequence of the collagen gene Col15 of the rice stem borer is shown in SEQ ID NO.

1.

4. A Col15 inhibitor of the collagen gene in the rice stem borer, characterized in that, The inhibitor is a substance that reduces the expression level or protein activity of the collagen gene Col15 from the rice stem borer, wherein the amino acid sequence encoded by the collagen gene Col15 from the rice stem borer is shown in SEQ ID NO.

2.

5. The inhibitor according to claim 4, characterized in that, The inhibitor comprises: dsRNA consisting of a nucleotide sequence as shown in SEQ ID NO.3 and its reverse complementary sequence; and / or sgRNA as shown in any one or more of SEQ ID NO.4 to SEQ ID NO.

7.

6. The use of the inhibitor according to any one of claims 4-5 in at least one of the following B1)-B6): B1) Application in the control of rice stem borer; B2) Application in the preparation of products for controlling rice stem borer; B3) Application in inhibiting ovarian development in rice stem borer; B4) Application in the preparation of products that inhibit the development of the ovaries of the rice stem borer; B5) Application in reducing the mating rate and / or egg production of female rice stem borers; B6) Application in the preparation of products that reduce the mating rate and / or egg production of female rice stem borers.

7. A method for preventing and / or inhibiting the ovarian development of the rice stem borer, characterized in that, By reducing and / or interfering with the expression of the collagen gene Col15 of the rice stem borer or reducing its protein activity, the ovarian development of the rice stem borer can be inhibited and / or the rice stem borer can be controlled.

8. The method according to claim 7, characterized in that, Reduce and / or interfere with the expression of the collagen gene Col15 in the rice stem borer using CRISPR / Cas9 gene editing or RNA interference techniques.

9. The method according to claim 8, characterized in that, The sgRNA sequences used in CRISPR / Cas9 gene editing technology are shown as any one or more of SEQ ID NO.4 to SEQ ID NO.

7.

10. The method according to claim 8, characterized in that, The dsRNA used in RNA interference technology is a double-stranded RNA consisting of the nucleotide sequence shown in SEQ ID NO.3 and its reverse complementary sequence.

Images