Pinellia ternate real-time fluorescent quantitative PCR reference gene and application thereof
By screening and validating the Pinellia ternata internal reference gene UBC1 and its specific primers, the problem of instability of internal reference genes in Pinellia ternata gene expression research was solved, and the accuracy and reproducibility of Pinellia ternata gene expression detection were achieved, supporting functional genomics research.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-26
- Publication Date
- 2026-03-27
AI Technical Summary
The lack of stable internal reference genes applicable to multiple tissues and different developmental stages of Pinellia ternata in the current technology leads to insufficient accuracy and reliability in Pinellia ternata gene expression research, which affects the in-depth development of functional genomics research.
Through systematic evaluation, screening, and validation, the most stable internal reference gene UBC1 expressed in multiple tissues and developmental stages of Pinellia ternata, along with its specific primers, was identified. Specific primers and detection kits were provided for real-time quantitative PCR detection of Pinellia ternata.
It significantly improves the accuracy and reproducibility of Pinellia ternata gene expression detection, provides a reliable molecular tool, and supports the analysis of functional gene expression patterns and molecular regulatory network analysis of Pinellia ternata.
Smart Images

Figure CN121737153A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant molecular biology technology, specifically relating to a real-time fluorescence quantitative PCR internal reference gene for Pinellia ternata and its application. Background Technology
[0002] Pinellia ternata, a traditional and widely used Chinese medicinal herb, possesses the effects of drying dampness and resolving phlegm, as well as relieving nausea and vomiting. With the advancement of molecular biology techniques, analyzing the biosynthesis of its active components (such as alkaloids and organic acids) and the mechanisms by which its geographical origin is formed at the gene level has become a research focus. Real-time quantitative PCR (qRT-PCR) is one of the most commonly used and sensitive techniques for studying gene expression levels. Its accuracy largely depends on the standardization correction of the data by a stable internal reference gene (also known as a housekeeping gene) expressed under different experimental conditions.
[0003] Common internal reference genes, such as actin, elongation factor (EF-1a), and tubulin, can exhibit significant differences in expression stability across different species, tissues, developmental stages, and treatment conditions. Using unstable internal reference genes can lead to serious biases in the calculation of target gene expression levels, and even erroneous conclusions. Currently, qRT-PCR studies on Pinellia ternata, an important medicinal plant, lack systematically screened and validated dedicated internal reference genes applicable to multiple tissues and different developmental stages, significantly hindering the in-depth advancement of functional genomics research on Pinellia ternata.
[0004] Therefore, starting from the genetic background of Pinellia ternata itself, systematically screening and verifying the internal reference gene that is most stably expressed in its specific research system is of great theoretical and practical significance for improving the reliability and comparability of Pinellia ternata gene expression research, and further revealing the molecular basis of its medicinal value. Summary of the Invention To address the shortcomings of the existing technologies, the purpose of this invention is to provide a Pinellia ternata quantitative PCR internal reference gene and its application.
[0005] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides an internal reference gene UBC1 for Pinellia ternata, the nucleotide sequence of which is shown in SEQ ID NO: 1.
[0006] A second aspect of the present invention provides a specific primer for detecting the Pinellia ternata internal reference gene, comprising a forward primer as shown in SEQ ID NO: 2 and a reverse primer as shown in SEQ ID NO: 3.
[0007] A third aspect of the present invention provides a detection reagent or kit containing the above-described specific primers.
[0008] A fourth aspect of the present invention provides the application of the above-mentioned internal reference gene or specific primer or detection reagent or kit in real-time fluorescence quantitative PCR detection of different tissues of Pinellia ternata.
[0009] A fifth aspect of the present invention provides the application of the above-mentioned internal reference gene or specific primer or detection reagent or kit in analyzing the expression of different genes in different tissues of Pinellia ternata.
[0010] A sixth aspect of the present invention provides the application of the above-mentioned internal reference gene or specific primer or detection reagent or kit in the screening or identification of differential genes at different developmental stages of Pinellia ternata.
[0011] A seventh aspect of the present invention provides a real-time quantitative PCR detection method for different tissues of Pinellia ternata, wherein the real-time quantitative PCR detection method uses the UBC1 gene as an internal reference gene, the nucleotide sequence of which is shown in SEQ ID NO: 1.
[0012] Compared with the prior art, the technical solution of the present invention has the following beneficial effects: This invention, for the first time, systematically screened and validated UBC1, the most stable internal reference gene expressed in multiple tissues and developmental stages of Pinellia ternata, through geNorm, NormFinder, BestKeeper, and RefFinder, filling a technological gap in this research field. The UBC1 gene and its specific primers provided by this invention can effectively eliminate background noise caused by factors such as sample differences, RNA quality, and reverse transcription efficiency in Pinellia ternata qRT-PCR experiments, significantly improving the accuracy and reproducibility of gene expression level detection. It provides a reliable and standardized molecular tool for subsequent research such as expression pattern analysis of functional genes in Pinellia ternata (e.g., key enzyme genes involved in the synthesis of active ingredients), molecular regulatory network analysis, and molecular marker-assisted breeding, and has significant application prospects. Attached Figure Description
[0013] Figure 1 The images shown are agarose gel electrophoresis results of total RNA from different tissues of Pinellia ternata in this invention, where 1 to 8 are the total RNA electrophoresis results for leaves at 0d, 5d, 10d, and 30d, respectively, as well as for stems, tubers, inflorescences, and roots.
[0014] Figure 2 The images shown are agarose gel electrophoresis results of PCR amplification products of candidate internal reference genes in this embodiment of the invention. In the images, 1 to 12 are the electrophoresis results of PCR amplification products of 18S rRNA, EF1α, TUB6, ACT7, TIP41, UBQ10, GADPH, ACT1, CYP, PP2A, elF4a and UBC1, respectively.
[0015] Figure 3 This is a melting curve of the qRT-PCR product of the candidate internal reference gene in an embodiment of the present invention.
[0016] Figure 4 This is a box plot showing the distribution of Ct values for 11 candidate internal reference genes in an embodiment of the present invention.
[0017] Figure 5 This is a ranking diagram of the expression stability of candidate internal reference genes based on geNorm software analysis in an embodiment of the present invention.
[0018] Figure 6 This is a ranking diagram of the expression stability of candidate internal reference genes based on NormFinder software analysis in an embodiment of the present invention.
[0019] Figure 7 This is a ranking diagram of the expression stability of candidate internal reference genes based on comprehensive analysis using RefFinder software in an embodiment of the present invention.
[0020] Figure 8 This is a graph showing the expression level analysis of the key enzyme gene PtNDS in the trigonelline synthesis pathway of Pinellia ternata in different tissue sites in the embodiments of the present invention, based on the internal reference gene UBC1.
[0021] Figure 9 This is a graph showing the expression level analysis of the internal reference gene TIP41 on the key enzyme gene PtNDS in the trigonelline synthesis pathway in different tissues in this embodiment of the invention. Detailed Implementation
[0022] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0023] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments of the present invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, and / or combinations thereof.
[0024] As mentioned above, the existing technology lacks a reference gene for Pinellia ternata that has been systematically screened and verified and is applicable to its multiple tissues and different developmental stages. Based on this, the present invention provides a quantitative PCR reference gene for Pinellia ternata and its application.
[0025] In one typical embodiment of the present invention, a reference gene UBC1 for Pinellia ternata is provided, the nucleotide sequence of which is shown in SEQ ID NO: 1.
[0026] ATGTCGACTCCGGCAAGGAAGAGGCTGATGAGGGACTTCAAGCGCTTGCAGCAGGATCCTCCTGCGGGGATCAGCGGTGCCCCGCAGGACAATAATATCATGCTTTGGAATGCTGTCATTTTTGGTCCTGACGACACCCCCTGGGATGGAGGCACGTTTAAATTGACACTTCAGTTCACAGAGGATTATCCAAATAAGCCACCAACTGTGCGCTTTGTTTCTCGGATGTTC CACCCAAATATTTATGCGGATGGAAGTATATGCTTGGATATTCTACAGAACCAGTGGAGTCCAATTTATGATGTGGCTGCTATACTTACATCAATACAGTCATTGCTCTGTGACCCAAATCCCAACTCGCCTGCAAACTCTGAGGCTGCGCGCATGTTCAGTGAGAACAAAAGAGAATACAACAGACGCGTGCGTGAAATTGTTGAGCAGAGCTGGACTGCAGATTGA (SEQ ID NO: 1).
[0027] This invention is the first to screen and verify the most stable internal reference gene UBC1 expressed in multiple tissues and developmental stages of Pinellia ternata through systematic evaluation (geNorm, NormFinder, BestKeeper and RefFinder), filling a technological gap in this research field.
[0028] In another typical embodiment of the present invention, a specific primer for detecting the Pinellia ternata internal reference gene is provided, comprising a forward primer as shown in SEQ ID NO: 2 and a reverse primer as shown in SEQ ID NO: 3. The primer pair produces an amplification product of 149 bp in length, exhibiting high amplification efficiency and good specificity.
[0029] ACTGTGCGCTTTGTTTCCG (SEQ ID NO: 2); GGATTTGGGTCACAGAGCAATG (SEQ ID NO: 3).
[0030] In another typical embodiment of the present invention, a detection reagent or kit containing the above-mentioned specific primers is provided.
[0031] In another typical embodiment of the present invention, the application of the above-mentioned internal reference gene or specific primer or detection reagent or kit in real-time fluorescence quantitative PCR detection of different tissues of Pinellia ternata is provided.
[0032] In some implementations, different tissues include, but are not limited to, leaves, roots, tubers, stems, and inflorescences.
[0033] In some embodiments, the method for analyzing the relative expression levels of the gene is real-time quantitative PCR.
[0034] In another typical embodiment of the present invention, the application of the above-mentioned internal reference gene or specific primer or detection reagent or kit in analyzing the expression of different genes in different tissues of Pinellia ternata is provided.
[0035] In some implementations, different tissues include, but are not limited to, leaves, roots, tubers, stems, and inflorescences.
[0036] In some embodiments, the method for analyzing the relative expression levels of the gene is real-time quantitative PCR.
[0037] In another typical embodiment of the present invention, the application of the above-mentioned internal reference gene or specific primer or detection reagent or kit in the screening or identification of differential genes at different developmental stages of Pinellia ternata is provided.
[0038] In some implementations, the application is achieved by detecting Pinellia ternata leaves that have developed on days 0, 5, 10, and 30.
[0039] In another typical embodiment of the present invention, a real-time quantitative PCR detection method for different tissues of Pinellia ternata is provided. The real-time quantitative PCR detection method uses the UBC1 gene as an internal reference gene, and its nucleotide sequence is shown in SEQ ID NO: 1.
[0040] In some implementations, the UBC1 gene is amplified using a forward primer as shown in SEQ ID NO: 2 and a reverse primer as shown in SEQ ID NO: 3.
[0041] In some implementations, the real-time quantitative PCR reaction system is as follows: 10 μL of 2×SYBR Green Master Mix, 0.4 μL of 10 μM upstream primer, 0.4 μL of 10 μM downstream primer, 7.2 μL of ddH2O, and 2 μL of cDNA template.
[0042] In some implementations, the real-time quantitative PCR reaction program is as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 5 s; 60°C annealing and extension for 30 s, for a total of 40 cycles.
[0043] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0044] Example 1: Screening and validation of the internal reference gene UBC1 I. Experimental Materials Healthy Pinellia ternata plants were collected in October 2025 from the Medicinal Botanical Garden of Hubei University of Traditional Chinese Medicine. The materials were identified as Pinellia ternata, a plant belonging to the genus Pinellia in the family Araceae. Eight types of samples were collected, including four tissues (root, tuber, stem, and inflorescence) and four key stages of leaf development (0 days, 5 days, 10 days, and 30 days). Each sample was replicated in triplicate. After washing and flash-freezing in liquid nitrogen, the samples were stored at -80°C for later use.
[0045] II. Total RNA Extraction and cDNA Synthesis Total RNA was extracted from each sample using the SteadyPure Plant RNA Extraction Kit. RNA integrity was assessed by 1.2% agarose gel electrophoresis (results are shown in the figure). Figure 1 As shown, the bands are clear, with bright 28S and 18S rRNA bands (no degradation). Concentration and purity were determined using NanoDrop (A260 / A280 ratio between 1.8 and 2.1). Equal volumes of high-quality RNA were reverse transcribed into cDNA first strand using the Evo M-MLV reverse transcription kit and stored at -20°C for later use.
[0046] III. Candidate Internal Reference Gene Selection and Primer Design Based on the genome annotation information of Pinellia ternata, 12 commonly used housekeeping genes were initially screened as candidate internal reference genes, including: 18S rRNA, EF1a, TUB6, ACT7, TIP41, UBQ10, GADPH, ACT1, CYP, PP2A, eIF4a, and UBC1. Gene-specific qRT-PCR primers were designed using PrimerPremier 3.0 software and synthesized by Sangon Biotech (Shanghai) Co., Ltd. Primer sequences and amplification efficiencies are shown in Table 1.
[0047] Table 1. Primer information for qRT-PCR of candidate internal reference genes for Pinellia ternata.
[0048] IV. Validation of Primer Specificity and Amplification Efficiency Conventional PCR amplification was performed using mixed cDNA as a template, and the results of agarose gel electrophoresis showed that ( Figure 2Except for UBQ10, the other 11 genes all yielded single, correctly sized amplified bands, indicating good primer specificity. qRT-PCR was performed using 5-fold serially diluted cDNA as templates, and standard curves were plotted. The amplification efficiency (E) of all qualified primers ranged from 84% to 120%, with a correlation coefficient (R²) > 0.99, and the melting curves all showed a single peak. Figure 3 This meets the requirements for quantitative analysis.
[0049] V. Analysis of the stability of internal reference gene expression Using cDNA from various tissues as templates, qRT-PCR was performed on 11 qualified candidate internal reference genes to obtain Ct values. The Ct value distribution is shown below. Figure 4 As shown, 18S rRNA expression was the highest (with the lowest Ct value), and the Ct values of each gene varied among different samples.
[0050] The obtained Ct value data were imported into geNorm, NormFinder, and BestKeeper software for stability analysis, and RefFinder was used for comprehensive ranking.
[0051] 1. geNorm analysis: The expression stability was ranked by calculating the average expression stability value M, with lower M values indicating greater stability. Results showed that eIF4α and UBC1 exhibited the best stability. Figure 5 ).
[0052] 2. NormFinder analysis: The system was sorted by stability value, with lower stability values indicating greater stability. Results showed that UBC1 had the highest stability. Figure 6 ).
[0053] 3. BestKeeper analysis: The Ct values were ranked by calculating the standard deviation (SD) and coefficient of variation (CV). The results are shown in Table 2. CYP had the lowest SD and CV values, followed by UBC1.
[0054] Table 2. Expression stability (BestKeeper) analysis of 11 candidate internal reference genes in different tissues.
[0055] 4. RefFinder Comprehensive Analysis: The analysis results from the above three software programs are integrated and ranked using a geometric mean. The results are as follows: Figure 7 As shown, UBC1 ranked first in overall stability (lowest score), making it the most stable internal reference gene expressed in different tissues and developmental stages of Pinellia ternata. Figure 7 ).
[0056] Based on the evaluation results of the above-mentioned algorithms, this invention screened the ubiquitinase gene UBC1 as the optimal internal reference gene for qRT-PCR analysis of Pinellia ternata in multiple tissues and developmental stages.
[0057] Example 2: Validation of the internal reference gene To verify the applicability of the selected internal reference genes, this study selected UBC1, the most stable gene in the overall ranking, and TIP41, the least stable gene, as references. The expression levels of the key enzyme gene PtNDS in the trigonelline synthesis pathway of Pinellia ternata were analyzed in four key tissue sites (0 days, 5 days, 10 days, and 30 days) during root, tuber, stem, inflorescence, and leaf development. The specific primer sequences used for PtNDS gene amplification were: F: 5'-AAGCGGTGCTTCTGGTTTTC-3', R: 5'-ATTGCATCAGCCTTCGCTTG-3'.
[0058] The results showed that, with UBC1 as an internal control, the expression level of the PtNDS gene was significantly higher in tubers than in other tissues, followed by petioles and leaves at different developmental stages, while the expression level was lowest in roots and inflorescences. Figure 8 This result is consistent with the physiological characteristic of high accumulation of trigonelline in Pinellia tuber. Conversely, when TIP41 was used as an internal control, the expression pattern of the PtNDS gene showed significant differences, with its expression level being highest in the 10-day-old leaves. Figure 9 The results showed that using an unstable internal reference gene could seriously interfere with the accuracy of the target gene expression pattern, further confirming the reliable stability and applicability of UBC1 in gene expression analysis of Pinellia ternata in different tissues.
[0059] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of them. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A reference gene for Pinellia ternata, characterized in that, The internal reference gene is UBC1, and its nucleotide sequence is shown in SEQ ID NO:
1.
2. A specific primer for detecting the internal reference gene of Pinellia ternata, characterized in that, The specific primers include the forward primer shown in SEQ ID NO: 2 and the reverse primer shown in SEQ ID NO:
3.
3. A detection reagent or kit containing the specific primers described in claim 2.
4. The application of the internal reference gene of claim 1, the specific primer of claim 2, or the detection reagent or kit of claim 3 in real-time fluorescence quantitative PCR detection of different tissues of Pinellia ternata.
5. The application of the internal reference gene of claim 1, the specific primer of claim 2, or the detection reagent or kit of claim 3 in analyzing the expression of different genes in different tissues of Pinellia ternata.
6. The application as described in claim 4 or claim 5, characterized in that, The tissues include leaves, roots, tubers, stems, and inflorescences.
7. The application as described in claim 4 or claim 5, characterized in that, The method for analyzing the relative expression levels of the genes was real-time quantitative PCR.
8. The application of the internal reference gene of claim 1, the specific primer of claim 2, or the detection reagent or kit of claim 3 in the screening or identification of differential genes at different developmental stages of Pinellia ternata.
9. The application as described in claim 8, characterized in that, The application is achieved by detecting Pinellia ternata leaves that have developed on days 0, 5, 10, and 30.
10. A real-time quantitative PCR method for detecting different tissues of Pinellia ternata, characterized in that, The real-time quantitative PCR detection method uses the UBC1 gene as an internal reference gene, and its nucleotide sequence is shown in SEQ ID NO: 1.