Promoter, promoter flank and application of promoter flank
By adding a 6-position complement sequence after the TAATACGACTCACTATAAG T7 promoter to form a new promoter, the problem of reduced RNA yield was solved, and a significant improvement in RNA yield and translation efficiency was achieved in the co-transcription system.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-26
- Publication Date
- 2026-03-27
AI Technical Summary
In existing technologies, the TAATACGACTCACTATAAG T7 promoter leads to a decrease in the yield of RNA transcribed in vitro, which affects the industrial production of RNA vaccines.
A new promoter is formed by adding a 6-position complement sequence after the existing sequence of the TAATACGACTCACTATAAG T7 promoter, which is used to increase RNA yield.
It significantly improves RNA yield and translation efficiency in co-transcription systems with different buffers, and exhibits better stability.
Smart Images

Figure BDA0005063452130000041 
Figure BDA0005063452130000061 
Figure BDA0005063452130000071
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to a promoter, a promoter flanking region and application thereof. BACKGROUND
[0002] RNA vaccine is to introduce mRNA containing antigen protein into human body, directly translate to form corresponding antigen protein, so as to induce specific immune response of the body, and achieve the effect of preventive immunity.
[0003] Up to now, there are 3 RNA vaccines approved for marketing worldwide, 2 of which are against SARS-CoV-2 and 1 of which is against respiratory syncytial virus (RSV). And with the excellent performance of RNA vaccine in the COVID-19 pandemic, it is further confirmed that the drug developed on the basis of RNA has great potential. In vitro transcription (IVT) is the core step of large-scale production of RNA vaccine, which generally refers to the process of using T7 RNA polymerase, T3 RNA polymerase and SP6 RNA polymerase to transcribe linear DNA into RNA in vitro. The co-transcription system has the advantages of high capping efficiency and translation efficiency, and the commonly used cap analog is m7(3'OMeG)(5')ppp(5')(2'OMeA)pG. The RNA prepared by the TAATACGACTCACTATAAG T7 promoter has higher translation efficiency than the traditional TAATACGACTCACTATAGG, but the TAATACGACTCACTATAAG T7 promoter will lead to the reduction of the yield of in vitro transcribed RNA, and thus affect the industrial production of RNA products. SUMMARY
[0004] Therefore, the present application provides a promoter, a promoter flanking region and application thereof. The present application increases 6 "complementary position sequences" after the T7 core sequence based on the existing sequence of the TAATACGACTCACTATAAG T7 promoter as the core sequence, so as to improve the yield of RNA.
[0005] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions:
[0006] In a first aspect, the present application provides a promoter flanking region, and the nucleotide sequence of the promoter flanking region comprises GX2X3X4X5X6.
[0007] X2 is selected from A or G;
[0008] X3 is selected from A, G or C;
[0009] X4, X5 and X6 are each selected from A, T, C or G.
[0010] In some embodiments of the present application, the promoter flanking sequence has:
[0011] (I) any of the nucleotide sequences shown in GGCGGG, GGGCGG, GGGGCC, GGGGGC, GGAATT, GAATAA, GGGCCC, GGGGGG, GGGTGG, GGGAAT; or
[0012] (II) a nucleotide sequence obtained by modifying, substituting, deleting or adding one or more bases to the nucleotide sequence shown in (I) or a nucleotide sequence functionally similar to the nucleotide sequence shown in (I); or
[0013] (III) a sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology to the nucleotide sequence shown in (I) or (II).
[0014] In a second aspect, the present application further provides the use of the promoter flanking sequence in any of the following:
[0015] (I) constructing a promoter, an expression cassette, an expression vector or a host;
[0016] (II) formulating a transcription system;
[0017] (III) synthesizing RNA;
[0018] (IV) improving the yield and / or translation efficiency of RNA;
[0019] (V) preparing a vaccine; and / or
[0020] (VI) preparing a transcription reagent or a transcription kit.
[0021] In a third aspect, the present application further provides a promoter, which comprises a core sequence and the promoter flanking sequence.
[0022] In some embodiments of the present application, the core sequence comprises but is not limited to a T7 promoter having the nucleotide sequence shown in SEQ ID No. 7.
[0023] In some embodiments of the present application, the promoter has:
[0024] (I) any of the nucleotide sequences shown in SEQ ID No. 1-2, SEQ ID No. 4, SEQ ID No. 6 and SEQ ID No. 11-16; or
[0025] (II) the nucleotide sequence as shown in any of (I) modified, substituted, deleted or added with one or more bases, or the nucleotide sequence functionally similar to the nucleotide sequence as shown in any of (I); or
[0026] (III) the sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology with the nucleotide sequence as shown in any of (I) or (II).
[0027] In a fourth aspect, the present application further provides the use of the promoter in any of the following:
[0028] (I) constructing an expression cassette, an expression vector or a host;
[0029] (II) formulating a transcription system;
[0030] (III) synthesizing RNA;
[0031] (IV) improving the yield and / or translation efficiency of RNA;
[0032] (V) preparing a vaccine; and / or
[0033] (VI) preparing a transcription reagent or a transcription kit.
[0034] In a fifth aspect, the present application further provides an expression cassette, which comprises the promoter flanking or the promoter.
[0035] In a sixth aspect, the present application further provides the use of the expression cassette in any of the following:
[0036] (I) constructing an expression vector or a host;
[0037] (II) formulating a transcription system;
[0038] (III) synthesizing RNA;
[0039] (IV) improving the yield and / or translation efficiency of RNA;
[0040] (V) preparing a vaccine; and / or
[0041] (VI) preparing a transcription reagent or a transcription kit.
[0042] In a seventh aspect, the present application further provides an expression vector, which comprises the promoter flanking, the promoter or the expression cassette.
[0043] In an eighth aspect, the present application further provides the use of the expression vector in any of the following:
[0044] (I) constructing a host;
[0045] (II) formulating a transcription system;
[0046] (III) synthesizing RNA;
[0047] (IV) improving the yield and / or translation efficiency of RNA;
[0048] (V) preparing a vaccine; and / or
[0049] (VI) preparing a transcription reagent or transcription kit.
[0050] In a ninth aspect, the present application further provides a host, which is transfected or transformed with the promoter flanking, the promoter, the expression cassette or the expression vector.
[0051] In a tenth aspect, the present application further provides a transcription system, which comprises the promoter or the expression vector.
[0052] In some embodiments of the present application, the transcription system comprises a co-transcription system.
[0053] The co-transcription system comprises, in 20 μL:
[0054]
[0055]
[0056] The buffer pair comprises Tris-HCl and / or HEPES-KOH.
[0057] In an eleventh aspect, the present application further provides use of the transcription system in any one of:
[0058] (I) synthesizing RNA;
[0059] (II) improving the yield and / or translation efficiency of RNA;
[0060] (III) preparing a vaccine; and / or
[0061] (IV) preparing a transcription reagent or transcription kit.
[0062] In a twelfth aspect, the present application further provides a transcription reagent, which comprises the promoter, the expression vector or the transcription system.
[0063] In a thirteenth aspect, the present application further provides use of the transcription reagent in any one of:
[0064] (I) synthesizing RNA;
[0065] (I) synthesizing RNA;
[0066] (II) improving the yield and / or translation efficiency of RNA;
[0067] (III) preparing a vaccine; and / or
[0068] (IV) preparing a transcription kit.
[0069] In a fourteenth aspect, the present application further provides a transcription kit comprising the promoter, the expression vector, the transcription system or the transcription reagent.
[0070] In a fifteenth aspect, the present application further provides use of the transcription kit in any one of the following:
[0071] (I) synthesizing RNA;
[0072] (II) improving the yield and / or translation efficiency of RNA; and / or
[0073] (III) preparing a vaccine.
[0074] The present application provides a promoter, a promoter flanking sequence and the use thereof. The present application is based on the existing sequence of TAATACGACTCACTATAAG T7 promoter as a core sequence, and increases 6 "complementary position sequences" after the T7 core sequence. The new promoter is used in the co-transcription system of different buffers to produce RNA, wherein,
[0075] Sequence 1 (as shown in SEQ ID No. 1): TAATACGACTCACTATAAGGGCGGG, Sequence 2 (as shown in SEQ ID No. 2): TAATACGACTCACTATAAGGGGCGG, Sequence 4 (as shown in SEQ ID No. 4): TAATACGACTCACTATAAGGGGGCC, Sequence 6 (as shown in SEQ ID No. 6): TAATACGACTCACTATAAGGGGGGC; Sequence 11 (as shown in SEQ ID No. 11): TAATACGACTCACTATAAGGGAATT, Sequence 12 (as shown in SEQ ID No. 12): TAATACGACTCACTATAAGGAATAA, Sequence 13 (as shown in SEQ ID No. 13): TAATACGACTCACTATAAGGGGCCC, Sequence 14 (as shown in SEQ ID No. 14): TAATACGACTCACTATAAGGGGGGG, Sequence 15 (as shown in SEQ ID No. 15): TAATACGACTCACTATAAGGGGTGG, Sequence 16 (as shown in SEQ ID No. 16): TAATACGACTCACTATAAGGGGAAT can improve the yield of RNA. Among them,
[0076] Sequence 2 (as shown in SEQ ID No. 2): TAATACGACTCACTATAAGGGGCGG, Sequence 11 (as shown in SEQ ID No. 11): TAATACGACTCACTATAAGGGAATT, Sequence 12 (as shown in SEQ ID No. 12): TAATACGACTCACTATAAGGAATAA, Sequence 13 (as shown in SEQ ID No. 13): TAATACGACTCACTATAAGGGGCCC, Sequence 14 (as shown in SEQ ID No. 14): TAATACGACTCACTATAAGGGGGGG, Sequence 15 (as shown in SEQ ID No. 15): TAATACGACTCACTATAAGGGGTGG, Sequence 16 (as shown in SEQ ID No. 16): TAATACGACTCACTATAAGGGGAAT can be applied to any co-transcriptional RNA preparation system for improving the yield of RNA.
[0077] The promoter provided by the application has more stable yield and translation efficiency than the mainstream TAATACGACTCACTATAAG in different systems and coding sequences. Especially in the co-transcriptional system, the yield of RNA can be significantly improved. BRIEF DESCRIPTION OF DRAWINGS
[0078] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced.
[0079] Figure 1 Structure of RNA expression vector;
[0080] Figure 2 RNA yield under different promoters in a co-transcription system based on Tris-HCl buffer;
[0081] Figure 3 RNA yield under different promoters in a co-transcription system based on HEPES-KOH buffer;
[0082] Figure 4 RNA yield under different promoters in a co-transcription system based on commercialized kit. DETAILED DESCRIPTION
[0083] The present application discloses a promoter, promoter flanking and application thereof, and those skilled in the art can refer to the content herein, and appropriately improve the process parameters. It is particularly pointed out that all similar replacements and changes are obvious to those skilled in the art, and they are all regarded as included in the present application. The method and application of the present application have been described by the preferred embodiments, and the related personnel can obviously modify or appropriately change and combine the method and application described herein without departing from the content, spirit and scope of the present application, to realize and apply the present application technology.
[0084] The reagent consumables used in the embodiments of the present application are shown in Table 1.
[0085] Table 1
[0086]
[0087]
[0088] The promoter sequence used in the embodiments of the present application is formed by taking TAATACGACTCACTATAAG as a core sequence and filling 6 “complementary base” positions after the core sequence. The new promoter sequence is shown in Table 2.
[0089] Table 2
[0090]
[0091]
[0092] The promoter sequence in Table 2 is constructed into a plasmid as a template for RNA preparation (the structure diagram of the RNA expression vector is as shown inFigure 1 The expression of the target protein is GFP protein, and the RNA sequence is as follows (as shown in SEQ ID No. 17):
[0093] ATGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAATGA
[0094] Explanation of terms:
[0095] A "promoter" refers to a nucleic acid, i.e., a polynucleotide sequence, which controls the transcription of an operably linked nucleic acid. The promoter can include the signals recognized and acted on by RNA polymerase and transcription initiation. The promoter(s) used will be functional in the cell type of the host cell in which the expression of the operably linked nucleic acid is involved. A large number of promoters, including constitutive, inducible and repressible promoters from a variety of different sources, are well known in the art (and are identified in databases such as GenBank). They can be obtained from or within a cloned polynucleotide (from, e.g., a depository such as the ATCC and other commercial or individual sources). A "promoter" comprises a nucleotide sequence that directs the transcription of, e.g., an operably linked structural gene. Typically, the promoter is located in the 5' non-coding region or 5' untranslated region (5' UTR) of the gene, proximal to the transcription start site of the structural gene. Sequence elements within promoters that function in the initiation of transcription are often characterized by consensus nucleotide sequences. These sequence elements include RNA polymerase binding sites, TATA sequences, CAAT sequences, differentiation-specific elements (DSE; McGehee, R.E. et al., MoI. Endocrinol. 7 (1993) 551), cyclic AMP response elements (CRE), serum response elements (SRE; Treisman, R., Seminars in Cancer Biol. 1 (1990) 47), glucocorticoid response elements (GRE), and binding sites for other transcription factors such as CRE / ATF (O'Reilly, M.A. et al., J. Biol. Chem. 267 (1992) 19938), AP2 (Ye, J., et al., J. Biol. Chem. 269 (1994) 25728), SP1, cAMP response element binding protein (CREB; Loeken, M.R., Gene Expr. 3 (1993) 253-264), and octanucleotide factors (see generally, Watson et al., eds., Molecular Biology of the Gene, 4th Ed., The Benjamin / Cummings Publishing Company, Inc. 1987, and Lemaigre, F.P. and Rousseau, G.G., Biochem. J. 303 (1994) 1-14). If the promoter is an inducible promoter, the rate of transcription is increased in response to an inducer. Conversely, if the promoter is a constitutive promoter, the rate of transcription is not modulated by an inducer. Repressible promoters are also known. For example, the c-fos promoter is specifically activated upon binding of growth hormone to its receptor on the cell surface. Tet-regulated expression can be accomplished by artificial hybrid promoters composed of, e.g., a CMV promoter followed by two Tet- operator sites.The Tet-repressor binds to both Tet-operator sites and blocks transcription. Upon addition of the inducer tetracycline, the Tet-repressor is released from the Tet-operator sites and transcription proceeds (Gossen, M. and Bujard, H., Proc. Natl. Acad. Sci. USA 89 (1992) 5547-5551). For other inducible promoters, including metallothionein and heat shock promoters, see, e.g., Sambrook, et al. (supra), and Gossen, M., et al., Curr. Opin. Biotech. 5 (1994) 516-520. Eukaryotic promoters that have been identified as strong promoters for high level expression are the SV40 early promoter, the adenovirus major late promoter, the mouse metallothionein-I promoter, the Rous sarcoma virus long terminal repeat, the Chinese hamster elongation factor 1 alpha (CHEF-1, see, e.g., US 5,888,809), the human EF-1 alpha, ubiquitin and the human cytomegalovirus immediate early promoter (CMV IE). Enhancers, i.e., cis-acting DNA elements that act on promoters to enhance transcription, are necessary to function in conjunction with promoters to increase the level of expression obtained with a promoter alone, and can be included as transcriptional regulatory elements. Typically, a polynucleotide segment containing a promoter will also include an enhancer sequence (e.g., CMV or SV40).
[0096] The term "nucleic acid" is a polymer consisting of individual nucleotides, i.e., a polynucleotide. It refers to naturally occurring, or partially or wholly non-naturally occurring nucleic acids, which, for example, encode a recombinantly producible polypeptide. A nucleic acid can consist of a DNA segment isolated by chemical means or synthesized. A nucleic acid can be integrated into another nucleic acid, e.g., into an expression plasmid or into the genome / chromosome of a host cell. Plasmids include shuttle and expression vectors. Typically, the plasmid will also contain a prokaryotic multiplication unit, which contains a replication initiation region (e.g., of ColE1) and a selectable marker (e.g., a penicillin or tetracycline resistance gene) for vector replication and selection in bacteria, respectively.
[0097] "RNA", i.e., ribonucleic acid (abbreviation: RNA), is a carrier of genetic information existing in the cells of living organisms and in part of viruses and viroids. RNA is a long-chain molecule condensed from ribonucleotides by phosphodiester bonds. A ribonucleotide molecule is composed of a phosphate, a ribose, and a base. The bases of RNA are mainly four kinds, i.e., A adenine, G guanine, C cytosine, and U uracil, among which U (uracil) replaces T in DNA. RNA is a single strand transcribed from one strand of DNA as a template according to the principle of base complementary pairing, and its main function is to realize the expression of genetic information on proteins, and it is a bridge in the process of genetic information transmission. The function of tRNA is to carry the required amino acids to synthesize proteins with mRNA as a template.
[0098] Within the scope of the present application, the transfected cells can essentially be obtained using any kind of transfection method known in the art. For example, the nucleic acid can be introduced into the cell by electroporation or microinjection. Alternatively, lipofection reagents such as FuGENE 6 (Roche Diagnostics GmbH, Germany), X-tremeGENE (Roche Diagnostics GmbH, Germany) and LipofectAmine (Invitrogen Corp., USA) can be used. Alternatively, the nucleic acid can be introduced into the cell by appropriate viral vector systems based on retrovirus, lentivirus, adenovirus and adeno-associated virus (Singer, O., Proc. Natl. Acad. Sci. USA 101 (2004) 5313-5314).
[0099] The term "cell" or "host cell" refers to a cell into which it is possible or possible to introduce / transfect, for example, a nucleic acid encoding a heterologous polypeptide or constituting a shRNA. Host cells include prokaryotic cells, which are used for propagation of vectors / plasmids, and eukaryotic cells, which are used for expression of nucleic acids. In one embodiment, the eukaryotic cell is a mammalian cell. In another embodiment, the mammalian host cell is selected from the group consisting of CHO cells (e.g. CHO K1 or CHO DG44), BHK cells, NS0 cells, SP2 / 0 cells, HEK 293 cells, HEK 293 EBNA cells, PER.C6 cells and COS cells. In other embodiments, the mammalian cell is selected from the group consisting of hybridomas, myelomas and rodent cells. Myeloma cells include rat myeloma cells (e.g. YB2), and mouse myeloma cells (e.g. NS0, SP2 / 0). Polypeptides for pharmaceutical applications are in one embodiment produced in mammalian cells such as CHO cells, NS0 cells, Sp2 / 0 cells, COS cells, HEK cells, BHK cells, PER.C6 cells and the like. For fermentation of the host cell and thus for expression of the polypeptide of interest, a culture medium is used. Today, CHO cells are widely used in laboratories for small scale or in production processes for large scale for expression of pharmaceutical polypeptides. Due to their widespread distribution and use, the characteristics and genetic background of CHO cells are well known. Therefore, regulatory agencies approve CHO cells for the production of therapeutic proteins for use in humans. In one embodiment, the mammalian cell is a CHO cell.
[0100] "Expression cassette" refers to a nucleic acid which contains the elements necessary for expression and secretion of at least a structural gene contained in the host cell. The nucleic acid is also characterized by its sequence consisting of individual nucleotides, or the amino acid sequence encoded by the nucleic acid molecule.
[0101] A "gene" denotes a nucleic acid, which is a segment on e.g. a chromosome or a plasmid, capable of influencing the expression of a peptide, polypeptide or protein. In addition to the coding region, i.e. the structural gene, a gene comprises further functional elements, such as a signal sequence, a promoter, an intron and / or a terminator.
[0102] The term "expression" refers to transcription and / or translation that occurs within a cell. The level of transcription of a desired product in a host cell can be determined on the basis of the amount of mRNA transcribed from the selected nucleic acid present in the cell. For example, mRNA transcribed from a selected nucleic acid can be quantified by PCR or by Northern hybridization (see Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989)). Protein encoded by a selected nucleic acid can be quantified by various methods, e.g. by ELISA, by determining the biological activity of the protein, or by using assays that are independent of this activity, such as Western blotting or radioimmunoassays using antibodies that recognize and bind to the protein (see Sambrook et al., 1989).
[0103] The promoter, the promoter flanks and the raw materials and reagents used in the application thereof provided by the present application can be purchased from the market.
[0104] The present application is further illustrated below in conjunction with examples:
[0105] Example 1 Screening of T7 promoter optimization
[0106] The currently commonly used synthesis system of RNA is: post-transcriptional capping system and co-transcriptional capping synthesis system (co-transcriptional system). The co-transcriptional system has the advantages of high capping efficiency and translation efficiency and simple production process, while the post-transcriptional capping system has the disadvantages of low capping efficiency and complicated process, and is gradually replaced by the co-transcriptional system. In the co-transcriptional system, the commonly used cap analog is m7(3'OMeG)(5')ppp(5')(2'OMeA)pG. This cap analog has a preference for AG for the last two positions of the T7 promoter TAATACGACTCACTATA, so the commonly used promoter in the mainstream co-transcriptional system adopts TAATACGACTCACTATAAG, which is named AG in this application. The optimized promoters in Table 2 and AG are used for RNA preparation by co-transcriptional system, respectively.
[0107] 1. RNA preparation method
[0108] (1) Thaw the system components in a fume hood and equilibrate to room temperature. Add the following components (as shown in Table 3) to the transcription system tube in order, mix gently.
[0109] Table 3
[0110] Component Volume 1 M Tris-HCl (pH 8.0) 0.6 μl 200 mM rATP 1.4 μL 200 mM rCTP 1.4 μL 200 mM N1-Me-pUTP 1.4 μL 200 mM rGTP 1.4 μL 100 mM m7(3'OMeG)(5')ppp(5')(2'OMeA)pG 1.96 μL 1M MgAc2 1 μL 500 mM DTT 1 μL 0.1 U / μL IPP 1.5 μL 40 U / μL RNase Inhibitor 0.5 μL 10 mM CaCl2 1 μL 100 mM Spermidine 0.4 μL 50 U / μL T7 polymerase 2 μL Template 0.4 μg / each RNase free Water Up to 20 μL
[0111] (2) React at 37℃ for 2 hours. Add 10 μL of 7.5M LiCl precipitation solution to all transcription tubes, mix well, and incubate at -20℃ for 30 min. Centrifuge at 15000 rpm at 4℃ for 15 min, and discard the supernatant. Resuspend and wash with 500 μL of pre-chilled 70% ethanol, and repeat the above centrifugation. Open the cap and let stand for 5 min, add 50 μL of Eloution Buffer to resuspend, and take 1.5 μL to detect the concentration using NanoDropOne.
[0112] 2. Production Analysis
[0113] The generated RNA was purified by lithium chloride precipitation and then its yield was analyzed (the purified and concentrated RNA sample was analyzed for concentration using NanoDropOne). The RNA yield comparison under different promoters is shown in the figure below. Figure 2 As shown, the corresponding production data is shown in Table 4. Figure 2 The horizontal axis represents the different newly designed promoters, with AG being the control promoter, and the vertical axis represents the RNA yield per 20 μL.
[0114] Table 4
[0115]
[0116] From Table 4 and Figure 2 It can be seen that: using the existing sequence TAATACGACTCACTATAAG as the core sequence, a 6-position "pairing sequence" is added after the T7 core sequence: where,
[0117] Sequence 2 (as shown in SEQ ID No. 2): TAATACGACTCACTATAAGGGGCGG, Sequence 4 (as shown in SEQ ID No. 4): TAATACGACTCACTATAAGGGGGCC, Sequence 6 (as shown in SEQ ID No. 6): TAATACGACTCACTATAAGGGGGGC; Sequence 11 (as shown in SEQ ID No. 11): TAATACGACTCACTATAAGGGAATT, Sequence 12 (as shown in SEQ ID No. 12): TAATACGACTCACTATAAGGAATAA, Sequence 13 (as shown in SEQ ID No. 13): TAATACGACTCACTATAAGGGGCCC, Sequence 15 (as shown in SEQ ID No. 15): TAATACGACTCACTATAAGGGGTGG, Sequence 16 (as shown in SEQ ID No. 16): TAATACGACTCACTATAAGGGGAAT can all improve the yield of RNA. Among them, Sequence 4: TAATACGACTCACTATAAGGGGGCC, Sequence 16: TAATACGACTCACTATAAGGGGAAT, Sequence 15: TAATACGACTCACTATAAGGGGTGG, Sequence 2:
[0118] TAATACGACTCACTATAAGGGGCGG, Sequence 12:
[0119] TAATACGACTCACTATAAGGAATAA, Sequence 6:
[0120] TAATACGACTCACTATAAGGGGGGC has more significant ability to improve the yield of RNA; Figure 2 "GGGGCC, P value 0.03125", "GGGAAT, P value 0.00322", "GGTGG, P value 0.0028", "GGGCGG, P value 0.0014", "GAATAA, P value 0.0003", "GGGGGC, P value <0.0001".
[0121] Example 2 Screening of T7 promoter optimization based on HEPES-KOH buffer co-transcription system
[0122] 1. RNA preparation method
[0123] (1) Thaw the system components in the fume hood and equilibrate to room temperature. Add the following components (as shown in Table 5) to the transcription system tube in turn, and mix gently.
[0124] Table 5
[0125] Component Volume 2 M HEPES-KOH (pH 7.5) 0.6 μl 200 mM rATP 1.4 μL 200 mM rCTP 1.4 μL 200 mM N1-Me-pUTP 1.4 μL 200 mM rGTP 1.4 μL 100 mM m7(3'OMeG)(5')ppp(5')(2'OMeA)pG 1.96 μL 1M MgAc2 1 μL 500 mM DTT 1 μL 0.1 U / μL IPP 1.5 μL 40 U / μL RNase Inhibitor 0.5 μL 10 mM CaCl2 1 μL 100 mM Spermidine 0.4 μL 50 U / μL T7 polymerase 2 μL Template 0.4 μg / each RNase free Water Up to 20 μL
[0126] (2) Reaction and detection scheme is carried out according to Example 1, and can also be prepared by using the specific embodiments of patent CN115125239A
[0126] -
[0132] ,
[0149] -
[0155] scheme.
[0127] 2. Yield analysis
[0128] The RNA produced is purified by lithium chloride precipitation method, and then the yield is analyzed. The specific calculation method of yield (the concentration of purified and concentrated RNA sample is analyzed by NanoDrop One), the comparison chart of RNA yield under different promoters is as shown in Figure 3 , and the corresponding yield data is shown in Table 6, Figure 3 The abscissa represents the different promoters newly designed, and the AG is the control promoter. The ordinate is the RNA yield per 20 μL.
[0129] Table 6
[0130]
[0131] From Table 6 and Figure 3 It can be seen that: taking the existing sequence TAATACGACTCACTATAAG as the core sequence, and adding 6 "complementary position sequences" after the T7 core sequence, it is found through screening that:
[0132] Sequence 1 (as shown in SEQ ID No. 1): TAATACGACTCACTATAAGGGCGGG, Sequence 2 (as shown in SEQ ID No. 2): TAATACGACTCACTATAAGGGGCGG, Sequence 4 (as shown in SEQ ID No. 4): TAATACGACTCACTATAAGGGGGCC, Sequence 6 (as shown in SEQ ID No. 6): TAATACGACTCACTATAAGGGGGGC, Sequence 11 (as shown in SEQ ID No. 11): TAATACGACTCACTATAAGGGAATT, Sequence 12 (as shown in SEQ ID No. 12): TAATACGACTCACTATAAGGAATAA, Sequence 13 (as shown in SEQ ID No. 13): TAATACGACTCACTATAAGGGGCCC, Sequence 14 (as shown in SEQ ID No. 14): TAATACGACTCACTATAAGGGGGGG, Sequence 15 (as shown in SEQ ID No. 15): TAATACGACTCACTATAAGGGGTGG, Sequence 16 (as shown in SEQ ID No. 16): TAATACGACTCACTATAAGGGGAAT can improve the yield of RNA. Among them, Sequence 1, Sequence 4, Sequence 6, Sequence 12, Sequence 13, Sequence 14, Sequence 15, Sequence 16 have more significant ability to improve the yield of RNA; Figure 3 "GGGCCC, P value 0.0018", "GGTGG, P value <0.0001", "GAATAA, P value <0.0001", "GGGCGG, P value <0.0001", "GGGAAT, P value <0.0001", "GGGGCC, P value <0.0001", "GGGGGG, P value <0.0001", "GGGGGC, P value <0.0001".
[0133] Example 3 Screening of T7 promoter optimization based on commercial kit co-transcription system
[0134] 1. RNA preparation method
[0135] (1) Thaw the system components in the fume hood and equilibrate to room temperature. Add the following components (as shown in Table 7) to the transcription system tube in turn, and mix gently.
[0136] Table 7
[0137] Component Volume 5x Transcription Buffer-1 4 μL 200 mM rATP 1 μL 200 mM rCTP 1 μL 200 mM N1-Me-pUTP 1 μL 200 mM rGTP 1 μL 100 mM m7(3'OMeG)(5')ppp(5')(2'OMeA)pG 2 μL 120 U / μL Murine RNase Inhibitor 0.5 μL 50 U / μL T7 RNA Polymerase 2 μL 0.1 U / μL IPP 1 μL Template 0.4 μg / each RNase-free Water Up to 20 μL
[0138] (2) The reaction and detection scheme is carried out according to Example 1, or the scheme of patent CN115125239A can also be used for preparation.
[0139] 2. Yield analysis
[0140] The RNA produced is purified by lithium chloride precipitation method, and then the yield is analyzed. The specific calculation method of yield (the concentration of the purified and concentrated RNA sample is analyzed by NanoDrop One), the comparison chart of RNA yield under different promoters is as shown in Figure 4 , and the corresponding yield data is shown in Table 8, Figure 4 The abscissa represents the newly designed different promoters, and the ordinate is the RNA yield per 20 μL.
[0141] Table 8
[0142]
[0143] From Table 8 and Figure 4 , it can be seen that: taking the existing sequence TAATACGACTCACTATAAG as the core sequence, adding 6 "complementary position sequences" after the T7 core sequence: among them,
[0144] Sequence 1 (as shown in SEQ ID No. 1): TAATACGACTCACTATAAGGGCGGG, Sequence 2 (as shown in SEQ ID No. 2): TAATACGACTCACTATAAGGGGCGG, Sequence 4 (as shown in SEQ ID No. 4): TAATACGACTCACTATAAGGGGGCC, Sequence 6 (as shown in SEQ ID No. 6): TAATACGACTCACTATAAGGGGGGC, Sequence 11 (as shown in SEQ ID No. 11): TAATACGACTCACTATAAGGGAATT, Sequence 12 (as shown in SEQ ID No. 12): TAATACGACTCACTATAAGGAATAA, Sequence 13 (as shown in SEQ ID No. 13): TAATACGACTCACTATAAGGGGCCC, Sequence 14 (as shown in SEQ ID No. 14): TAATACGACTCACTATAAGGGGGGG, Sequence 15 (as shown in SEQ ID No. 15): TAATACGACTCACTATAAGGGGTGG, Sequence 16 (as shown in SEQ ID No. 16): TAATACGACTCACTATAAGGGGAAT can all improve the yield of RNA. Among them, Sequence 2, Sequence 4, Sequence 6, Sequence 12, Sequence 14, Sequence 15, Sequence 16 have more significant ability to improve the yield of RNA.Figure 4 GGGAAT, P value 0.0004, "GGGGCC, P value 0.0030", "GGTGG, P value <0.0001", "GGGCGG, P value 0.0018", "GGGGGG, P value <0.0001", "GAATAA, P value 0.0002", "GGGGGC, P value <0.0001".
[0145] The above merely describes the preferred embodiments of the present application, and it should be noted that those of ordinary skill in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered within the protection scope of the present application.
Claims
1. A starter wing, characterized in that, The nucleotide sequence flanking the promoter includes GX2X3X4X5X6; Where X2 is selected from A or G; X3 is selected from A, G, or C; X4, X5, and X6 can be arbitrarily selected from A, T, C, or G.
2. The starter wing as described in claim 1, characterized in that, The promoter wing has: (Ⅰ) Any nucleotide sequence shown in GGCGGG, GGGCGG, GGGGCC, GGGGGC, GGAATT, GAATAA, GGGCCC, GGGGGG, GGGTGG, GGGAAT; or (II) Nucleotide sequences obtained by modifying, substituting, deleting, or adding one or more bases to any of the nucleotide sequences shown in (I), or nucleotide sequences with similar functions to any of the nucleotide sequences shown in (I); or (III) A sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology to any of the nucleotide sequences shown in (I) or (II).
3. The application of the promoter wing as described in claim 1 or 2 in any of the following: (I) Construct the promoter, expression frame, expression vector or host; (II) Preparation of the transcription system; (III) RNA synthesis; (IV) Increase RNA yield and / or translation efficiency; (V) Vaccine preparation; and / or (VI) Preparation of transcription reagents or transcription kits.
4. A promoter, characterized in that, The promoter includes a core sequence and promoter flanks as described in claim 1 or 2.
5. The promoter as described in claim 4, characterized in that, The core sequence includes, but is not limited to, the T7 promoter, which has a nucleotide sequence as shown in SEQ ID No.
7.
6. The promoter as described in claim 4 or 5, characterized in that, The promoter has: (I) Nucleotide sequences as shown in any of SEQ ID No. 1–2, SEQ ID No. 4, SEQ ID No. 6, and SEQ ID No. 11–16; or (II) Nucleotide sequences obtained by modifying, substituting, deleting, or adding one or more bases to any of the nucleotide sequences shown in (I), or nucleotide sequences with similar functions to any of the nucleotide sequences shown in (I); or (III) A sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology to any of the nucleotide sequences shown in (I) or (II).
7. The use of the promoter as described in any one of claims 4 to 6 in any one of the following: (I) Constructing the expression frame, expression vector, or host; (II) Preparation of the transcription system; (III) RNA synthesis; (IV) Increase RNA yield and / or translation efficiency; (V) Vaccine preparation; and / or (VI) Preparation of transcription reagents or transcription kits.
8. An expression box, characterized in that, The expression box includes the promoter wing as described in claim 1 or 2, or the promoter as described in claims 4 to 6.
9. The application of the expression box as described in claim 8 in any of the following: (I) Constructing expression vectors or hosts; (II) Preparation of the transcription system; (III) RNA synthesis; (IV) Increase RNA yield and / or translation efficiency; (V) Vaccine preparation; and / or (VI) Preparation of transcription reagents or transcription kits.
10. An expression vector, characterized in that, The expression vector includes the promoter wing as described in claim 1 or 2, the promoter as described in claims 4 to 6, or the expression frame as described in claim 8.
11. The use of the expression vector as described in claim 10 in any of the following: (I) Constructing the host; (II) Preparation of the transcription system; (III) RNA synthesis; (IV) Increase RNA yield and / or translation efficiency; (V) Vaccine preparation; and / or (VI) Preparation of transcription reagents or transcription kits.
12. The host, characterized in that, The host transfection or transformation has a promoter flanking as described in claim 1 or 2, a promoter as described in claims 4 to 6, an expression frame as described in claim 8, or an expression vector as described in claim 10.
13. A transcription system, characterized in that, The transcription system includes the promoter as described in any one of claims 4 to 6 or the expression vector as described in claim 10.
14. The transcription system as described in claim 13, characterized in that, The transcription system includes a co-transcription system; The co-transcription system comprises, in 20 μL increments: The buffer pair includes Tris-HCl and / or HEPES-KOH.
15. The use of the transcription system as described in claim 13 or 14 in any of the following: (I) RNA synthesis; (II) Increase RNA yield and / or translation efficiency; (III) Preparation of vaccines; and / or (IV) Preparation of transcription reagents or transcription kits.
16. A transcription reagent, characterized in that, The transcription reagent includes the promoter as described in any one of claims 4 to 6, the expression vector as described in claim 10, or the transcription system as described in claim 13 or 14.
17. The use of the transcription reagent as described in claim 16 in any of the following: (I) RNA synthesis; (II) Increase RNA yield and / or translation efficiency; (III) Preparation of vaccines; and / or (IV) Preparation of transcription kit.
18. A transcription kit, characterized in that, The transcription kit includes the promoter as described in any one of claims 4 to 6, the expression vector as described in claim 10, the transcription system as described in claim 13 or 14, or the transcription reagent as described in claim 16.
19. The use of the transcription kit as described in claim 18 in any of the following: (I) RNA synthesis; (II) Increase RNA yield and / or translation efficiency; and / or (III) Vaccine preparation.
20. A vaccine, characterized in that, The vaccine comprises RNA; the RNA is transcribed from a promoter as described in any one of claims 4 to 6, an expression cassette as described in claim 8, an expression vector as described in claim 10, a transcription system as described in claim 13 or 14, a transcription reagent as described in claim 16, or a transcription kit as described in claim 18.
Citation Information
Patent Citations
Hamster EF-1 alpha transcriptional regulatory DNA
US5888809A