Genetically engineered bacterium, construction method and application

Abstract

The invention belongs to the technical field of genetic engineering and biological fermentation, and particularly relates to a genetically engineered bacterium, a construction method and application, the genetically engineered bacterium simultaneously contains a dehydrogenase gene and a hydrolase gene, the dehydrogenase is 3-ketosteroid-delta1-dehydrogenase, the nucleotide sequence of the dehydrogenase gene is SEQ ID No.5, and the corresponding protein sequence is SEQ ID No.6; the hydrolase is esterase, the nucleotide sequence of the hydrolase gene is SEQ ID No.7, and the corresponding protein sequence is SEQ ID No.8; according to the present invention, the enzyme liquid of the genetically engineered bacterium is adopted to convert substrates such as hydrocortisone acetate and 6 alpha-methyl hydrocortisone acetate, the conversion is complete within the high substrate content and the short time, the conversion rate reaches 99%, and the genetically engineered bacterium is suitable for industrial production.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and bio-fermentation technology, specifically relating to a genetically engineered bacterium, its construction method, and its application. Background Technology

[0002] Methylprednisolone (11β,17α,21-trihydroxy-6α-methylpregn-1,4-diene-3,20-dione) and prednisolone (chemical name: 11β,17α,21-trihydroxypregn-1,4-diene-3,20-dione) are widely used glucocorticoid drugs in clinical practice. They have potent anti-inflammatory, immunosuppressive, and anti-allergic effects and are used for autoimmune diseases, organ transplant rejection, and allergic inflammation, respectively. These drugs are not only key drugs for treating various inflammatory and immune diseases, but also important precursors for the synthesis of high-value-added derivatives (such as prednisolone sodium phosphate and methylprednisolone sodium succinate).

[0003] Existing preparation processes have limitations and technical bottlenecks. Currently, industrial production mainly relies on biotransformation and chemical synthesis methods, but both have significant drawbacks: 1. The current process for prednisolone uses cortisone acetate as raw material, employing a combination of bio-fermentation dehydrogenation and a three-step chemical reaction (Bacillus fermentation dehydrogenation, followed by ketone group protection and reduction under the action of aminourea hydrochloride and potassium borohydride, and then deprotection with sodium nitrite and hydrolysis with potassium hydroxide). This process has the following problems: 1) Traditional bio-fermentation dehydrogenation requires strict control: high aseptic requirements, complex post-processing, and a production cycle of up to 18 days per batch; 2) High energy consumption and pollution: high chemical oxygen demand (COD) in fermentation wastewater, resulting in high energy consumption; 3) Low conversion rate: conversion rate ≤95.0%, substrate needs to be recycled and reused, with a yield of 90%. The reaction route is shown below: .

[0004] 2. The current process for methylprednisolone uses Protodyakonov oxide as a raw material, and involves four synthetic steps: ketal reaction, sodium borohydride reduction, peracid epoxidation, and Grignard methylation, to obtain the 6-methylprednisolone compound. It is then produced via bio-fermentation dehydrogenation, iodination replacement, and hydrolysis. The bio-fermentation dehydrogenation process suffers from problems such as low conversion rate, long fermentation cycle (7 days / batch), high energy consumption, and low yield (85%). The reaction route is as follows: .

[0005] 3. The α-hydroxy ketone structure of the D-ring-17-side chain in corticosteroid drugs is a key pharmacodynamic group, but it is prone to intramolecular rearrangement and oxidative cleavage in alkaline environments, ultimately transforming into inactive 17-ketone byproducts, affecting product quality. The reaction conditions are harsh: it must be carried out at low temperatures of 0-5℃, using strongly alkaline reagents (such as NaOH or KOH) and a complex organic solvent system (a mixture of dichloromethane, tetrahydrofuran, and methanol). Furthermore, environmental and safety issues are prominent: excessive organic solvents (used to dissolve the substrate and stabilize intermediates) increase costs; the use of strong alkalis not only increases process hazard but also generates high-concentration alkaline wastewater, exacerbating environmental pressures. By strictly controlling the temperature, optimizing the solvent system, and limiting the amount of alkali used, the hydrolysis of the 21-ester group can be achieved while suppressing byproduct formation. The chemical method for the strong-base hydrolysis synthesis of 21-esters (taking methylprednisolone as an example) is as follows: .

[0006] Enzymatic synthesis of key steps in steroid synthesis has become an indispensable technology in the preparation of steroid active pharmaceutical ingredients and intermediates. However, existing steroid dehydrogenases and hydrolases, when catalyzing structurally complex and diverse corticosteroid drugs, fail to meet the requirements of industrial production in terms of efficiency and versatility. They generally suffer from high costs, difficult waste treatment, numerous byproducts, and low yields, becoming key bottlenecks restricting production.

[0007] Therefore, developing a new, efficient, green, and industrially suitable preparation process is a key technical challenge that urgently needs to be overcome in the field of steroid drug manufacturing. Summary of the Invention

[0008] The technical problem to be solved by this invention is to provide a genetically engineered bacterium, a construction method and an application to improve the conversion rate of substrates and increase the yield of prednisolone and methylprednisolone.

[0009] This invention provides a genetically engineered bacterium containing both a dehydrogenase gene and a hydrolase gene. The dehydrogenase is 3-ketosteroid-Δ1-dehydrogenase, the nucleotide sequence of which is SEQ ID No. 5, and the corresponding protein sequence is SEQ ID No. 6. The hydrolase is an esterase, the nucleotide sequence of which is SEQ ID No. 7, and the corresponding protein sequence is SEQ ID No. 8.

[0010] Preferably, the host strain of the genetically engineered bacteria is Escherichia coli BL21(DE3).

[0011] This invention provides a method for constructing the genetically engineered bacteria, comprising the following steps: 1) Using PET28a-KstD plasmid as a template, PCR amplification was performed using primers 1 and 2 to obtain the KstD gene, which is the 3-ketosteroid-Δ1-dehydrogenase gene; 2) The amplification product and the pRSFDuet-1 empty vector were double-digested with BamHI and HindIII, respectively; 3) After the enzyme digestion products are recovered from the gel, they are ligated using T4 DNA ligase to construct the pRSF-KstD recombinant plasmid; 4) The pRSF-KstD recombinant plasmid was transformed into T5a competent cells, and positive clones were obtained through antibiotic selection and PCR verification; 5) Using PET28a-Esterase plasmid as a template, PCR amplification was performed using primers 3 and 4 to obtain the esterase gene Esterase; 6) The amplification product and the pRSF-KstD recombinant plasmid were double-digested with KpnI and XhoI, respectively; 7) After the enzyme digestion products were recovered from the gel, they were ligated using T4 DNA ligase to construct the pRSF-KstD-Esterase recombinant plasmid; 8) The recombinant plasmid was transformed into BL21(DE3) competent cells. Positive clones were obtained through resistance selection and PCR verification and named pRSF-KstD-Esterase-BL21, i.e., genetically engineered bacteria. Primer 1 is SEQ ID No. 1, with the sequence cgcggatccatgcaggactggaccagcg. Primer 2 is SEQ ID No. 2, with the sequence cccaagcttacttcgccatgtcctgg. Primer 3 is SEQ ID No. 3, with the sequence cggggtaccggagggggaccccaccgtcgcccg. Primer 4 is SEQ ID No. 4, and its sequence is ccgctcgagttgcgctagctccgtgactgcctttc.

[0012] Preferably, the PCR amplification program for steps 1) and 5) is 98℃ for 3 min; 98℃ for 15 s; 55℃ for 15 s; 72℃ for 30 s, repeated 30 times, and then incubated at 16℃.

[0013] Preferably, after PCR amplification, the PCR product is subjected to 1% agarose gel electrophoresis and calibrated with a DL2000 marker to verify whether it is within the target gene size range.

[0014] This invention provides an application of the genetically engineered bacteria, wherein the genetically engineered bacteria are fermented and cultured, and then processed (generally by centrifugation) to obtain an enzyme solution (generally by homogenization); the enzyme solution is added to a mixture containing a substrate, and PMS is added to initiate the reaction to obtain the product; the substrate is hydrocortisone acetate or / and 6α-methylhydrocortisone acetate.

[0015] Preferably, the mixture contains isopropanol, defoamer, buffer solution and water.

[0016] Preferably, the buffer solution is a dipotassium hydrogen phosphate-potassium dihydrogen phosphate buffer solution.

[0017] Preferably, the reaction temperature is 30°C.

[0018] Preferably, the pH value of the reaction is controlled at 7.8-8.

[0019] The beneficial effects of this invention are that it constructs a highly active genetically engineered bacterium containing both 3-ketosteroid-Δ1-dehydrogenase and esterase genes, and co-expresses these two enzymes. The dehydrogenase and hydrolase are constructed into a dual-expression vector, and both expressed enzymes exhibit activity and function normally. Furthermore, the dehydrogenase activity in the co-expressed strain is nearly identical to that in the strain expressing the dehydrogenase alone. This shortens the continuous enzyme catalysis process into a single step, reducing material losses during post-processing such as filtration and extraction. Only one engineered bacterium needs to be fermented during enzyme production, reducing the risk of fermentation failure.

[0020] The enzyme solution of the genetically engineered bacteria of this application was used to transform the substrates hydrocortisone acetate and 6α-methyl hydrocortisone acetate. The transformation was complete and the conversion rate reached 99% in a short time with high substrate content, making it suitable for industrial production. Attached Figure Description

[0021] Figure 1 This is the hydrogen spectrum of prednisolone according to the present invention.

[0022] Figure 2 This is the liquid phase spectrum of prednisolone according to the present invention. Detailed Implementation

[0023] Example 1 A method for constructing a genetically engineered bacterium includes the following steps: 1. Using the PET28a-KstD plasmid (vector: PET28a, target gene: KstD, i.e., the 3-ketosteroid-Δ1-dehydrogenase gene KstD) as a template, primer 1 sequence is SEQ ID No. 1, and primer 2 sequence is SEQ ID No. 2; the primers were sent to Changsha Qingke for synthesis. The nucleotide sequence of the 3-ketosteroid-Δ1-dehydrogenase gene KstD is SEQ ID No. 5, and the corresponding protein sequence is SEQ ID No. 6.

[0024] Primers 1 and 2 were used to amplify the KstD gene by PCR using the PET28a-KstD plasmid as a template. The reagent used was Takara PrimeSTAR Max DNA Polymerase, and the PCR system was prepared according to its instructions. The PCR program was: 98℃ for 3 min; 98℃ for 15 s; 55℃ for 15 s; 72℃ for 30 s, repeated 30 times, followed by incubation at 16℃. Verification: The PCR products were subjected to 1% agarose gel electrophoresis and calibrated using a DL2000 marker. A PCR product with a length between 1000 bp and 1500 bp was considered the target band. The PCR products were then purified by gel extraction.

[0025] The recovered KstD PCR product and pRSFDuet-1 empty vector plasmid were double-digested with restriction enzymes (purchased from Takara) BamHⅠ and HindⅢ. The corresponding bands of the PCR and plasmid digestion were recovered by gel extraction.

[0026] The target band and plasmid recovered from the gel were ligated using T4 DNA ligase (purchased from Takara) and incubated overnight at 16°C. The ligation product (pRSF-KstD) was introduced into T5a competent cells, plated onto LB agar plates containing kanamycin, and incubated at 37°C until single colonies grew. Single colonies were selected for PCR verification, and positive clones were cultured for preservation, yielding the engineered strain pRSF-KstD-DH5a.

[0027] 2. Using the PET28a-Esterase plasmid (target gene is the esterase gene Esterase) as a template, primers were designed: primer 3 (SEQ ID No. 3) and primer 4 (SEQ ID No. 4), which were sent to Changsha Qingke for synthesis. The nucleotide sequence of the esterase gene Esterase is SEQ ID No. 7, and the corresponding protein sequence is SEQ ID No. 8.

[0028] Primers 3 and 4 were used to amplify the Esterase gene by PCR using the PET28a-Esterase plasmid (Esterase is an esterase) as a template. The PCR program was 98℃ for 3 min; 98℃ for 15 s; 55℃ for 15 s; 72℃ for 30 s, repeated 30 times, followed by incubation at 16℃. Verification: The PCR product was run on a 1% agarose gel and calibrated using a DL2000 marker. A PCR product between 1000-1500 bp was considered the target band.

[0029] The PCR products were purified using gel extraction. A portion of the recovered PCR products and the pRSF-KstD plasmid were double-digested with restriction enzymes (purchased from Takara) KpnI and XhoI. The gel-extracted PCR products and plasmid digested with these enzymes yielded the correct bands. The target band and plasmid were ligated overnight at 16°C using T4 DNA ligase (purchased from Takara). The ligation product was labeled pRSF-KstD-Esterase.

[0030] The ligation product was introduced into BL21(DE3) competent cells, plated onto LB agar plates containing kanamycin resistance, and incubated at 37°C until single colonies grew. Single colonies were selected for PCR verification, and positive clones were cultured for preservation, yielding the engineered strain pRSF-KstD-Esterase-BL21.

[0031] SEQ ID No.1: cgcggatccatgcaggactggaccagcg, SEQ ID No.2:cccaagcttacttcgccatgtcctgg, SEQ ID No.3: cggggtaccggagggggaccccaccgtcgcccg, SEQ ID No. 4: ccgctcgagttgcgctagctccgtgactgcctttc.

[0032] SEQ ID No. 5: 1 atgcaggact ggaccagcga gtgcgacgtg ttggtagtcg gctccggcgg cggagcgctg 61 accggcgcat ataccgccgc tgctcaggga ttgacgacga tcgtcctcga gaaaaccgat 121 cgtttcggcg ggacctccgc ctactcgggc gcctcgatct ggctcccagg tacccaggtg 181 caggaacgcg ccggacttcc cgactcgacc gagaatgccc gcacctatct gcgcgcgttg 241 ctcggtgacg ccgagtccga gcgccaggac gcctacgtcg agaccgctcc cgctgtcgtc 301 gctctactcg agcagaaccc gaacatcgaa ttcgagttcc gtgcgttccc cgactactac 361 aaagccgaag gccggatgga cacgggacgc tccatcaacc ctctcgatct cgatcccgcc 421 gacatcggtg acctcgccgg caaggtgcgt ccggaactgg accaagaccg caccggtcag 481 gatcatgctc ccggcccgat gatcggtggg cgcgcactga tcggccgtct gctggccgca 541 gttcagagca ccggtaaggc agaacttcgc accgaatccg tcctcacctc cctgatcgtg 601 gaagacggcc gtgttgtcgg cgccgaggtc gaatccggcg gcgaaaccca gcgaatcaag 661 gcgaaccgcg gtgtcctgat ggcagcaggc ggcatcgaag gcaacgccga gatgcgtgag 721 caggccggca cccccggcaa ggcgatctgg agtatgggtc ccttcggcgc caacaccggc 781 gacgcgatct ccgccggaat tgccgtcggc ggcgcaacag ccttgctcga tcaggcgtgg 841 ttctgccccg gcgtcgagca gcccgacggc agcgccgcct tcatggtcgg cgttcgcggt 901 gggctcgtcg tcgacagcgc cggtgagcgc tacctcaacg agtcgcttcc gtacgaccag 961 ttcggacgag ccatggatgc tcacgacgac aacggttctg ccgtgccgtc gttcatgatc 1021 ttcgactcgc gcgagggtgg cggactgccc gccatctgca tcccgaacacggcgcccgcc 1081 aagcacctcg aagccggaac ctgggtcggt gccgacactc tcgaagaactcgctgccaag 1141 accggactac cggccgacgc attgcgcagc actgtcgaaa agttcaacgatgccgcaaaa 1201 ctgggcgtcg acgaagagtt ccatcgcggc gaagacccgt acgacgcgttcttctgccca 1261 cccaacggtg gtgcgaatgc ggcactgacg gccatcgaga acggtccgttctacgcggcc 1321 cgcatcgtcc tcagtgacct cggcaccaag ggcggattgg tcaccgacgtcaacggccga 1381 gtcctgcgtg ctgacggcag cgccatcgac ggcctttacg ccgcaggcaacacgagcgcg 1441 tcactgagcg gccgcttcta ccccggcccc ggagttccac tcggcacggccatggtcttc 1501 tcgtaccgag cagcccagga catggcgaag taa。

[0033] SEQ ID No.6: MQDWTSECDV LVVGSGGGAL TGAYTAAAQG LTTIVLEKTD RFGGTSAYSG ASIWLPGTQV QERAGLPDST ENARTYLRAL LGDAESERQD AYVETAPAVV ALLEQNPNIE FEFRAFPDYYKAEGRMDTGR SINPLDLDPA DIGDLAGKVR PELDQDRTGQ DHAPGPMIGG RALIGRLLAA VQSTGKAELR TESVLTSLIV EDGRVVGAEV ESGGETQRIK ANRGVLMAAG GENEALOGICAL REVIEW SMGPFGANTG DAISAGIAVG GATALLDQAW FCPGVEQPDG SAAFMVGVRG GLVVDSAGER YLNESLPYDQ FGRAMDAHDD NGSAVPSFMI FDSREGGGLP AICIPNTAPA KHLEAGTWVG JUDGES TGLPADALRS TVEKFNDAAK. LGVDEEFHRG EDPYDAFFCP PNGGANAALT AIENGPFYAA RIVLSDLGTK GGLVTDVNGR VLRADGSIDE GLYAGNTSA SLSGRFYPGP GVPLGTAMVF。

[0034] SEQ ID No.7: 1 ggcggtgggc cgcaccgccg cccggattcc gtgaccggtg tttctcctg ctccaaggga 61 gtatccgggc tggtcatcgc acttttggtc caggacggct tcctcgacct cgacgccgaa 121 gtgtcaagt actggccgga attcggcgcc gaaggaagg ccacgattac cgtggcccag 181 ctgctctccc accaggccgg gcttctggga gtcgaggcg gactcaccct cgcggaatac 241 aacaactccg aactggccgc cgccaagctc gcgcagatgc ggccgctgtg gaagcccggg 301 accgccttcg ggtaccacgc cctgaccatc ggcgtcttca tggaggact ttgccgccgg 361 atcaccgggt ccacgctcca ggaaatctac gaacagcgga tccgctcggt cacgggcgcc 421 cacttcttcc tgggactgcc tgagtccgag gaacccgct atgccaccct ccgttgggct 481 gcagacccct cccagccgtg gattgatccc gccagccatt tcggcctttc cgcaaactcg 541 gccgtgggg acatccttga cctgcccaac ctccgcgagg tccgcgcagc cggcctgagt 601 tcagccgccg gagtcgccag cgcggaaggc atggcccgcg tctacgctgc ggcactcacc 661 ggacttgccg ccaacggcga ccgagccgcc gtcgcgcccc tcctcagcga agagaccactc 721 caaaccgtca cggccgagca ggtcttcggc atcgaccggg tgttcggcga gacgagctgc 781 tttgggacag tgttcatgaa atcgcatgca cgctcgcctt atggcagcta ccgggcgttc 841 gggcacgacg gcgccagcgc atctttgggg ttcgctgacc ctgtgtatga actcgcttc 901 gggtacgtgc cgcaacaggc cgagccgggc ggagcgggat gccgcaacct tgagctgagc 961 gccgccgtgc ggaaggcagt caccgaactg gctcagtag.

[0035] SEQ ID No. 8: GGGPHRRPDS VTGVFSCSKG VSGLVIALLV QDGFLDLDAE VVKYWPEFGA EGKATITVAQ LLSHQAGLLG VEGGLTLAEY NNSELAAAKL AQMRPLWKPG TAFGYHALTI GVFMEELCRR ITGSTLQEIY EQRIRSVTGA HFFLGLPESE EPRYATLRWA ADPSQPWIDP ASHFGLSANS AVGDILDLPN LREVRAAGLS SAAGVASAEG MARVYAAALT GLAANGDRAA VAPLLSEETI QTVTAEQVFG IDRVFGETSC FGTVFMKSHA RSPYGSYRAF GHDGASASLG FADPVYELAF GYVPQQAEPG GAGCRNLELS AAVRKAVTEL AQ.

[0036] Example 2 Enzyme solution preparation: Prepare 100 mL of LB liquid medium as seed culture medium and autoclave at 121 °C for 20 min. After cooling, use an inoculation loop to pick a single colony from Example 1 and inoculate it into the medium. Incubate overnight at 37 °C and 200 rpm to prepare the seed culture. Prepare 1 L of fermentation medium using LB liquid medium. Inoculate 20 mL of the overnight cultured seed culture medium into the fermentation medium and incubate at 37 °C and 200 rpm until the O.D600 reaches 0.6-0.8. Add IPTG to a final concentration of 0.01 mM to induce expression for 12 hours. Collect the bacterial cells by centrifugation at 8000 rpm at 4 °C. Weigh a portion of the bacterial cells, resuspend them in pure water, adjust the pH to 7.0 with phosphate, prepare a 300 g / L bacterial suspension, and add a small amount of nuclease. Disrupt the cells using an autoclave and store at -20 °C.

[0037] Enzyme activity assay: 1. The reagents are: Hydrocortisone acetate stock solution: Dissolve 0.09 g of hydrocortisone acetate in deionized water by sonication, dilute to 100 mL in a volumetric flask, and store at 4 °C.

[0038] DCPIP stock solution: Dissolve 0.035 g of 2,6-dichlorophenolindophenol in distilled water and bring the volume up to 100 mL. Store at 4 °C.

[0039] 50mM Tris-HCl (pH 8.0): Weigh 5g of Tris, dissolve it in distilled water and bring the volume to 100mL. Store at 4℃.

[0040] 2. Reaction: 2.1 Grouping: Experimental group (3 groups) and control group (1 group).

[0041] 2.2 Sample addition Experimental group: Add 50mM Tris-HCl solution, volume 0.2mL; then add 10μL DCPIP stock solution and 70μL hydrocortisone acetate stock solution, mix well, incubate at 30℃ for 10min, and then add 20μL of appropriately diluted enzyme solution.

[0042] Control group: An equal volume of Tris-HCl solution was added instead of the enzyme solution.

[0043] After thorough mixing, the absorbance change was measured at 600 nm using an ELISA reader within 1 minute.

[0044] Enzyme activity is defined as the amount of enzyme required to reduce 1 μM DCPIP per minute under optimal conditions, which is one unit (U).

[0045] Example 3

[0046] Weigh 12g of hydrocortisone acetate into a conversion flask, add 75mL of pure water, 5mL of isopropanol, and 1g of defoamer, stir to disperse evenly, then add 10mL of dipotassium hydrogen phosphate-potassium dihydrogen phosphate buffer (pH 8.0, 0.1M), and continue stirring at 30℃ until evenly mixed.

[0047] Add 5 mL of enzyme solution with a concentration of 300 g / L, and finally add 0.01 g of PMS to start the reaction. During the reaction, the pH of the system was controlled at 7.8-8.0 using 10% sodium hydroxide solution. The substrate residue was monitored by TLC during the reaction. Take 0.1 mL of the reaction sample, add 0.4 mL of dichloromethane as the extraction solvent, shake thoroughly, centrifuge for 20 s, and use a capillary pipette to collect the supernatant, spotting it onto a silica gel thin-layer plate. The developing solvent was dichloromethane:methanol = 15:1, and UV color development was performed. The conversion rate was 99% after 24 h. The obtained system was filtered, the filter cake was dried, mixed with 1 g of activated carbon, and extracted twice with ethyl acetate (100 mL each time). The residue was removed by hot filtration, and the filtrates were combined and concentrated to a paste. After cooling to 5-10℃, the mixture was filtered and dried at 50℃ to obtain 10.2 g of white solid, which was identified by NMR as prednisolone, with a weight yield of 85% and an HPLC purity of 99.36%. The proton and liquid phase spectra of prednisolone are as follows: Figure 1-2 As shown.

[0048] Hydrocortisone acetate: 1 H NMR (500 MHz, CDCl3) δ 5.56 (d, J = 2.1 Hz, 1H), 4.97 – 4.76 (m, 2H), 4.38 – 4.27 (m, 1H), 2.66 – 2.52 (m, 1H), 2.37 (ddd, J =16.1, 13.8, 5.1 Hz, 2H), 2.29 – 2.19 (m, 1H), 2.18 – 2.09 (m, 2H), 2.07 (d, J= 6.7 Hz, 3H), 2.01 – 1.86 (m, 3H), 1.83 – 1.58 (m, 4H), 1.41 – 1.35 (m, 1H),1.34 (d, J = 5.1 Hz, 3H), 1.30 (dd, J = 11.2, 6.2 Hz, 1H), 1.08 – 0.95 (m,1H), 0.89 (dd, J = 11.2, 3.3 Hz, 1H), 0.78 (s, 3H). 13C NMR (126 MHz, CDCl3) δ206.1, 201.1, 174.5, 171.5, 121.7, 89.4, 68.4, 67.7, 56.0, 52.0, 49.4, 49.2,49.0, 48.9, 48.7, 48.5, 48.4, 47.3, 39.3, 39.2, 34.6, 33.8, 33.6, 32.8, 32.2,31.4, 23.6, 20.7, 20.4, 16.6.

[0049] Prednisolone: 1 H NMR (400 MHz, DMSO- d6 ) δ 7.31 (d, J = 10.1 Hz, 1H), 6.15 (dd, J = 10.1, 1.8 Hz, 1H), 5.91 (t, J = 1.6 Hz, 1H), 5.18 (s, 1H), 4.73 –4.61 (m, 2H), 4.49 (dd, J = 19.1, 5.9 Hz, 1H), 4.27 (t, J = 3.3 Hz, 1H), 4.07(dd, J = 19.1, 5.9 Hz, 1H), 2.62 – 2.52 (m, 2H), 2.29 (dd, J = 13.1, 4.3 Hz,1H), 2.01 (dd, J = 11.7, 7.7 Hz, 2H), 1.85 (dd, J = 13.6, 3.6 Hz, 1H), 1.71 –1.50 (m, 3H), 1.38 (s, 3H), 1.34 – 1.20 (m, 1H), 1.00 (qd, J = 13.0, 4.5 Hz,1H), 0.88 (dd, J = 11.0, 3.4 Hz, 1H), 0.77 (s, 3H). 13 C NMR (101 MHz, DMSO- d6 ) δ212.1, 187.7, 172.8, 158.4, 126.8, 121.5, 88.7, 69.4, 66.6, 55.3, 51.1, 47.3,44.5, 39.1, 34.0, 33.4, 32.0, 31.1, 23.7, 20.5, 16.8.

[0050] Example 4

[0051] Weigh 30g of 6α-methylhydrocortisone acetate into a conversion flask, add 188 mL of pure water, 12.5 mL of isopropanol, and 2.6 g of defoamer, stir to disperse evenly, then add 26 mL of dipotassium hydrogen phosphate-potassium dihydrogen phosphate buffer (pH 8.0, 0.1M), and continue stirring at 30℃ until evenly mixed.

[0052] 12.5 mL of enzyme solution with a concentration of 300 g / L was added, followed by 0.2 g of PMS to initiate the reaction. During the reaction, the pH of the system was controlled at 7.8-8.0 using 10% sodium hydroxide solution. The substrate residue was monitored by TLC during the reaction. 0.1 mL of the reaction sample was taken, and 0.4 mL of dichloromethane was added as the extraction solvent. After thorough shaking, the mixture was centrifuged for 20 s. The supernatant was aspirated using a capillary pipette and spotted onto a silica gel thin-layer plate. The developing solvent was dichloromethane:methanol = 10:1, and UV colorimetric analysis was performed. The conversion rate was 99% after 24 h of conversion. The resulting system was filtered, the filter cake was dried, and mixed with 3 g of activated carbon. The mixture was then refluxed twice with dichloromethane and methanol (200 mL each time, dichloromethane:methanol = 3:1). The residue was removed by hot filtration, and the filtrates were combined and concentrated to a paste. After cooling to 5-10℃ and filtering, the solid was dried at 50℃ to obtain 25.8g of white solid, which was identified as methylprednisolone by NMR, with a weight yield of 86% and an HPLC purity of 99.2%.

[0053] 6α-Methylhydrocortisone acetate: 1H NMR (400 MHz, DMSO- d6) δ 5.50 (s, 1H, H-4), 5.39 (s, 1H, OH-17), 5.08 (d, J = 17.6 Hz, 1H, H-21), 4.74 (d, J = 17.6 Hz, 1H, H-21), 4.35 (d, J = 3.9 Hz, 1H, OH-11), 4.26 (t, J = 3.6 Hz, 1H, H-11), 2.59 – 2.44 (m, 3H), 2.34 (ddd, J = 16.7, 12.2, 4.8 Hz, 1H), 2.20 (dt, J = 16.3, 5.1 Hz, 1H), 2.09 (d, J = 1.3 Hz, 3H), 2.04 (td, J = 9.5, 8.8, 4.7 Hz, 2H), 1.94 (ddd, J = 14.7, 9.4, 3.6 Hz, 3H), 1.83 (td, J = 12.8, 4.1 Hz, 1H), 1.65 (h, J = 7.0 Hz, 3H), 1.51 – 1.39 (m, 1H), 1.35 (s, 3H), 1.32 – 1.21 (m, 1H), 0.98 (d, J = 6.3 Hz, 3H, CH3-6), 0.89 (dd, J = 11.1, 3.1 Hz, 1H), 0.76 (s, 3H), 0.75 – 0.65 (m, 1H). 13C NMR (101 MHz, DMSO- d6 ) δ 205.3 (C-20), 198.2 (C-3), 175.4 (C-5), 169.7 (OCCH3), 118.7 (C-4), 88.6, 67.5, 66.5, 55.4, 51.5, 46.9, 42.0, 39.2, 34.2, 33.2, 33.2, 32.5, 30.9, 23.3, 21.8, 20.4, 18.1, 16.6。

[0054] Methylprednisolone: 1 1H NMR (400 MHz, DMSO- d6) δ 7.32 (d, J = 10.1 Hz, 1H, H-1),6.17 (dd, J = 10.1, 1.8 Hz, 1H, H-2), 5.82 (t, J = 1.7 Hz, 1H, H-4), 5.76 (s,1H, OH-21), 5.49 (s, 1H, OH-17), 4.74 (d, J = 17.0 Hz, 1H, H-21), 4.65 (d, J= 3.2 Hz, 1H, OH-11), 4.38 (d, J = 17.0 Hz, 1H, H-21), 4.33 – 4.22 (m, 1H, H-11), 2.65 (dq, J = 11.4, 5.2 Hz, 1H), 2.56 (ddd, J = 14.6, 11.1, 2.2 Hz, 1H),2.12 (td, J = 11.0, 4.1 Hz, 1H), 2.04 (dq, J = 12.5, 4.6, 4.2 Hz, 1H), 1.88(dd, J = 13.6, 3.6 Hz, 1H), 1.70 – 1.52 (m, 3H), 1.51 – 1.40 (m, 1H), 1.38(s, 3H), 1.31 (dd, J = 11.2, 6.1 Hz, 1H), 1.04 (d, J = 6.3 Hz, 3H, CH3-6),0.85 (dd, J = 11.2, 3.4 Hz, 1H), 0.78 (s, 3H), 0.71 (q, J = 12.1 Hz, 1H). 13 CNMR (101 MHz, DMSO- d6 ) δ 203.2 (C-20), 185.1 (C-3), 173.4 (C-5), 157.2 (C-1),126.7 (C-2), 118.8(C-4), 89.2, 68.3, 55.8, 54.9, 50.8, 48.8, 46.7, 44.0,42.8, 33.0, 32.4, 30.8, 23.4, 21.3, 17.6, 17.0。

[0055] Those skilled in the art should understand that the discussion of any of the above embodiments is merely exemplary and is not intended to imply that the scope of protection of this application is limited to these examples; within the framework of this application, the technical features of the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other variations of different aspects of one or more embodiments of this application as described above, which are not provided in detail for the sake of brevity.

[0056] One or more embodiments in this application are intended to cover all such substitutions, modifications, and variations that fall within the broad scope of this application. Therefore, any omissions, modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of one or more embodiments in this application should be included within the protection scope of this application.

Claims

1. A genetically engineered bacterium, characterized in that, The genetically engineered bacteria contain both a dehydrogenase gene and a hydrolase gene. The dehydrogenase is 3-ketosteroid-Δ1-dehydrogenase, and the nucleotide sequence of the dehydrogenase gene is SEQ ID No. 5, while the corresponding protein sequence is SEQ ID No.

6. The hydrolase is an esterase, and the nucleotide sequence of the hydrolase gene is SEQ ID No. 7, while the corresponding protein sequence is SEQ ID No.

8.

2. The genetically engineered bacterium as described in claim 1, characterized in that, The host strain of the genetically engineered bacteria is Escherichia coli BL21(DE3).

3. A method for constructing genetically engineered bacteria as described in claim 1 or 2, characterized in that, Includes the following steps: 1) Using PET28a-KstD plasmid as a template, PCR amplification was performed using primers 1 and 2 to obtain the KstD gene, which is the 3-ketosteroid-Δ1-dehydrogenase gene; 2) The amplification product and the pRSFDuet-1 empty vector were double-digested with BamHI and HindIII, respectively; 3) After the enzyme digestion products are recovered from the gel, they are ligated using T4 DNA ligase to construct the pRSF-KstD recombinant plasmid; 4) The pRSF-KstD recombinant plasmid was transformed into T5a competent cells, and positive clones were obtained through antibiotic selection and PCR verification; 5) Using PET28a-Esterase plasmid as a template, PCR amplification was performed using primers 3 and 4 to obtain the esterase gene Esterase; 6) The amplification product and the pRSF-KstD recombinant plasmid were double-digested with KpnI and XhoI, respectively; 7) After the enzyme digestion products were recovered from the gel, they were ligated using T4 DNA ligase to construct the pRSF-KstD-Esterase recombinant plasmid; 8) The recombinant plasmid was transformed into BL21(DE3) competent cells. Positive clones were obtained through resistance selection and PCR verification and named pRSF-KstD-Esterase-BL21, i.e., genetically engineered bacteria. Primer 1 is SEQ ID No. 1, with the sequence cgcggatccatgcaggactggaccagcg. Primer 2 is SEQ ID No. 2, with the sequence cccaagcttacttcgccatgtcctgg. Primer 3 is SEQ ID No. 3, with the sequence cggggtaccggagggggaccccaccgtcgcccg. Primer 4 is SEQ ID No. 4, and its sequence is ccgctcgagttgcgctagctccgtgactgcctttc.

4. The construction method as described in claim 3, characterized in that, The PCR amplification program for steps 1) and 5) is as follows: 98℃ for 3 min; 98℃ for 15 s; 55℃ for 15 s; 72℃ for 30 s, for 30 cycles, and then incubated at 16℃.

5. The construction method as described in claim 3, characterized in that, After PCR amplification, the PCR products were subjected to 1% agarose gel electrophoresis and calibrated using a DL2000 marker to verify whether they were within the target gene size range.

6. The application of a genetically engineered bacterium as described in claim 1 or 2, characterized in that, The genetically engineered bacteria were fermented and cultured to obtain an enzyme solution; the enzyme solution was added to a mixture containing substrate, and PMS was added to initiate the reaction to obtain the product; The substrate is hydrocortisone acetate or / and 6α-methyl hydrocortisone acetate.

7. The application as described in claim 6, characterized in that, The mixture contains isopropanol, defoamer, buffer solution, and water.

8. The application as described in claim 7, characterized in that, The buffer solution is a potassium dihydrogen phosphate-potassium dihydrogen phosphate buffer.

9. The application as described in claim 6, characterized in that, The reaction temperature is 30℃.

10. The application as described in claim 6, characterized in that, The pH value of the reaction is controlled at 7.8-8.

Images