Method for enhancing CAR-NK cell function by interfering GPR68 and application thereof

By interfering with the GPR68 gene to enhance CAR-NK cell function, the problem of NK cell functional exhaustion in the tumor microenvironment of solid tumors was solved, significantly improving the killing and proliferation capabilities of NK cells and enhancing the anti-tumor effect of CAR-NK cells.

CN121737211APending Publication Date: 2026-03-27SHANGHAI ENTEBIO PHARMACEUTICAL TECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-05
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Existing technologies struggle to overcome the immunosuppressive effects of the tumor microenvironment in solid tumors, leading to NK cell depletion and an inability to effectively reach and infiltrate solid tumors, thus affecting the anti-tumor activity of CAR-NK cells.

Method used

By designing RNAi target sequences to interfere with the GPR68 gene, constructing interference plasmids and MUC1-CAR plasmids, the immune function and anti-tumor activity of NK cells were enhanced, and GPR68 in NK92 cells was knocked down using RNA interference technology.

Benefits of technology

It significantly improved the killing ability, activation level, proliferation ability and anti-apoptotic ability of NK cells, and enhanced the in vitro and in vivo anti-tumor effects of CAR-NK cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121737211A_ABST
    Figure CN121737211A_ABST
Patent Text Reader

Abstract

The invention relates to the field of bioengineering, and discloses a method for enhancing CAR-NK cell functions by interfering GPR68 and application of the method, and the method comprises the following steps: step 1, designing an RNAi target sequence based on a GPR68 gene; 2, designing an interference sequence according to the RNAi target sequence; step 3, constructing an interference plasmid pLL3.7-shRNA-1-EGFP (Enhanced Green Fluorescent Protein); step 4, construction of a pLL3.7 to shRNA-1 (short hairpin ribonucleic acid 1)-MUC1-CAR plasmid is carried out; step 5, obtaining an scFv sequence of an anti-human MUC1 antibody; the GPR68 gene is knocked down in the NK cell and the CAR-NK cell through an RNA interference technology, and the immune function and the anti-tumor activity of the NK cell and the CAR-NK cell can be enhanced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioengineering, specifically to a method for enhancing CAR-NK cell function by interfering with GPR68 and its application. Background Technology

[0002] The GPCR family is the largest family of membrane receptors, containing over 800 members, and plays a crucial role in regulating physiological and pathological processes. Approximately 40% of commercially available drugs exert their effects through GPCRs, making them important drug targets. The acidic tumor microenvironment is a key characteristic of tumor development, activating oncogenic phenotypes such as treatment resistance and immune escape. Proton-sensing GPCRs play a central role in this process; lactate accumulation and extracellular acidification activate GPCRs such as GPR68, inhibiting immune cell function and promoting tumor progression. The proton-sensing receptor GPR68 is highly expressed in immune cells; it can sense and be activated by the extracellular acidic environment, thereby regulating physiological processes such as cell growth, metabolism, and migration. As an innate immune cell, NK cells have attracted much attention due to their unique killing mechanism, diverse sources, allogeneic applicability, and good safety profile. CAR-NK therapy overcomes the limitations of allogeneic CAR-T therapy. Its advantages include: short production cycle, support for repeated dosing, and no risks such as graft-versus-host disease, severe cytokine release syndrome, and immune effector cell-related neurotoxicity. CAR-NK therapy has emerged as a promising alternative to CAR-T therapy for anti-tumor research and clinical treatment. However, immune cells struggle to reach and infiltrate solid tumors, and the hypoxic, immunosuppressive tumor microenvironment (TME) generates large amounts of lactate through metabolism, leading to NK cell depletion. Current research on overcoming the tumor microenvironment in solid tumors focuses on enhancing the anti-tumor activity and specificity of NK cells using immunostimulants, modulating cytokine expression, immune checkpoint blockade (ICB), and chimeric antigen receptors (CARs). Therefore, this invention proposes a method for enhancing CAR-NK cell function by interfering with GPR68 and its application. Summary of the Invention

[0003] The purpose of this invention is to provide a method for enhancing CAR-NK cell function by interfering with GPR68 and its application, so as to solve the problems mentioned in the background art.

[0004] To achieve the above objectives, the present invention provides the following technical solution: a method for enhancing CAR-NK cell function by interfering with GPR68, comprising the following steps:

[0005] Step 1: Design RNAi target sequences based on the GPR68 gene. The nucleotide sequence of the RNAi target sequence of the GPR68 gene is SEQ ID NO.1.

[0006] Step 2: Design an interference sequence based on the RNAi target sequence. The nucleotide sequence of the interference sequence GPR68-shRNA-1 is SEQ ID NO.2 and SEQ ID NO.3.

[0007] Step 3: Construct the interfering plasmid pLL3.7-shRNA-1-EGFP. Based on the interfering sequence in Step 2, synthesize the double-stranded DNA sequence of the target sequence. Digest the empty vector pLL3.7 with restriction endonucleases HpaI and XhoI, and ligate it with T4 DNA ligase to construct the recombinant plasmid pLL3.7-shRNA-1-EGFP.

[0008] Step 4, Construction of pLL3.7-shRNA-1-MUC1-CAR plasmid: The pLL3.7-MUC1-CAR vector was digested with restriction endonucleases XbaI and XhoI, and the large fragment was recovered. The pLL3.7-shRNA-1-EGFP was digested with restriction endonucleases XbaI and XhoI, and the small fragment was recovered. The fragments were then ligated with T4 DNA ligase to obtain the pLL3.7-shRNA-1-MUC1-CAR plasmid.

[0009] Step 5: scFv sequence of anti-human MUC1 antibody. Select the scFv sequence of anti-human MUC1 antibody to construct pLL3.7-MUC1-CAR vector, named MUC1-scFv. The nucleotide sequence of MUC1-scFv is SEQ ID NO.6, and the amino acid sequence is SEQ ID NO.7.

[0010] Preferably, the pLL3.7-MUC1-CAR vector, i.e., the CAR, is composed of the following amino acid sequences from the amino terminus to the carboxyl terminus: the amino acid sequence of the human CD8α signal peptide (SEQ ID No. 9, 1-21AA), the amino acid sequence of the Flag tag (SEQ ID No. 9, 22-29AA), the amino acid sequence of the anti-human MUC1-scFv (SEQ ID No. 9, 30-274AA), the amino acid sequence of the human CD8α hinge (SEQ ID No. 9, 275-319AA), the amino acid sequence of the human CD8α transmembrane region (SEQ ID No. 9, 320-343AA), the amino acid sequence of the human 4-1BB intracellular domain (SEQ ID No. 9, 344-385AA), and the amino acid sequence of the human CD3ζ domain (SEQ ID No. 9, 386-498AA), strung together.

[0011] Preferably, the amino acid sequence of the pLL3.7-MUC1-CAR vector is SEQ ID No. 9, and the nucleotide sequence of the chimeric antigen receptor molecule targeting human MUC1 synthesized in its entirety is SEQ ID No. 8. The molecule is ligated into the lentiviral vector pLL3.7 by molecular cloning to construct a full-length MUC1-CAR sequence expression cassette with a single coding frame, and expressed using the EF1α promoter.

[0012] According to the above-mentioned method of enhancing CAR-NK cell function by interfering with GPR68, the immune function and anti-tumor activity of NK cells and CAR-NK cells are enhanced.

[0013] Compared with the prior art, the beneficial effects of this invention are as follows:

[0014] This invention utilizes RNA interference technology to design interfering sequences that knock down GPR68 in NK92 cells. A GPR68-knockdown MUC1-CAR-NK was designed and developed to enhance its anti-tumor function, thus providing a new strategy for CAR-NK therapy of solid tumors. Attached Figure Description

[0015] Figure 1 This is a flowchart of the method of the present invention;

[0016] Figure 2 The plasmid maps of pLL3.7-shRNA-NC-EGFP and pLL3.7-shRNA-1-EGFP of this invention are shown.

[0017] Figure 3 The images show the enzyme digestion identification of the pLL3.7-shRNA-NC-EGFP and pLL3.7-shRNA-1-EGFP plasmids of this invention.

[0018] Figure 4 The plasmid maps of pLL3.7-shRNA-NC-MUC1 and pLL3.7-shRNA-1-MUC1 in the embodiments of the present invention are shown.

[0019] Figure 5 The images show the enzyme digestion identification diagrams of pLL3.7-shRNA-NC-MUC1 and pLL3.7-shRNA-1-MUC1 plasmids in the embodiments of the present invention.

[0020] Figure 6 This is the result of GFP positivity rate detection in NK92 cells in an embodiment of the present invention;

[0021] Figure 7 This is a graph showing the GPR68 interference efficiency detection results in an embodiment of the present invention.

[0022] Figure 8This is a statistical chart showing the kill efficiency of NK92 against K562 in an embodiment of the present invention;

[0023] Figure 9 The following is a flow cytometry diagram of the expression level of NK92 activated cytokines in an embodiment of the present invention: A: detection of GzmB; B: detection of IFN-γ.

[0024] Figure 10 This is a flow cytometry diagram illustrating the detection of NK92 proliferation and anti-apoptotic abilities in an embodiment of the present invention. A: Detection of cell proliferation level; B: Detection of BCL-2 expression level; C: Detection of cell apoptosis level.

[0025] Figure 11 Flow cytometry detection of CAR positivity rate in an embodiment of the present invention;

[0026] Figure 12 The figure shows the detection results of GPR68 interference efficiency in CAR-NK cells in an embodiment of the present invention. A: RT-PCR results; B: Statistical results of relative mRNA expression levels.

[0027] Figure 13 This is a statistical chart showing the killing efficiency of CAR-NK cells against target cells in an embodiment of the present invention.

[0028] Figure 14 The following is an in vivo anti-tumor effect diagram of CAR-NK in an embodiment of the present invention: A: Mouse in vivo imaging results; B: Tumor size; C: Survival curve. Detailed Implementation

[0029] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0030] Example

[0031] Please see Figures 1-3 The illustrated method for enhancing CAR-NK cell function by interfering with GPR68 includes the following steps:

[0032] Step 1: Design RNAi target sequences based on the GPR68 gene. The nucleotide sequence of the RNAi target sequence of the GPR68 gene is SEQ ID NO.1.

[0033] Step 2: Design an interference sequence based on the RNAi target sequence. The nucleotide sequence of the interference sequence GPR68-shRNA-1 is SEQ ID NO.2 and SEQ ID NO.3.

[0034] Step 3: Construct the interfering plasmid pLL3.7-shRNA-1-EGFP. Based on the interfering sequence in Step 2, synthesize the double-stranded DNA sequence of the target sequence. Digest the empty vector pLL3.7 with restriction endonucleases HpaI and XhoI, and ligate it with T4 DNA ligase to construct the recombinant plasmid pLL3.7-shRNA-1-EGFP.

[0035] Step 4, Construction of pLL3.7-shRNA-1-MUC1-CAR plasmid: The pLL3.7-MUC1-CAR vector was digested with restriction endonucleases XbaI and XhoI, and the large fragment was recovered. The pLL3.7-shRNA-1-EGFP was digested with restriction endonucleases XbaI and XhoI, and the small fragment was recovered. The fragments were then ligated with T4 DNA ligase to obtain the pLL3.7-shRNA-1-MUC1-CAR plasmid.

[0036] Step 5: scFv sequence of anti-human MUC1 antibody. Select the scFv sequence of anti-human MUC1 antibody to construct pLL3.7-MUC1-CAR vector, named MUC1-scFv. The nucleotide sequence of MUC1-scFv is SEQ ID NO.6, and the amino acid sequence is SEQ ID NO.7.

[0037] In this embodiment, the gene sequence number of Homo sapiens G protein-coupled receptor 68 (GPR68) was found on the NCBI website: NM_001177676.2. Based on the gene sequence number, the GPR68 gene RNAi target sequence was designed using an online tool (https: / / rnaidesigner.thermofisher.com / rnaiexpress / design.do). The results are shown in Table 1.

[0038] Table 1 GPR68 gene RNAi target sequences

[0039] Target sequence name Starting position nucleotide sequence of RNAi target sequence GC% SEQ ID NO. Target sequence 1 542 GGAACATCACTGCAGACAACT 47.62 SEQ ID NO.:1

[0040] Based on the screened target sequences, the interference sequences were designed and determined according to the following principles: the 5' end starts with G, the GC content is set to 30% to 50%, and according to the requirements of the pLL3.7 vector, (1) T is added to the 5' end of the positive strand to reconstruct the T at the 1 position of the U6 promoter, (2) a loop “TTCAAGAGA” is added after the interference target sequence, (3) the reverse complementary sequence and the termination signal “TTTTTT” are added, (4) the EcoRI restriction site GAATTC is added to the 3' end for easy identification, and (5) the XhoI restriction site is then added to synthesize a pair of complementary fragments.

[0041] The sequences were shuffled to design NC (Negative Control) sequences, as shown in Table 2 below.

[0042] Table 2 shows the oligonucleotide sequences designed for the target sequence and negative control sequence, respectively.

[0043]

[0044]

[0045] The designed target oligonucleotide sequence was synthesized into a double-stranded DNA sequence of the target sequence. The empty vector pLL3.7 was double-digested with restriction endonucleases HpaI and XhoI, and then ligated with T4 DNA ligase to construct recombinant plasmids pLL3.7-shRNA-NC-EGFP and pLL3.7-shRNA-1-EGFP. The plasmid map is shown below. Figure 2 The recombinant plasmid was identified and sequenced by EcoRI single enzyme digestion as follows: Figure 3 As shown.

[0046] Furthermore, the pLL3.7-MUC1-CAR vector was digested with restriction endonucleases XbaI and XhoI, and the large fragment (8007 bp) was recovered. The pLL3.7-shRNA-NC-EGFP and pLL3.7-shRNA-1-EGFP vectors were digested with restriction endonucleases XbaI and XhoI, and the small fragment (384 bp) was recovered. These fragments were then ligated using T4 DNA ligase to obtain the pLL3.7-shRNA-NC-MUC1-CAR and pLL3.7-shRNA-1-MUC1-CAR plasmids. The plasmid maps are shown below. Figure 4 As shown, the recombinant plasmid was identified and sequenced by EcoRI single enzyme digestion. Figure 5 As shown.

[0047] The pLL3.7-MUC1-CAR vector was constructed using the scFv sequence of the anti-human MUC1 antibody with the best affinity, and named MUC1-scFv (nucleotide sequence as shown in SEQ ID No. 6, amino acid sequence as shown in SEQ ID No. 7). Its specific sequence is shown in the table below:

[0048] Table 3. scFv sequences of anti-human MUC1 antibodies

[0049]

[0050]

[0051] The pLL3.7-MUC1-CAR vector (CAR for short) is composed of the following amino acid sequences, from the amino terminus to the carboxyl terminus: the amino acid sequence of the human CD8α signal peptide (SEQ ID No. 9, 1-21AA), the Flag tag amino acid sequence (used for protein detection and localization, SEQ ID No. 9, 22-29AA), the anti-human MUC1-scFv amino acid sequence (SEQ ID No. 9, 30-274AA), the human CD8α hinge amino acid sequence (SEQ ID No. 9, 275-319AA), the human CD8α transmembrane region amino acid sequence (SEQ ID No. 9, 320-343AA), the human 4-1BB intracellular domain amino acid sequence (SEQ ID No. 9, 344-385AA), and the human CD3ζ domain amino acid sequence (SEQ ID No. 9, 386-498AA). The amino acid sequence is shown in SEQ ID No. 9. The nucleotide sequence of the fully synthesized chimeric antigen receptor molecule targeting human MUC1 is shown in SEQ ID No. 9. No. 8, whose specific sequence is as follows, was ligated into the lentiviral vector pLL3.7 by molecular cloning to construct a full-length MUC1-CAR sequence expression cassette with a single coding frame, and expressed using the EF1α promoter.

[0052] Table 4. pLL3.7-MUC1-CAR sequence

[0053]

[0054]

[0055] Lentiviral packaging: (1) 293T cells were cultured in 10cm cell culture dishes, passaged, and cell state was adjusted. (2) When the cell density reached approximately 70-80%, the virus was packaged. The target plasmid and the chronic disease packaging helper plasmids (pMD2.G, psPAX2) were dissolved in serum-free DMEM medium at a ratio of 5μg:3μg:5μg. The transfection reagent PEI was mixed at a ratio of PEI:DNA mass of 3:1. The mixture was left to stand at room temperature for 20 minutes. (3) 1ml of plasmid-PEI mixture was gently added dropwise to the culture medium and cultured for 6-8 hours. The culture medium was discarded, and 10ml of DMEM medium containing 1% FBS was added to each dish. The mixture was cultured for 48 hours. After h, collect the first cell culture medium, add new DMEM medium containing 1% FBS and culture for another 24 h, collect the second cell culture supernatant, mix and obtain the virus stock solution, (4) centrifuge at 4℃ and 4000g for 10 min to remove cell debris, filter the supernatant again with a 0.22μm needle filter, (5) transfer the filtered virus solution into a sterilized ultracentrifuge tube and centrifuge at 4℃, 25000g for 2 h, remove the culture medium supernatant after centrifugation, mark the concentrated spots of the virus with a marker, add 400μl of NK92 medium, dissolve the virus overnight, collect the virus, and dispense the virus into 1.5ml EP tubes and freeze in a -80℃ freezer for later use.

[0056] Virus titer determination: (1) 293T cells were cultured in 24-well plates, with 2 × 10⁻⁶ cells per well. 5 Add different volumes of concentrated virus solution to 24-well plates, and set uninfected wells as blank control groups. Culture for 48 hours, and collect cells by digestion after 48 hours; (2) Centrifuge and wash cells, resuspend cells with 100 μl FACS buffer, add the corresponding antibody, stain at 4℃ in the dark for 30 min, add 1 ml FACS buffer after incubation, centrifuge (400 g, 3 min) and wash cells, resuspend cells with 250 μl FACS buffer, and perform flow cytometry to detect the positive rate.

[0057] The titer is calculated using the following formula:

[0058]

[0059] The calculation results are as follows: the titers of the two viruses, pLL3.7-shRNA-1-EGFP and pLL3.7-shRNA-NC-EGFP, are 1.53 × 10⁻⁶. 8 1.48×10 8 The titers of the two viruses, pLL3.7-shRNA-1-MUC1-CAR and pLL3.7-shRNA-NC-MUC1-CAR, were 1.33 × 10⁻⁶.8 1.27×10 8 .

[0060] NK92 cell culture, (1) Preparation of NK92-specific culture medium. Incomplete culture medium: αMEM + 0.1mM β-mercaptoethanol + HS and 12.5% ​​FBS at a final concentration of 12.5%. When using, add IL-2 (200 IU / ml) to the culture medium. Try to use it up within 7 days. Otherwise, IL-2 needs to be added again. (2) NK92 cell resuscitation. After thawing in a 37℃ water bath, centrifuge at 800 rpm for 5 min, discard the frozen solution, add culture medium to resuspend, and culture in a T25 culture flask with an initial density of 2-3 × 10⁻⁶ cells per ml. 5 (3) Passage of NK92 cells. Shake the culture flask to roughly mix the cells, count the cells, and add 2-3 × 10⁶ cells per ml every 2-3 days. 5 For each live cell density, the medium should be completely or partially replaced, and the passage time and frequency should be determined based on the cell density.

[0061] To determine the interference efficiency of GPR68 in NK92 infected cells, (1) NK92 cells were seeded in 24-well plates, with 5 × 10⁶ cells per well. 5 Cells were divided into three groups in three wells: a negative control group without virus infection, a control group without pLL3.7-shRNA-NC-EGFP interference, and a lentivirus interference group with pLL3.7-shRNA-1-EGFP, with two wells in each group. The two experimental groups were added with the corresponding volume of virus according to MOI=15. After 24 hours, the cells were collected, centrifuged at 1000 rpm for 5 minutes, and the culture medium was discarded to obtain NK92 cells with GPR68 interference and control, which were named NC and SH, respectively. Fresh culture medium was added and cultured for another 48 hours. The cells were collected and the GFP expression efficiency, i.e. the positive rate of virus infection, was detected by flow cytometry. The results showed that the infection efficiency of the two viruses, pLL3.7-shRNA-1-EGFP and pLL3.7-shRNA-NC-EGFP, on NK92 cells reached 80%. Figure 6 As shown. The GFP positivity rate of NC was 80.3%, and the positivity rate of SH was 80.5%. (3) NK92 cells infected for 48 h were lysed with Trizol, total RNA was extracted, and the interference effect of GPR68 in NK92 was analyzed by RT-PCR. The results are shown in the figure. Figure 7 As shown, pLL3.7-shRNA-1-EGFP lentivirus infection of cells can significantly interfere with the transcription of GPR68 mRNA, resulting in a significant decrease in the expression level of GPR68 mRNA to 10% of the original level, which is highly significant (P<0.001).

[0062] cytotoxicity of NK92 cells knocked down by GPR68 against K562 cells: (1) NK92 cells (NC, SH) and K562 target cells were collected 72 h after viral infection, counted and their density adjusted. First, the target cells K562 were labeled with CFSE. Then, the target cells were spaced at 3 × 10⁶ cells per well. 4 Cells were seeded in 96-well plates, and NK92 cells were added according to different effector-to-target ratios (E:T, 1.25:1, 2.5:1, 5:1), i.e., 3.75 × 10⁶ cells were added respectively. 4 7.5×10 4 1.5×10 5 (2) After co-incubation for 4 hours, cells were collected, washed once with FACS buffer, and then stained with Annexin V antibody at room temperature for 15 minutes. The proportion of Annexin V+ cells in the FITC-positive population was detected by flow cytometry. The killing efficiency of effector cells was obtained based on the autoapoptosis of target cells. The results are as follows: Figure 8 As shown.

[0063] The results showed that with the increase of the effector-to-target ratio, the killing ratio of GPR68 knockdown NK92 against target cells K562 increased significantly. The killing efficiencies of NC-NK92 against K562 at the three effector-to-target ratios were 24.81%, 38.56%, and 51.46%, respectively, while those of SH-NK92 against K562 were 33.86%, 48.31%, and 64.71%, respectively. The killing efficiency of the SH-NK92 group was better than that of the NC-NK92 group at different effector-to-target ratios, and statistical analysis showed that the difference in killing efficiency between the two groups was extremely significant (P < 0.001). This indicates that GPR68 knockdown enhances the killing ability of NK92.

[0064] Detection of the expression level of activating cytokines in GPR68 knocked-down NK92 cells: (1) Take NK92 cells (NK, SH) and K562 cells 72 hours after viral infection, count them, adjust the cell density, and co-culture them in a regular 96-well cell culture plate at an effector cell to target cell ratio of 5:1. Add 2×10 K562 cell suspension. 4 / well, NK92 cells 1×10 5 / well, set 3 replicates, control cells are uninfected NK92, total culture medium volume is 200μl, (2) add 1μl of 10μg / ml Golgi inhibitor (BFA) to each well, gently shake to disperse the Golgi inhibitor in the cell suspension, incubate in an incubator for 4h, (3) after incubation, transfer each group of samples to centrifuge tubes, wash twice with FACS buffer, add 200μl of cell perforation and fixation solution to resuspend the cells, incubate at 4℃ in the dark for 30 minutes, after fixation and perforation, add FACS buffer to wash the cells, centrifuge and discard the supernatant, add 100μl of FACS buffer to suspend the cells, add 0.5μl each of PEcy7-anti-Human GzmB and APC-anti-Human IFN-γ flow cytometry antibody, gently tap the tube wall to mix, stain at 4℃ in the dark for half an hour, add FACS buffer to wash away excess antibody, add 250μl of FACS buffer to resuspend the cells, flow cytometry detection, results are shown in Figure 9 The expression levels of GzmB and IFN-γ in the SH group were higher than those in the NC group, demonstrating that GPR68 knockdown enhanced NK activation.

[0065] Detection of proliferation and anti-apoptotic ability of GPR68 knockdown NK92: (1) As mentioned above, NK92 cells (NC, SH) and K562 cells infected with the virus for 72 h were taken, counted and the cell density was adjusted, and added to a 48-well plate at an effector-to-target ratio of 4:1, with a final volume of 200 μl. (2) After culturing for 5 days, each sample was transferred to a 1.5 ml centrifuge tube, and the cells were washed twice with FACS buffer. One sample was stained with Annexin V antibody to detect the proportion of apoptotic cells, and the other two samples were incubated at 4℃ for 30 minutes with 200 μl of membrane perforation fixation solution. (3) The cells were washed with FACS buffer, centrifuged at 1000 rpm for 5 min and the supernatant was discarded. The cells were resuspended with 100 μl of FACS buffer, and 0.3 μl of APC anti-human Ki-67 or APC anti-human Bcl-2 flow cytometry antibody were added. The tube was gently tapped to mix. (4) The cells were stained at 4℃ in the dark for 30 min and the excess antibody was washed away with FACS buffer. Resuspend cells in 300 μl of FACS buffer and perform flow cytometry analysis. Results are shown below. Figure 10 As shown in the figure, the SH-NK92 group expressed more cyclin Ki-67 and the anti-apoptotic protein Bcl-2, and had a lower proportion of Annexin V+ cells than the NC-NK92 group. The results indicate that knockdown of GPR68 enhanced the proliferation and anti-apoptotic capabilities of NK92 cells.

[0066] The interference efficiency of GPR68 in CAR-NK cells was determined. (1) Based on the above results, NK92 cells (MOI=15) were infected with MUC1-CAR, pLL3.7-shRNA-NC-MUC1, and pLL3.7-shRNA-1-MUC1 viruses. Cells were collected after 24 hours, centrifuged at 1000 rpm for 5 minutes, and fresh culture medium was replaced to obtain MUC1-CAR-NK92, NC-MUC1-CAR-NK92, and SH-MUC1-CAR-NK92 cells, which were abbreviated as CAR, NC-CAR, and SH-CAR, respectively. The negative control NK92 cells that were not infected with the virus were called Mock. (2) Cells were collected after 48 hours, resuspended in 100 μl FACS buffer, and 0.3 μl APC anti-human MUC1 antibody was added. After staining at 4℃ in the dark for 30 minutes, the MUC1 positivity rate was detected by flow cytometry. The results are as follows. Figure 11 As shown, compared with Mock, the MUC1 expression of CAR, NC-CAR and SH-CAR were all above 90%.

[0067] NK92 cells infected for 48 hours were lysed with Trizol, total RNA was extracted, and the interference effect of GPR68 in NK92 cells was analyzed by RT-PCR. The results are as follows: Figure 12 As shown, pLL3.7-shRNA-1-MUC1-CAR lentivirus infection of cells can significantly interfere with the transcription of GPR68 mRNA, resulting in a significant decrease in the expression level of GPR68 mRNA to 31% of the original level, which is highly significant (P<0.0001).

[0068] cytotoxicity assay of GPR68 knockdown CAR-NK: (1) NK92 cells (CAR, NC-CAR, SH-CAR) infected with the virus for 72 h, uninfected NK92 (Mock) cells, and MUC1+ tumor cells MGC803-Luci were counted and the cell density was adjusted. They were co-cultured in low-adsorption 96-well cell culture plates at effector-to-target ratios of 1.25:1, 2.5:1, and 5:1, with 3 × 10⁶ target cells per well. 4 Each target cell was prepared in triplicate, with control cells being MGC803-Luciferase without effector cells. The final culture medium volume was 200 μl. (2) After co-culturing for 4 h, the cell suspension in the 96 wells was carefully aspirated, and the expression level of luciferase was detected using a multi-functional microplate reader according to the instructions of the firefly luciferase reporter gene assay kit. The killing efficiency was calculated, and the statistical results are shown in the figure. Figure 13The results showed that with the increase of the effector-to-target ratio, the proportion of target cells killed by the CAR-expressing group increased significantly. The killing efficiency of effector cells against MGC803-Luci cells at the three effector-to-target ratios were as follows: Mock group (20.02%, 24.74%, 32.28%); CAR group (25.88%, 34.77%, 40.64%); NC-CAR group (23.65%, 33.874%, 41.63%); SH-CAR group (38.88%, 52.07%, 63.46%). The killing efficiency of SH-CAR was better than that of CAR and NC-CAR groups, and statistical analysis showed that the difference in killing efficiency between the two groups was extremely significant (P<0.01). There was no significant difference between CAR and NC-CAR groups. This indicates that GPR68 knockdown enhances the in vitro cytotoxicity of CAR-NK cells.

[0069] GPR68 knockdown of CAR-NK in vivo anti-tumor effect, (1) using 8-week-old female NCG mice (NOD / ShiLtJGpt-Prkdc em26Cd52 Il2rg em26Cd22 A gastric cancer xenograft model was established using 2×10⁻⁶ Gpt. 6 MGC803-luci cells were subcutaneously injected into the right posterior abdomen of NSG mice. When the tumor volume reached approximately 50-100 mm, 3 Mice were randomly divided into four groups and subjected to IVIS imaging. Every 7 days, mice were intravenously injected with PBS, Mock-NK92, NC-CAR-NK92, and SH-CAR-NK92 cells. Simultaneously, 20,000 IU of recombinant human IL-2 was injected intraperitoneally. IVIS in vivo imaging was performed every few days to visualize tumor growth and observe mouse survival. Figure 14 As shown in Figure A, (2) the fluorescence area of ​​mice treated with NC-CAR-NK92 and SH-CAR-NK92 cells gradually decreased, indicating that tumor growth was inhibited. Figure 14 B shows that on day 35 of the experiment, a portion of the mouse's tumor was removed and photographed. Figure 14 C represents the survival curve of mice observed over 50 days. The survival rate of SH-CAR-NK92 mice was 100%, the survival rate of NC-CAR-NK92 group was 75%, and the Mock group began to die on day 17, with all mice dying by day 38.

[0070] In summary, the SH-CAR-NK group showed better therapeutic effects than the CAR-NK group, and the CAR-NK group was superior to the Mock group. This indicates that the expression of MUC1-CAR can target MGC803 cells with high MUC1 expression, thereby effectively killing tumors. Furthermore, the knockdown of GPR68 promoted the cytotoxicity and activity of NK cells and enhanced their anti-apoptotic ability, thus further enhancing the anti-tumor function of CAR-NK against gastric cancer in vivo.

[0071] In addition, regarding the screening of the optimal interference sequence for GPR68, during the screening of the shRNA-1 interference sequence of this application, different interference sequences were designed for multiple different target sequences, and related experiments were conducted. The experimental methods were the same as those described above. Other RNAi target sequences that were screened are shown in Table 3, and the upstream and downstream fragments of the interference sequences corresponding to each target sequence are shown in Table 4. Among them, shRNA-2 is the original sequence of the example.

[0072] Table 5. GPR68 gene RNAi target sequences

[0073] Example Target sequence name Starting position nucleotide sequence of RNAi target sequence GC% SEQ ID NO.: Example 1 Target sequence 1 542 GGAACATCACTGCAGACAACT 47.62 1 Comparative Example C1 Target sequence 2 570 GAGCTGTACCATCGACCATAC 52.39 10 Comparative Example C2 Target sequence 3 1087 GCCATCAACTACTACCGCTTC 52.39 11

[0074] Table 6. Oligonucleotide sequences designed for the target sequence and negative control sequence, respectively.

[0075]

[0076] Using the same method as described above, interfering shRNA was designed, and interfering sequence DNA double strands were synthesized and ligated into the pLL3.7 vector. Lentiviral packaging and viral titer determination were then performed. Using the same method described above, the interference effects of the pLL3.7-shRNA-1-EGFP, pLL3.7-shRNA-2-EGFP, pLL3.7-shRNA-3-EGFP, and pLL3.7-shRNA-NC-EGFP plasmids were tested. Figure 7 The RT-PCR results showed that, based on the mRNA expression of GPR68, among the multiple screened interfering RNAs, the expression levels of shRNA-2 and shRNA-3 interfering groups were higher than those of shRNA-1, therefore the shRNA-1 fragment had the best interference effect.

[0077] This invention utilizes RNA interference technology to design and screen for the most effective interference sequence, successfully knocking down GPR68 in NK92 cells, and designing and developing a GPR68-knockdown MUC1-CAR-NK to enhance its anti-tumor function, thereby providing a new strategy for CAR-NK therapy of solid tumors.

[0078] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0079] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

Claims

1. A method for enhancing CAR-NK cell function by interfering with GPR68, characterized in that, Includes the following steps: Step 1: Design RNAi target sequences based on the GPR68 gene. The nucleotide sequence of the RNAi target sequence of the GPR68 gene is SEQ ID NO.

1. Step 2: Design an interference sequence based on the RNAi target sequence. The nucleotide sequence of the interference sequence GPR68-shRNA-1 is SEQ ID NO.2 and SEQ ID NO.

3. Step 3: Construct the interfering plasmid pLL3.7-shRNA-1-EGFP. Based on the interfering sequence in Step 2, synthesize the double-stranded DNA sequence of the target sequence. Digest the empty vector pLL3.7 with restriction endonucleases HpaI and XhoI, and ligate it with T4 DNA ligase to construct the recombinant plasmid pLL3.7-shRNA-1-EGFP. Step 4, Construction of pLL3.7-shRNA-1-MUC1-CAR plasmid: The pLL3.7-MUC1-CAR vector was digested with restriction endonucleases XbaI and XhoI, and the large fragment was recovered. The pLL3.7-shRNA-1-EGFP was digested with restriction endonucleases XbaI and XhoI, and the small fragment was recovered. The fragments were then ligated with T4 DNA ligase to obtain the pLL3.7-shRNA-1-MUC1-CAR plasmid. Step 5: scFv sequence of anti-human MUC1 antibody. Select the scFv sequence of anti-human MUC1 antibody to construct pLL3.7-MUC1-CAR vector, named MUC1-scFv. The nucleotide sequence of MUC1-scFv is SEQ ID NO.6, and the amino acid sequence is SEQ ID NO.

7.

2. The method for enhancing CAR-NK cell function by interfering with GPR68 according to claim 1, characterized in that: The pLL3.7-MUC1-CAR vector, or CAR, is composed of the following amino acid sequences from the amino terminus to the carboxyl terminus: the amino acid sequence of the human CD8α signal peptide (SEQ ID No. 9, 1-21AA), the amino acid sequence of the Flag tag (SEQ ID No. 9, 22-29AA), the amino acid sequence of the anti-human MUC1-scFv (SEQ ID No. 9, 30-274AA), the amino acid sequence of the human CD8α hinge (SEQ ID No. 9, 275-319AA), the amino acid sequence of the human CD8α transmembrane region (SEQ ID No. 9, 320-343AA), the amino acid sequence of the human 4-1BB intracellular domain (SEQ ID No. 9, 344-385AA), and the amino acid sequence of the human CD3ζ domain (SEQ ID No. 9, 386-498AA).

3. The method for enhancing CAR-NK cell function by interfering with GPR68 according to claim 2, characterized in that: The amino acid sequence of the pLL3.7-MUC1-CAR vector is SEQ ID No. 9, and the nucleotide sequence of the chimeric antigen receptor molecule targeting human MUC1 synthesized in its entirety is SEQ ID No.

8. The vector is linked to the lentiviral vector pLL3.7 by molecular cloning to construct a full-length MUC1-CAR sequence expression cassette with a single coding frame, and expressed using the EF1α promoter.

4. The application of the method for enhancing CAR-NK cell function by interfering with GPR68 according to any one of claims 1-3, characterized in that: Enhance the immune function and anti-tumor activity of NK cells and CAR-NK cells.