FAS ligand variants and recombinant cells exhibiting increased cytotoxicity and improved viability.

FasL variants with targeted amino acid sequences enhance NK cell viability and cytotoxicity by redistributing FasL to secretory lysosomes, addressing the limitations of existing AICD modification techniques and improving cancer treatment efficacy.

JP2026520882APending Publication Date: 2026-06-25オンニ バイオテクノロジーズ オサケ ユキチュア
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025569498
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-05-29
Filing Date
2024-05-28
Publication Date
2026-06-25

AI Technical Summary

Technical Problem

Existing methods for modifying NK cells to enhance cytotoxicity and viability face challenges with persistent side effects and reduced cytotoxicity or viability, as AICD (activation-induced cell death) modification techniques often lead to undesirable outcomes.

Method used

Development of Fas ligand (FasL) variants with specific amino acid sequences that facilitate intracellular transport to secretory lysosomes, reducing AICD and enhancing cytotoxic activity through extracellular vesicle release, thereby increasing NK cell viability and cytotoxicity.

Benefits of technology

The FasL variants improve NK cell viability and cytotoxicity, resulting in more efficient cancer cell destruction and higher yields during in vitro culture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026520882000001
    Figure 2026520882000001
  • Figure 2026520882000002
    Figure 2026520882000002
  • Figure 2026520882000003
    Figure 2026520882000003
Patent Text Reader

Abstract

Disclosed are variants of Fas ligands (APTL, FASL, CD178, CD95L, ALPS1B, CD95-L, TNFSF6, TNLG1A, APT1LG1) and vectors providing them. Furthermore, recombinant cells, such as NK cells (natural killer cells), containing genetic elements that enable the production of at least one FasL variant to enhance the cytotoxicity and viability of recombinant cells and improve the therapeutic activity of recombinant cells are disclosed. Also disclosed are pharmaceutical compositions containing recombinant cells and methods for obtaining them, as well as NK cells modified to express Fas ligand variants for use in immunotherapy.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This invention generally relates to Fas ligand (FasL) variants and recombinant cells expressing them. In particular, the invention relates to immune cells, such as natural killer cells, that express FasL variants, though not exclusively. In some embodiments, the invention relates to methods for improving the functionality of NK cells, such as their cytotoxic activity and viability, for use in immunotherapy. Specifically, these methods include compositions of DNA fragments of Fas ligand (APTL; FASL; CD178; CD95L; ALPS1B; CD95-L; TNFSF6; TNLG1A; APT1LG1) variants, and methods for producing recombinant NK cells with increased Fas ligand production. The invention also encompasses compositions of engineered recombinant NK cells and NK cell lines, and their use for treating or preventing cancer and other immune-related diseases. This disclosure further includes natural killer (NK) cells modified to express Fas ligand variants for use in therapy, such as immunotherapy. [Background technology]

[0002] This section provides useful background information without any acceptance that any of the technologies described herein are representative of prior art. NK cells are the primary cellular effectors of the innate immune system, destroying a variety of targets, including infected or transformed cells, and possibly senescent or stressed cells (Shimasaki et al., Nat Rev Drug Discov. 2020 Mar;19(3):200-218; Giannoula et al., Biomed J. 2023 Feb 4:S2319-4170(23) 00005-7). NK cells do not require prior antigen exposure or MHC restriction (Schattner, Duggan. Am J Hematol. 1985 Apr;18(4):435-43; Brix et al. US 10030065B2 / 2018). NK cells lack surface T cell receptors (TCRs) and do not induce graft-versus-host disease (GVHD). Therefore, they are considered an off-shelf cell therapy product that can be pre-prepared, optimized, and administered to patients when needed. These attributes give NK cells unique advantages for autologous and allogeneic therapeutic applications.

[0003] The functions of NK cells, including cytotoxicity, cytokine synthesis, and degranulation, are regulated by signaling mediated by inhibitory receptors (particularly killer Ig-like receptors (KIRs) and heterodimeric C-type lectin receptors (NKG2A)) and activating receptors (particularly the natural cytotoxicity receptors (NCRs) NKp46, NKp30, NKp44, and the lectin-like C-type activated immune receptor NKG2D7) that recognize ligands on target cells (Toledo et al., Sci Adv. 2021 Jun 11;7(24):eabc16405-8; Rascle et al., Front Immunol. 2023 Jan 20;14:1087155; Valton et al., JP2022101530A / 2022; Andre, Kubler, ES2772307T3 / 2020).

[0004] NK cells can directly kill tumor cells by a) releasing cytoplasmic granules containing perforin and granzymes, and by b) expressing TNF family proteins such as FasL or TRAIL, which induce apoptosis in tumor cells by interacting with their respective receptors. Immature NK cells are more likely to use TRAIL-dependent cytotoxicity rather than FasL-dependent or granule-release-dependent cytotoxicity, while mature NK cells primarily use both FasL-dependent and granule-release-dependent cytotoxicity (Zamai et al., J Exp Med. 1998 Dec 21;188(12):2375-80). In addition, antibody-dependent cell-mediated cytotoxicity (ADCC) mediated by the CD16 Fc receptor can induce NK cell-mediated death of target cells that have interacted with the antibody (Bunting et al., Sci Adv. 2022 Mar 18;8(11):eabk3327; Orange, Nat Rev Immunol. 2008 Sep;8(9):713-25.). Furthermore, IFN-γ produced by activated NK cells influences tumors because it induces remodeling of the tumor microenvironment, inhibits tumor angiogenesis, and possesses anti-metastatic activity (von Locquenghien et al., J Clin Invest. 2021 Jan 4;131(1):e143296; Granzin et al., Front Immunol. 2017 Apr 26; 8:458; Chawla-Sarkar et al., Apoptosis. 2003 Jun;8(3):237-49; JP7204643B2 / 2023).

[0005] In NK cells, FasL is stored in secretory lysosomes that also contain granzymes and perforins. The co-localization of FasL, perforins, and granzymes within the same intracellular structure suggests that simultaneous delivery of these apoptosis-inducing molecules to the immune synapse between effector and target cells may lead to more efficient and rapid killing of target cells. Intracellular accumulation of FasL is tightly controlled by its cytoplasmic tail and interacting molecules (Bossi et al., Nat Med. 1999 Jan;5(1):90-6; Glukhova et al., Cell Death Dis. 2018 Jan 22;9(2):73). When NK cells collide with target cells such as tumor cells, cytoplasmic granules containing FasL (secretory lysosomes) are transported to the site of intercellular contact, where they fuse with the plasma membrane, resulting in the exposure of FasL within the immune synapse. Selective association with lipid rafts on the cell surface increases the cell death-promoting activity of FasL (Lettau et al., Curr Med Chem. 2008;15(17):1684-96; Kassahn et al., Cell Death Differ. 2009 Jan;16(1):115-24).

[0006] T cells have been shown to clonalize rapidly after antigen stimulation, but then decrease in number as a result of programmed cell death. This secondary stage is known as peripheral deletion, and it is due to the involvement of apoptotic pathways in signaling for clonal proliferation. This phenomenon is called "activation-induced cell death (AICD)" and is mediated by the interaction of Fas and FasL on activated T cells. Antigen stimulation causes T cells to upregulate FasL, increasing their sensitivity to Fas-mediated apoptosis. As the Fas-FasL interaction between T cells leads to T cell death, the number of T cells decreases (Yamauchi et al., Blood. 1996 Jun 15;87(12):5127-35; Hennessy et al., J Leukoc Biol 2019 Jun;105(6):1341-1354). A similar phenomenon has been shown in NK cells. During the immune response, proliferated activated NK cells begin to express Fas and ultimately undergo AICD mediated by the secretion of the body's own FasL (Masuda et al., Cancer Sci. 2020 Mar;111(3):807-816; Lopez-Verges et al., Blood. 2010 Nov 11;116(19):3865-74; Lee et al., Cytokine. 2012; 59(3): 547).

[0007] Methods and compositions for modifying AICD in T cells and / or NK cells have previously been shown to be involved in the treatment of diabetes and anticancer therapies, and these are summarized below.

[0008] U.S. Patent No. 9,624,469 / 2017 (Regulatory immune cells with enhanced targeted cell death effect) discloses that targeted simulation of the activation-induced cell death (AICD) process at inflammatory sites improves inflammatory insulinitis. The inventors have created regulatory T cells (Tregs) with enhanced cell death effect by chemically conjugating a chimeric Fas ligand (FasL) protein to the surface of these cells and are using them for the suppression of diabetes-induced effector cells at inflammatory sites and for the treatment of diabetes. These results demonstrate the value of modified Treg cells overexpressing death molecules such as FasL for the treatment of immune-related diseases.

[0009] International Publication No. 2019 / 014684 / 2019 provides a method for inhibiting AICD of T cells and / or NK cells in subjects with chronic lymphocytic leukemia, comprising administering ibrutinib, an interleukin-2-inducible T-cell kinase (ITK) inhibitor, to the subjects. This data demonstrates that ibrutinib therapy is conceivable as a cellular immunomodulator for CLL, and optionally for other types of hematological cancers and solid tumors.

[0010] The authors of Australian Patent Application Publication No. 2019347873 / 2021 disclose a method for obtaining genetically modified immune-responsive cells (e.g., T cells or NK cells) comprising an antigen-recognizing receptor and a dominant-negative Fas polypeptide. Such T cells or NK cells are conferred with enhanced selective cytotoxic activity at tumor sites.

[0011] U.S. Patent Application Publication No. 2019 / 0038671 / 2019 discloses a pharmaceutical composition based on engineered mammalian cells, comprising a vector containing a heterogeneous nucleic acid encoding an immunomodulatory factor (immune checkpoint inhibitor or immune activator) and a second heterogeneous nucleic acid encoding a CAR or TCR. Such T cells may be more resistant to activation-induced cell death and may be widely applicable in cancer immunotherapy.

[0012] U.S. Patent Application Publication No. 2021 / 0246423 / 2021 proposes a method for improving the in vitro proliferation and activation of immune cells and preventing AICD. This method is based on the discovery that activation of CARs expressed on the surface of immune effector cells (e.g., transiently expressed) provides an effective means for proliferation and / or activation of a population of immune effector cells.

[0013] Canadian Patent No. 2706445 / 2019 describes a method for protecting immune cells from cell death using IRX-2. IRX-2, also known as "citoplurikin," is a natural primary cell-derived biopharmaceutical produced by mononuclear cells stimulated with phytohemagglutinin and ciprofloxacin. IRX-2 protects activated T cells from both extrinsic and endogenous metabolic apoptosis and enhances their antitumor activity.

[0014] Excessive Fas ligand on the plasma membrane (within lipid rafts) can lead to the death of the cells that produce it. Retaining Fas ligand intracellularly, particularly within secretory lysosomes, is a defense mechanism and a crucial factor in the cytotoxic activity of NK cells (Krzewski et al., Front Immunol. 2012 Nov 9;3:335; Lee et al., Immun Inflamm Dis. 2018 Jun;6(2):312-321). Known "trafficking domains" are primarily LAMP lumen domains, which effectively target proteins containing them to lysosomal vesicles. A summary of protein modification methods for targeting proteins to endosomal / lysosomal compartments is provided below.

[0015] U.S. Patent No. 5,633,234 / 1997 (Lysosomal targeting of immunogens, expired) discloses targeting signals that direct proteins to endosomal / lysosomal compartments. The authors demonstrated that chimeric proteins containing cytoplasmic endosomal / lysosomal targeting signals effectively target antigens to these compartments.

[0016] U.S. Patent Application Publication 2004 / 0157307 / 2004 (Chimeric vaccines) describes a chimeric protein comprising an antigen sequence and a domain for transporting the protein to an endosomal compartment, regardless of whether the antigen is a membrane-derived or non-membrane-derived protein. In a preferred embodiment of the present invention, the trafficking domain comprises the luminal domain of a LAMP polypeptide.

[0017] U.S. Patent No. 9,993,546 / 2018 (Lysosomal targeting of antigens employing nucleic acids encoding lysosomal membrane polypeptide / antigen chimeras) discloses lysosomal targeting of antigens employing nucleic acids encoding lysosomal membrane polypeptide / antigen chimeras. In a preferred embodiment, the trafficking domain comprises the luminal domain of a LAMP polypeptide. Alternatively, or in addition, the chimeric protein comprises the trafficking domain of an endocytosis receptor (e.g., DEC-205 or gp200-MR6).

[0018] Australian Patent Application Publication No. 2019250227 / 2021 (Nucleic acids for treatment of allergies) provides DNA vaccines for the treatment of allergies. These vaccines comprise sequences encoding one or more allergen epitopes, preferably full-length protein sequences of the allergen protein from which the epitope is derived, which are fused in-frame with the luminal domain and targeting sequences of lysosome-associated membrane proteins (LAMPs).

[0019] The ability of NK cells to control AICD has a significant impact on NK cell therapy for cancer. Common drawbacks of known AICD modification techniques are a) the difficulty in controlling persistent side effects caused by these treatments, and b) the fact that AICD inhibition leads to higher NK cell viability but reduced cytotoxicity, and vice versa (increased AICD leads to decreased viability and higher cytotoxic activity).

[0020] Therefore, there is a need for alternative, preferably improved, human NK cells that possess higher cytotoxicity and more pronounced viability. [Overview of the Initiative] [Problems that the invention aims to solve]

[0021] FasL variants and recombinant cells expressing them offer significant advantages in immunotherapy by redistributing the FasL variant to secretory lysosomes but not to the cell membranes of recombinant cells such as recombinant NK cells. This reduces AICD (activation-induced cell death) during NK cell activation, resulting in increased viability and enhanced cytotoxic activity of recombinant cells through the release of extracellular vesicles containing the FasL variant by secretory lysosomes (cytotoxic granules) from the recombinant cells of the present invention. In addition, the use of FasL variants enables greater yields of recombinant cells with high cytotoxic activity, such as recombinant NK cells, during in vitro culture. [Means for solving the problem]

[0022] The attached claims define the scope of the claims. Any examples and technical descriptions of apparatus, products, and / or methods in the specification and / or drawings, unless covered by a claim, are presented not as embodiments of the invention, but as examples useful for understanding the background art or the invention. This disclosure should be understood not to be limited to the details described below in the embodiments, claims, specification and drawings. The invention may have other embodiments and may be carried out or performed in a variety of other ways.

[0023] To address this need for more efficient destruction of cancer cells, the Specified Provision provides nucleotide and amino acid sequences and vectors encoding gene constructs that confer both greater viability and enhanced cytotoxicity to natural killer cells. A further objective is to provide a method for producing modified (recombinant) NK cells having increased Fas-ligand (variant) production, a composition comprising such cells, and the use of such composition in the treatment of cancer.

[0024] According to some embodiments, NK cells are derived from umbilical cord blood, peripheral blood, bone marrow, CD34-positive cells, iPSCs, or ESCs. In some aspects, NK cells are human NK cell lines such as NKL (CVCL_0466), YTS (CVCL_D324), NK3.3 (CVCL_7994), NK-92 (CVCL_2142), KHYG-1 (CVCL_2976), haNK (CVCL_JM23), and laNK (CVCL_VN54). According to some embodiments of the present invention, NK cells are cells that have infiltrated tissue.

[0025] According to a first exemplary embodiment, a Fas ligand (FasL) variant is provided having an intracellular domain comprising at least one amino acid sequence GYXXφ, wherein (X) is any amino acid and (φ) is an amino acid selected from amino acids L, I, or V, and the amino acid position of the above amino acid sequence corresponds to the amino acid position of SEQ ID NO: 1.

[0026] In one embodiment, the intracellular domain of the Fas ligand (FasL) variant comprises at least two, preferably at least three, amino acid sequences GYXXφ (wherein X is any amino acid and φ is an amino acid selected from amino acids L, I, or V), and the amino acid positions of the amino acid sequences correspond to the amino acid positions of SEQ ID NO: 1. In another embodiment, the intracellular domain of the Fas ligand (FasL) variant corresponds to amino acids 1 to 80 of SEQ ID NO: 1, and the intracellular domain comprises at least one amino acid sequence GYXXφ, where (X) is any amino acid and (φ) is an amino acid selected from amino acids L, I, or V, and the amino acid positions of the amino acid sequences correspond to the amino acid positions of SEQ ID NO: 1.

[0027] The intracellular domain of wild-type FasL is composed of amino acids 1 to 80 corresponding to amino acids 1 to 80 of SEQ ID NO: 47. The intracellular domain of wild-type human FasL is amino acids 1 M to G 80 and is composed of. Wild-type human FasL has the amino acid sequence of SEQ ID NO: 47.

[0028] In one embodiment, a Fas ligand (FasL) variant has an intracellular domain comprising the amino acid sequence 6 GYXXφ 10 where (X) is any amino acid and (φ) is an amino acid selected from amino acids L, I or V, and the amino acid position of the above amino acid sequence corresponds to the amino acid position of SEQ ID NO: 1.

[0029] In one embodiment, a Fas ligand (FasL) variant 6 GYXXφ 10 , 8 GYXXφ 12 , and 67 GYXXφ 71 and has an intracellular domain comprising at least one amino acid sequence selected from, where (X) is any amino acid and (φ) is an amino acid selected from amino acids L, I or V, and the amino acid position of the above amino acid sequence corresponds to the amino acid position of SEQ ID NO: 1.

[0030] In one embodiment, a FasL variant is obtained by introducing amino acid substitutions into the wild-type FasL amino acid sequence. In one embodiment, a FasL variant is obtained by introducing at least four amino acid substitutions into the intracellular domain of the wild-type FasL sequence of SEQ ID NO: 47. According to some embodiments of the present invention, amino acid substitutions for modified forms of Fas ligand were selected according to data from Bonifacino and Traub (Annu Rev Biochem. 2003; 72:395-447). The selected amino acid substitutions are designed to redistribute the transport of Fas ligand to intracellular depots, including secretory lysosomes, rather than the plasma membrane.

[0031] In one embodiment, the FasL variant comprises an intracellular domain containing the amino acid sequence YXXφ, where Y is tyrosine, X is any amino acid, and φ is a hydrophobic amino acid selected from leucine, isoleucine, or valine (L;I;V).

[0032] According to some embodiments of the present invention, the YXXφ site in the intracellular domain of the Fas ligand is involved in the interaction with the adapter protein (AP) complex and is responsible for ligand internalization and transport to secretory lysosomes. In some embodiments, a glycine residue preceding tyrosine facilitates the transport of the protein into the lysosomal compartment.

[0033] In one embodiment, the FasL variant comprises an intracellular domain containing the amino acid sequence GYXXφ, where G is glycine, Y is tyrosine, X is any amino acid, and φ is a hydrophobic amino acid selected from leucine, isoleucine, or valine (L;I;V).

[0034] According to some embodiments of the present invention, modified Fas ligands include amino acid substitutions that result in a GYXXφ repeat site containing a hydrophobic amino acid (leucine, isoleucine, or valine (L;I;V)) that facilitates their transport to secretory lysosomes.

[0035] In one embodiment, the intracellular domain of the FasL variant includes an amino acid sequence selected from GYXXL, GYXXI, or GYXXV, where X is one of the amino acids.

[0036] In one embodiment, the FasL variant is FasLmod1. According to some embodiments of the present invention, FasLmod1, a modified form of Fas ligand, has the following sites that facilitate their transport to secretory lysosomes and increase cytotoxicity: 6 GYGYL 10 , 8 GYLQI 12 , 13 YWVL 16 This includes G-glycine, Y-tyrosine, L-leucine, Q-glutamine, I-isoleucine, W-tryptophan, V-valine, and P-proline.

[0037] In one embodiment, the FasL variant has an amino acid position corresponding to the amino acid position of SEQ ID NO: 1. 6 GYGYL 10 , 8 GYLQI 12 , and 13 YWVL 16 It comprises an intracellular domain having at least one amino acid sequence selected from. In one embodiment, the FasL variant has an amino acid position corresponding to the amino acid position of SEQ ID NO: 1 6 GYGYLQIYWVL 16 It contains an intracellular domain with the following amino acid sequence.

[0038] In one embodiment, the FasL variant is FasLmod2. According to some embodiments of the present invention, FasLmod2, a modified form of the Fas ligand, has the following sites that promote transport to secretory lysosomes and increase cytotoxicity: 6 GYGYI 10 , 8 GYIQI 12 , 13 YWVI 16This includes the amino acid single-letter codes, which are as previously presented.

[0039] In one embodiment, the FasL variant has an amino acid position corresponding to the amino acid position of SEQ ID NO: 1. 6 GYGYI 10 , 8 GYIQI 12 , and 13 YWVI 16 It comprises an intracellular domain having at least one amino acid sequence selected from. In one embodiment, the FasL variant is 6 GYGYIQIYWVI 16 It contains an intracellular domain with the amino acid sequence, where the amino acid positions correspond to the amino acid positions of SEQ ID NO: 1.

[0040] In one embodiment, the FasL variant is FasLmod3. According to some embodiments of the present invention, FasLmod3, a modified form of the Fas ligand, has the following sites that promote transport to secretory lysosomes and increase cytotoxicity: 6 GYGYV 10 , 8 GYVQI 12 , 13 YWVV 16 This includes the amino acid single-letter codes, which are as previously presented.

[0041] In one embodiment, the FasL variant is 6 GYGYV 10 , 8 GYVQI 12 , and 13 YWVV 16 It comprises an intracellular domain having at least one amino acid sequence selected from, the amino acid position corresponding to the amino acid position of SEQ ID NO: 1. In one embodiment, the FasL variant is 6 GYGYVQIYWVV 16 It contains an intracellular domain with the amino acid sequence, where the amino acid positions correspond to the amino acid positions of SEQ ID NO: 1.

[0042] In one embodiment, the FasL variant is FasLmod4. According to some embodiments of the present invention, FasLmod4, a modified form of the Fas ligand, has the following sites that promote transport to secretory lysosomes and increase cytotoxicity: 6 GYGYL 10 , 8 GYLQI 12 , 13 YWVL 16 , 67 GYPPL 71 This includes the amino acid single-letter codes, which are as previously presented.

[0043] In one embodiment, the FasL variant is 6 GYGYL 10 , 8 GYLQI 12 , 13 YWVL 16 , and 67 GYPPL 71 It comprises an intracellular domain containing at least one amino acid sequence selected from, where the amino acid position corresponds to the amino acid position of SEQ ID NO: 1. In one embodiment, the FasL variant is 6 GYGYLQIYWVL 16 The amino acid sequence and 67 GYPPL 71 It contains an intracellular domain with the amino acid sequence, where the amino acid positions correspond to the amino acid positions of SEQ ID NO: 1.

[0044] In one embodiment, the FasL variant is FasLmod5. According to some embodiments of the present invention, FasLmod5, a modified form of the Fas ligand, has the following sites that promote transport to secretory lysosomes and increase cytotoxicity: 6 GYGYI 10 , 8 GYIQI 12 , 13 YWVI 16 , 67 GYPPI 71 This includes the amino acid single-letter codes, which are as previously presented.

[0045] In one embodiment, the FasL variant includes an intracellular domain comprising at least one amino acid sequence selected from: 6 GYGYI 10 , 8 GYIQI 12 , 13 YWVI 16 , and 67 GYPPI 71 corresponding to the amino acid positions of SEQ ID NO: 1. In one embodiment, the FasL variant includes an intracellular domain comprising the amino acid sequences of 6 GYGYIQIYWVI 16 and 67 GYPPI 71 .

[0046] In one embodiment, the FasL variant is FasLmod6. According to some embodiments of the present invention, FasLmod6, a modified form of Fas ligand, promotes transport to secretory lysosomes and increases cytotoxicity at the following sites: 6 GYGYV 10 , 8 GYVQI 12 , 13 YWVV 16 , 67 GYPPV 71 , where the single-letter amino acid code is as presented above.

[0047] In one embodiment, the FasL variant includes an intracellular domain comprising at least one amino acid sequence selected from: 6 GYGYV 10 , 8 GYVQI 12 , 13 YWVV 16 , and 67 GYPPV 71 corresponding to the amino acid positions of SEQ ID NO: 1. In one embodiment, the FasL variant includes an intracellular domain comprising the amino acid sequences of 6 GYGYVQIYWVV 16 and 67GYPPV 71 It contains an intracellular domain with the following amino acid sequence.

[0048] In one embodiment, the intracellular domain of the FasL variant is 6 GYGYL 10 , 6 GYGYI 10 ,or 6 GYGYV 10 It includes an amino acid sequence selected from, where the amino acid positions of the sequence correspond to the amino acid positions of SEQ ID NO: 1. In one embodiment, the intracellular domain of the FasL variant is 6 GYXXφ 10 The amino acid sequence of the FasL variant includes the amino acid sequence GYXXφ, where X is any amino acid and φ is an amino acid selected from amino acids L, I, or V, and the amino acid sequence of the FasL variant has at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity with the sequence of SEQ ID NO: 1, and the amino acid positions of the sequence correspond to the amino acid positions of SEQ ID NO: 1. In one embodiment, the intracellular domain of the FasL variant includes the amino acid sequence GYXXφ, where X is any amino acid and φ is an amino acid selected from amino acids L, I, or V, and the amino acid sequence of the FasL variant has at least 80%, preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 97% sequence identity with amino acids 1 to 80 of SEQ ID NO: 1, and the amino acid positions of the sequence correspond to the amino acid positions of SEQ ID NO: 1. In such one embodiment, the amino acid sequence GYXXφ is preferably at 6 GYXXφ 10 It is located at the amino acid position corresponding to the amino acid position of SEQ ID NO: 1. In one embodiment, the intracellular domain of the FasL variant is located at at least the amino acid position N 6 , P 8 , P 10 , and D 16 This includes an amino acid substitution, in which case the amino acid position corresponds to the wild-type FasL amino acid in SEQ ID NO: 47.

[0049] In one embodiment, the intracellular domain of the FasL variant is P 8 , and P 10 , N 6 , P 8 , and P 10 , N 6 , P 8 , P 10 , and D 16 , N 6 , P 8 , P 10 , I 16 , P 67 , and L 68 , N 6 , P 8 , P 10 , I 16 , P 67 , L 68 , L 71 , and These combinations The variant includes a set of amino acid substitutions at an amino acid position selected from, where the amino acid position corresponds to the wild-type FasL amino acid of SEQ ID NO: 47. In one embodiment, the intracellular domain of the FasL variant includes amino acid substitutions at at least positions N6G, P8G, P10φ, and D16Z, where both (φ) and (Z) are independently selected from amino acids L, I, or V, where the amino acid position corresponds to the wild-type FasL amino acid of SEQ ID NO: 47.

[0050] In one embodiment, the intracellular domain of the FasL variant is P8G and P10L; or P8G and P10I; or P8G and P10V; or N6G, P8G, and P10L; or N6G, P8G, and P10I; or N6G, P8G, and P10V; or N6G, P8G, P10L, and D16I; or N6G, P8G, P10I, and D16I; or N6G, P8G, P10V, and D16I; or N6G, P8G, P10L, and D16V; or N6G, P8G, P10I, and D16V; or N6G, P8G, P10V, and D16V; or N6G, P8G, P10L, and D16L; or N6G, P8G, P10I, and D16L; or N6G, P8G, P10V, and D16L; or P67G and L68Y; or P67G, L68Y and L71I; or P67G, L68Y and L71V, and those combinations This includes a series of amino acid substitutions at amino acid positions selected from, where the amino acid positions correspond to the wild-type FasL amino acids of SEQ ID NO: 47. In one embodiment, the intracellular domain of the FasL variant is the amino acid sequence 6 GYGYφQIYWVZ 16 This includes, where both (φ) and (Z) are independently selected from amino acids L, I, or V, and the amino acid positions in the above amino acid sequence correspond to the amino acid positions of SEQ ID NO: 1. In such embodiments, X 10 and X 16 The amino acids at this position can be selected independently.

[0051] In one embodiment, the intracellular domain of the FasL variant is an amino acid sequence 6 GYGYLQIYWVL 16 ,or 6 GYGYIQIYWVI 16 ,or 6 GYGYVQIYWVV 16 It contains, and the amino acid position corresponds to the amino acid position of SEQ ID NO: 1. In one embodiment, the intracellular domain of the FasL variant is the amino acid sequence 6 GYGYLQIYWVL 16 ,or 6 GYGYIQIYWVI 16 ,or 6 GYGYVQIYWVV 16 ,or 6GYGYLQIYWVL 16 and 67 GYPPL 71 ,or 6 GYGYIQIYWVI 16 and 67 GYPPI 71 ,or 6 GYGYVQIYWVV 16 and 67 GYPPV 71 It contains, and the amino acid positions correspond to the amino acid positions of SEQ ID NO: 1.

[0052] In one embodiment, the intracellular domain of the FasL variant is an amino acid sequence 6 GYGYLQIYWVL 16 , 6 GYGYLQIYWVI 16 , 6 GYGYLQIYWVV 16 , 6 GYGYIQIYWVL 16 , 6 GYGYIQIYWVI 16 , 6 GYGYIQIYWVV 16 , 6 GYGYVQIYWVL 16 , 6 GYGYVQIYWVI 16 ,or 6 GYGYVQIYWVV 16 It includes, in which case the amino acid positions of the sequence correspond to the amino acid positions of SEQ ID NO: 1. In one embodiment, the FasL variant is an amino acid sequence 6 GYGYLQIYWVL 16 ,or 6 GYGYIQIYWVI 16 ,or 6 GYGYVQIYWVV 16 It includes an intracellular domain containing [specific amino acid], in which case the amino acid position corresponds to the amino acid position of SEQ ID NO: 1.

[0053] In one embodiment, the FasL variant is an amino acid sequence 6 GYGYLQIYWVL 16 , 6GYGYIQIYWVI 16 , 6 GYGYVQIYWVV 16 , 6 GYGYLQIYWVL 16 and 67 GYPPL 71 , 6 GYGYIQIYWVI 16 and 67 GYPPI 71 ,or 6 GYGYVQIYWVV 16 and 67 GYPPV 71 It includes an intracellular domain containing [specific amino acid], in which case the amino acid position corresponds to the amino acid position of SEQ ID NO: 1.

[0054] In one embodiment, the Fas ligand (FasL) variant comprises an amino acid sequence selected from SEQ ID NOs: 1 to 6.

[0055] In one embodiment, the FasL variant includes a modification that promotes the transport of the FasL variant to secretory lysosomes when expressed intracellularly. In one embodiment, the FasL variant includes a modification that reduces the transport of the FasL variant to the cell membrane when expressed intracellularly, compared to FasL without the above modification (i.e., unmodified FasL). In one embodiment, the modification of the FasL variant includes at least two, at least three, at least four, at least five, at least six, or at least seven amino acid substitutions compared to wild-type FasL. In one embodiment, the Fas ligand (FasL) variant is obtained by introducing at least three or four amino acid substitutions into wild-type FasL. In one embodiment, the FasL variant may include at least two or three further modifications in addition to at least four amino acid substitutions, where at least one of the further modifications is selected from the group consisting of amino acid substitutions, deletions, and insertions. In one embodiment, the mutation introduced into the FasL variant is located within the intracellular domain of the FasL variant. In some embodiments, only a portion of the mutations introduced into the FasL variant reside within the intracellular domain of the FasL variant, while other mutations may be located within other domains of the FasL variant. In one embodiment, the FasL variant comprises at least one amino acid substitution compared to wild-type FasL, the amino acid substitution configured to facilitate the transport of the FasL variant to secretory lysosomes when expressed intracellularly. In one embodiment, the FasL variant comprises at least two, at least three, or at least four amino acid substitutions compared to wild-type FasL, the amino acid substitution configured to facilitate the transport of the FasL variant to secretory lysosomes when expressed intracellularly. In one embodiment, the nucleic acid sequence of the FasL variant of this disclosure is codon-optimized for expression in mammalian cells, preferably in human cells.According to some embodiments of the present invention, the substituted amino acids leucine, isoleucine, or valine (L, I, V) in modified forms of Fas ligands such as FasLmod1-6 are encoded by codons optimized for the use of human codons for expression in human cells. Unless otherwise specified, a particular nucleic acid sequence of a modified form of Fas ligand implicitly includes its conservatively modified variant (e.g., degenerate codon substitution).

[0056] According to a second exemplary embodiment, recombinant cells are provided that include a genetic element capable of producing at least one FasL variant of the first embodiment. In one embodiment, the recombinant cells are immune-responsive cells. In one embodiment, the recombinant cells are derived from a lymphoid or myeloid lineage. In one embodiment, the recombinant cells are selected from the group consisting of T cells, natural killer (NK) cells, B cells, monocytes, and macrophages. In one embodiment, the T cells are cytotoxic T lymphocytes (CTLs), regulatory T cells, or natural killer T (NKT) cells. In a preferred embodiment, the recombinant cells are recombinant NK cells.

[0057] In one embodiment, recombinant cells are genetically engineered immune cells such as natural killer (NK) cells. In one embodiment, recombinant cells are mammalian-derived cells, most preferably human-derived cells. In one embodiment, recombinant cells are genetically engineered immune cells, preferably human immune cells. In one embodiment, recombinant cells are engineered to express a FasL variant that has enhanced transport to secretory lysosomes and reduced transport to the cell membrane compared to wild-type FasL. In one embodiment, recombinant cells are beneficial because they have increased cytotoxicity and viability compared to cells producing unmodified (wild-type) FasL. In one embodiment, the increased viability of recombinant cells compared to corresponding cells expressing unmodified FasL is achieved by increased cell viability of recombinant cells expressing the FasL variant. In one embodiment, recombinant cells showed at least 100% and at least 200% increased cell viability compared to corresponding cells expressing unmodified FasL, as measured after 11 days of culture. In one embodiment, the increased cytotoxicity of recombinant cells compared to corresponding cells expressing unmodified FasL is achieved by a decrease in the viability of target (cancerous) cells in the presence of recombinant cells expressing the FasL variant. In one embodiment, the recombinant cells are human natural killer (NK) cells.

[0058] In one embodiment, recombinant cells are derived from umbilical cord blood, peripheral blood, bone marrow, tissue in which the cells have infiltrated, and / or recombinant cells are derived from CD34-positive cells, iPSCs (induced pluripotent stem cells), ESCs (embryonic stem cells), or human NK cell lines. The object of the present invention is to provide a method for transfecting NK cells, characterized in that cells having a modified form of Fas ligand have higher cytotoxicity compared to unmodified NK cells and greater viability compared to cells producing unmodified FasL, and to provide the use of these cells for the treatment of cancer and other diseases.

[0059] In one embodiment, the recombinant cells are recombinant NK cells comprising a Fas ligand variant having selected amino acid substitutions in the intracellular domain that redistribute the transport of the FasL variant toward secretory lysosomes. Preferably, the FasL variant has an amino acid sequence selected from SEQ ID NOs. 1 to SEQ ID NOs. 6.

[0060] According to a third exemplary embodiment, a vector is provided comprising a polynucleotide encoding the FasL variant of the first embodiment and a FasL promoter.

[0061] In one embodiment, the vector is an expression vector for a FasL variant. In one embodiment, the vector is an expression vector. In one embodiment, the vector includes a plasmid expression vector such as a eukaryotic expression vector, a viral vector, or an mRNA molecule used as an expression vector. In one embodiment, the expression vector is an mRNA molecule used as an expression vector, such as an mRNA molecule containing a 5' cap analog, a 5' untranslated region, an open reading frame encoding a Fas ligand variant encoding protein, a 3' untranslated region, and a poly(A) tail. In one embodiment, the expression vector includes a polynucleotide encoding the FasL variant of the first embodiment. In one embodiment, any vector capable of transcribing and translating the FasL variant in a host cell may be used. Any viral vector may be used, such as a vector derived from an adenovirus, adeno-associated virus, retrovirus (e.g., lentivirus, rhabdovirus, mouse leukemia virus), or herpesvirus, which can accept the coding sequence of the FasL variant molecule to be expressed. The tropism of a viral vector can be modified by pseudotyping the vector with envelope proteins or other surface antigens derived from other viruses, or by appropriately substituting different viral capsid proteins. Such vectors are known to those skilled in the art. Therefore, in one embodiment, the vector is a pseudotyped viral vector. In one embodiment, the expression vector is a plasmid or any other vector containing a nucleic acid sequence encoding a FasL variant.

[0062] In one embodiment, the FasL promoter is a cleaved FasL promoter, preferably having the nucleotide sequence of SEQ ID NO: 13. In one embodiment, the vector contains a cleaved promoter compared to a wild-type FasL promoter.

[0063] In one embodiment, the vector contains a polynucleotide encoding one of the FasL variants from SEQ ID NO: 1 to SEQ ID NO: 6. In another embodiment, the vector contains one of the polynucleotides from SEQ ID NO: 7 to SEQ ID NO: 12.

[0064] In some embodiments, expression vectors encoding modified FasL may include a cleaved version of the FASLG gene promoter to enhance intracellular Fas ligand expression. The cleaved variant of the FASLG gene promoter (hfaslg) was selected according to data from Holtz-Heppelmann et al. (Holtz-Heppelmann et al., J Biol Chem. 1998 Feb 20;273(8):4416-23; Rivera et al., J Biol Chem. 1998 Aug 28;273(35):22382-8; McClure et al., J Biol Chem. 1999 Mar 19;274(12):7756-62; Bodor et al., Eur J Immunol. 2002 Jan;32(1):203-12). The activity of the cleaved promoter is higher than that of the native one, but lower than that of the widely used CMV promoter. Using such promoters makes it possible to achieve high levels of Fas ligand expression, resulting in less cytotoxicity compared to CMV.

[0065] In another exemplary embodiment, a method for obtaining recombinant cells is disclosed. This method includes introducing a vector containing a polynucleotide encoding a FasL variant into selected cells, thereby providing recombinant cells. In one embodiment, the method for obtaining recombinant cells includes extracting in vivo cells from a mammal such as a human, and preparing the cells by introducing a vector containing a polynucleotide encoding a FasL variant into selected cells in vitro. In one embodiment, recombinant cells expressing the FasL variant are cultured, proliferated, activated, and / or stimulated in vitro. In one embodiment, the method for obtaining recombinant cells includes culturing the recombinant cells under conditions that allow for the production of a FasL variant polypeptide.

[0066] In one embodiment, a method for obtaining recombinant cells includes culturing recombinant cells in vitro in the presence of total trans retinoic acid (ATRA). In some embodiments, the addition of ATRA during in vitro culture of recombinant cells results in suppression of FasL expression during in vitro cell production, thereby increasing the viability and yield of recombinant cells. In some embodiments, the addition of ATRA during in vitro culture of recombinant cells is configured to provide recombinant cells with increased cytotoxicity. In some embodiments, a method for obtaining recombinant cells includes the addition of at least 1 μM of ATRA during in vitro culture of recombinant cells, configured to increase cell viability and yield. In some embodiments, a method for obtaining recombinant cells includes the addition of at least 1 μM of ATRA during in vitro culture of recombinant cells for a period of at least 7 days, configured to increase cell viability and yield. Removal of ATRA after cell culture restores FasL expression levels and cytotoxic activity of the cells, thereby making the cells usable in vivo.

[0067] In one embodiment, a method for obtaining recombinant cells includes culturing recombinant cells in vitro in the presence of vitamin E or a derivative thereof. In some embodiments, the addition of vitamin E during in vitro culture of recombinant cells results in suppression of FasL expression during in vitro cell production, thereby increasing the viability and yield of recombinant cells. Removal of vitamin E after cell culture restores FasL expression levels and cytotoxic activity of the cells, thereby making the cells ready to be used in vivo.

[0068] In some embodiments, a method for obtaining recombinant cells includes adding at least 1 μM of ATRA during in vitro culture of recombinant cells, configured to increase the viability and yield of recombinant cells. In some embodiments, a method for obtaining recombinant cells includes adding at least 1 μM of ATRA for a period of at least 13 days during in vitro culture of recombinant cells, configured to increase the viability and yield of recombinant cells. In one embodiment, a method for obtaining recombinant cells includes culturing recombinant cells in the presence of ATRA and vitamin E.

[0069] In some embodiments, recombinant cells containing a genetic element capable of producing at least one FasL variant are used in in vitro applications, such as in vitro diagnostic applications, for example, as reference cells for cell viability or cytotoxicity.

[0070] According to some embodiments of the present invention, further positive effects can be achieved in obtaining modified cells by adding all-trans retinoic acid (ATRA) when culturing modified NK cells in vitro. ATRA downregulates FasL expression according to data from Yang et al. (Yang et al., J Exp Med. 1995 May 1; 181 (5): 1673-82; Bissonnette et al., Mol Cell Biol. 1995 Oct;15(10):5576-85; Cui et aL, Cell Immunol. 1996 Feb 1;167(2):276-84; Lee et aL, Eur J Biochem. 2002 Feb;269(4):1162-70).

[0071] According to some embodiments of the present invention, further positive effects can be achieved in obtaining modified cells by adding vitamin E and its derivatives when culturing modified NK cells in vitro. Vitamin E downregulates FasL expression according to data from Li-Weber et al. (J Clin Invest. 2002 Sep;110(5):681-90; Lee et al., Nutrients. 2018 Nov 1;10(11):1614).

[0072] According to one embodiment of the present invention, a composition involving the use of a cleavage promoter and the addition of ATRA during culture results in suppression of FasL expression during in vitro cell production. As a result, the viability of modified NK cells and the yield of the cell product at the end of the culture cycle are increased. After removing ATRA in the final stage of culture, the expression level of FasL and the cytotoxic activity of the cells are restored. Therefore, by using a cleavage promoter in combination with ATRA to express a modified FasL type, it becomes possible to obtain more NK cells with high cytotoxic activity during in vitro culture. In one embodiment, a method for obtaining recombinant cells is: A vector containing a cleaved FasL promoter, which includes a polynucleotide encoding a FasL variant, is introduced into selected host cells to obtain recombinant cells. Culture of recombinant cells in vitro in the presence of all-trans retinoic acid (ATRA), and To remove ATRA from cultured recombinant cells, thereby restoring the expression level of FasL variants and the cytotoxic activity of recombinant cells. Includes.

[0073] According to several embodiments of the present invention, compositions using a cleavage promoter and the addition of vitamin E or a derivative thereof during culture suppress FasL expression during in vitro cell production. As a result, the viability of modified NK cells and the yield of the cell product at the end of the culture cycle are increased. After removing vitamin E or a derivative thereof in the final stage of culture, the expression level of FasL and the cytotoxic activity of the cells are restored. Therefore, the combined expression of a modified FasL type by a cleavage promoter and vitamin E or a derivative thereof makes it possible to obtain a greater yield of NK cells with high cytotoxic activity during in vitro culture.

[0074] In one embodiment, a method for obtaining recombinant cells is: Introducing a vector containing a cleaved FasL promoter, which includes a polynucleotide encoding a FasL variant, into selected host cells. Culturing recombinant cells in vitro in the presence of vitamin E or its derivatives, and To remove vitamin E or its derivatives from cultured recombinant cells, thereby restoring the expression level of FasL variants and the cytotoxic activity of recombinant cells. Includes.

[0075] According to some embodiments of the present invention, an exemplary strategy for improving NK cells for immunotherapy, enhancing anti-cancer cytotoxicity, and improving NK cell viability by preferentially redistributing FasL transport to intracellular depots, particularly secretory lysosomes, is shown in Figure 12.

[0076] According to a fourth exemplary embodiment, a pharmaceutical composition is disclosed comprising recombinant cells containing a FasL variant and at least one further component selected from pharmaceutically acceptable excipients, carriers, and / or adjuvants. In one embodiment, the pharmaceutical composition comprises a pharmaceutically acceptable excipient. The excipient is an inert substance that functions as a vehicle or bulking agent in the pharmaceutical composition. In one embodiment, the pharmaceutically acceptable excipient is one or more selected from lubricants, preservatives, diluents, binders, coatings, colorants, wetting agents, dispersants, emulsifiers (e.g., methylcellulose), pH buffers, gelling or viscosity enhancing additives, preservatives, and flavorings. In one embodiment, the pharmaceutical composition comprises a carrier such as liposomes, nanoparticles, microspheres, and emulsions. The carrier is a substance used to deliver the pharmaceutical composition to a target site in the body. In one embodiment, the pharmaceutical composition comprises an adjuvant such as a chemokine, cytokine, other cells, or monoclonal antibody. An adjuvant is a substance added to a pharmaceutical composition to enhance the immune response to the pharmaceutical composition. In one embodiment, the pharmaceutical composition comprises an additional therapeutic agent, a pharmaceutically active compound, and / or the pharmaceutical composition. In one embodiment, the additional therapeutic agent is nivolumab (Opdivo®), pembrolizumab (Keytruda®), pizilizumab (CureTech), atezolizumab (Tecentriq®), avelumab (Bavencio®), semiprimab (Ributayo®), dostallimab (Jemperli), durvalumab (Imfinzi) TM ), ipilimumab (Yervoy®), and one or more PD1, PDL1, CTLA4, and LAG-3 inhibitors selected from among these.

[0077] According to a fifth exemplary embodiment, natural killer (NK) cells modified to express a Fas ligand variant are disclosed for use in the treatment of a disease in an individual, if necessary, such use comprising administering to an individual a therapeutically effective amount of NK cells modified to express a Fas ligand variant, configured to have increased cytotoxicity and viability compared to cells producing unmodified FasL, thereby treating the disease. In one embodiment, the use in the treatment of a disease is an immunotherapy use. In one embodiment, the use in the treatment of a disease is an oncology use. In one embodiment, in the treatment of a disease in an individual, NK cells modified to express a Fas ligand variant, if necessary, are administered to the individual a therapeutically effective amount of the pharmaceutical composition of the fourth embodiment.

[0078] In one embodiment, the therapeutically effective dose varies depending on the disease being treated and the individual, but generally, the therapeutically effective dose can be considered to be the amount that produces a therapeutic effect. In this context, the therapeutic effect can range from alleviation of disease symptoms to complete cure of the condition. In one embodiment, the individual is a mammal, preferably a human. In one embodiment, NK cells modified to express a Fas ligand variant are configured to express one or more Fas ligand variants. In one embodiment, NK cells modified to express a Fas ligand variant are configured to express one or more of FasLmod1 to FasLmod6. In one embodiment, NK cells modified to express a Fas ligand variant are configured to express a heterogeneous population of multiple FasL variants. In one embodiment, NK cells modified to express a Fas ligand variant are configured to express only a single FasL variant.

[0079] In one embodiment, the use of the FasL variant or recombinant cells or pharmaceutical composition relating to this disclosure in the treatment of an individual's disease state, as needed, is disclosed. In one embodiment, the use of the FasL variant or recombinant cells or pharmaceutical composition relating to this disclosure in a therapeutic procedure within an individual's body is disclosed.

[0080] In one embodiment, NK cells modified to express a Fas ligand variant for use in treating a disease are autologous or allogeneic to the individual. In one embodiment, the disease is cancer. In one embodiment, the disease is a pathogen infection such as a viral, bacterial, or fungal infection.

[0081] In one embodiment, NK cells modified to express a Fas ligand variant for use in treating a disease state are derived from umbilical cord blood, peripheral blood, bone marrow, cells infiltrating tissue, CD34-positive cells, iPSCs (induced pluripotent stem cells), ESCs (embryonic stem cells), or human NK cell lines.

[0082] In one embodiment, NK cells modified to express a Fas ligand variant for use in the treatment of a disease are cultured, proliferated, activated, or stimulated in vitro before administration to an individual.

[0083] In one embodiment, NK cells modified to express a Fas ligand variant for use in treating a disease are cultured, proliferated, activated, or stimulated with varying concentrations of total trans retinoic acid (ATRA), vitamin E, or its derivatives before administration to an individual.

[0084] In one embodiment, the recombinant cells are natural killer (NK) cells modified to express a Fas ligand variant for use in treating the disease state of an individual, and the embodiment includes administering a therapeutically effective amount of natural killer (NK) cells modified to express a Fas ligand variant to an individual, in which case, The FasL variant comprises an amino acid sequence selected from SEQ ID NOs: 1 to SEQ ID NOs: 6, and the modified form encompassed by the FasL variant treats the pathological condition by promoting the transport of recombinant cells to secretory lysosomes and increasing their cytotoxicity and viability compared to cells producing unmodified FasL. In one embodiment, a method for treating a patient's pathological condition is disclosed, comprising administering recombinant cells to the patient. In one embodiment, a method for increasing the viability of recombinant cells in a therapeutic regime is disclosed, comprising administering the recombinant cells of this disclosure to a patient. In one embodiment, a method for treating any type of cancer, including hematological malignancies or solid tumors, in an individual, comprising administering to the individual a therapeutically effective amount of natural killer (NK) cells modified to express a Fas ligand variant, wherein the FasL variant treats the pathological condition of cancer by containing amino acid substitutions that promote their transport to secretory lysosomes and increase their cytotoxicity and viability compared to cells producing unmodified FasL.

[0085] In one embodiment, a method for treating any type of cancer comprises, for an individual, NK cells being of autologous origin or allogeneic.

[0086] In one embodiment, a method for treating any type of cancer comprises NK cells derived from umbilical cord blood, peripheral blood, bone marrow, tissue-infiltrating cells, CD34-positive cells, iPSCs, ESCs, or human NK cell lines.

[0087] In one embodiment, a method for treating any type of cancer comprises NK cells containing a Fas ligand having selected amino acid substitutions in its intracellular domain, which preferentially redistributes the transport of FasL to an intracellular depot, where the mutein of FasL is encoded by an amino acid sequence selected from SEQ ID NOs. 1 to SEQ ID NOs. 6.

[0088] In one embodiment, a method for treating any type of cancer comprises the cleavage-type FasL promoter sequence being sequence number 13.

[0089] In one embodiment, a method for treating any type of cancer comprises culturing, growing, activating or stimulating NK cells expressing FasL mutein before administration to an individual.

[0090] In one embodiment, a method for treating any type of cancer comprises culturing, growing, activating or stimulating NK cells expressing FasL mutein under the control of a cleavage-type FasL promoter before administration to an individual.

[0091] In one embodiment, a method for treating any type of cancer comprises culturing, growing, activating or stimulating NK cells expressing FasL mutein with varying concentrations of total trans retinoic acid (ATRA) before administration to an individual.

[0092] In one embodiment, a method for treating any type of cancer comprises culturing, growing, activating or stimulating NK cells expressing FasL mutein with varying concentrations of vitamin E or its derivatives before administration to an individual. Unless otherwise stated, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which the invention pertains. The materials, methods and examples described herein are illustrative and not necessarily intended to limit the scope of the invention.

[0093] The above describes different, non-limiting, exemplary embodiments and models of the present invention. The embodiments described above are used solely to illustrate selected embodiments or steps that may be utilized in carrying out the present invention. Some embodiments may be presented only in relation to specific exemplary embodiments of the present invention. It should be understood that corresponding embodiments may also be applicable to other exemplary embodiments.

[0094] [Sequence List] SEQ ID NO: 1: Amino acid sequence of FasL variant FasLmod1 containing amino acid substitutions N6G, P8G, P10L, and D16L Sequence ID 2: Amino acid sequence of FasL variant FasLmod2 containing amino acid substitutions N6G, P8G, P10I, and D16I Sequence ID 3: Amino acid sequence of FasL variant FasLmod3 containing amino acid substitutions N6G, P8G, P10V, and D16V SEQ ID NO: 4: Amino acid sequence of FasL variant FasLmod4 containing amino acid substitutions N6G, P8G, P10L, D16L, P67G, L68Y SEQ ID NO: 5: Amino acid sequence of FasL variant FasLmod5 containing amino acid substitutions N6G, P8G, P10I, D16I, P67G, L68Y, L71I Sequence ID 6: Amino acid sequence of FasL variant FasLmod6 containing amino acid substitutions N6G, P8G, P10V, D16V, P67G, L68Y, L71V Sequence ID 7: Nucleotide sequence encoding the FasL variant FasLmod1 Sequence ID 8: Nucleotide sequence encoding the FasL variant FasLmod2 Sequence ID 9: Nucleotide sequence encoding the FasL variant FasLmod3 Sequence ID 10: Nucleotide sequence encoding the FasL variant FasLmod4 Sequence ID 11: Nucleotide sequence encoding FasL variant FasLmod5 Sequence ID 12: Nucleotide sequence encoding the FasL variant FasLmod6 Sequence ID 13: Oligonucleotide sequence encoding a cleavage-type FasL promoter sequence SEQ ID NO: 14: Forward primer oligonucleotide sequence for encoding the cleaved FasL gene promoter sequence of SEQ ID NO: 13 Sequence ID 15: Reverse primer oligonucleotide sequence for encoding the cleaved FasL gene promoter sequence of Sequence ID 13 Sequence ID 16: Oligonucleotide sequence F1GL Sequence ID 17: Oligonucleotide sequence F1GI Sequence ID 18: Oligonucleotide sequence F1GV Sequence ID 19: Oligonucleotide sequence F2L Sequence ID 20: Oligonucleotide sequence F2I Sequence ID 21: Oligonucleotide sequence F2V Sequence ID 22: Oligonucleotide sequence F3 Sequence ID 23: Oligonucleotide sequence F4 Sequence ID 24: Oligonucleotide sequence F5 Sequence ID 25: Oligonucleotide sequence F6 Sequence ID 26: Oligonucleotide sequence F6GYL Sequence ID 27: Oligonucleotide sequence F6GYI Sequence ID 28: Oligonucleotide sequence F6GYV Sequence ID 29: Oligonucleotide sequence R1 Sequence ID 30: Oligonucleotide sequence R2 Sequence ID 31: Oligonucleotide sequence R2GYL Sequence ID 32: Oligonucleotide sequence R2GYI Sequence ID 33: Oligonucleotide sequence R2GYV Sequence ID 34: Oligonucleotide sequence R3 Sequence ID 35: Oligonucleotide sequence R4 Sequence ID 36: Oligonucleotide sequence R5 Sequence ID 37: Oligonucleotide sequence R6GL Sequence ID 38: Oligonucleotide sequence R6GI Sequence ID 39: Oligonucleotide sequence R6GV Sequence ID 40: Oligonucleotide sequence LNKF1 Sequence ID 41: Oligonucleotide sequence LNKR1 Sequence ID 42: Oligonucleotide sequence LNKF3 Sequence ID 43: Oligonucleotide sequence FaslR_Xho Sequence ID 44: Oligonucleotide sequence FaslP_Mlu Sequence ID 45: Oligonucleotide sequence ExF Sequence ID 46: Oligonucleotide sequence ExR Sequence ID No. 47: Amino acid sequence of wild-type human Fas ligand [Brief explanation of the drawing]

[0095] Several embodiments of the present invention are described with reference to the accompanying drawings below.

[0096] [Figure 1] This figure shows a map of the plasmid vector pFasLmod, indicating the insertion points of specific constructs into the plasmid according to several embodiments. Human faslg promoter (233-685 bp), FasLmod1-6 (686-1531 bp), BGH pA (1575-1799 bp), f1 ori (1845-2273 bp), SV40 initial promoter (2278-2647 bp), neomycin resistance gene Neo(R) (2683-3477 bp), SV40pA (3651-3781 bp), pUC origin (4164-4834 bp), ampicillin resistance gene Amp(R) (4979-5839 bp) (complementary strand), bla promoter (5840-5938 bp) (complementary strand). The FasLmod positions within the pFasLmod vector indicate the positions where FasL variants (FasLmod1-6) can be inserted. [Figure 2]These are micrographs showing the cytotoxicity of NK cells modified with various constructs (vectors) according to several embodiments against target cells HEK293 (human embryonic kidney cells). NK cells, NK-FasLmod1, NK-FasLmod2, NK-FasLmod3, NK-FasLmod4, NK-FasLmod5, and NK-FasLmod6 were incubated with HEK293 target cells in a 3:1 (effector:target) ratio for 5 hours and then photographed. [Figure 3] These are micrographs showing the cytotoxicity of NK cells modified with various constructs according to several embodiments against target cells HeLa (human cervical adenocarcinoma cells). NK cells, NK-FasLmod1, NK-FasLmod2, NK-FasLmod3, NK-FasLmod4, NK-FasLmod5, and NK-FasLmod6 were incubated with HeLa target cells in a 3:1 (effector:target) ratio for 5 hours and then photographed. [Figure 4] These are micrographs showing the cytotoxicity of NK cells modified with various constructs according to several embodiments against target cells A172 (human glioblastoma cells). NK cells, NK-FasLmod1, NK-FasLmod2, NK-FasLmod3, NK-FasLmod4, NK-FasLmod5, and NK-FasLmod6 were incubated with A172 target cells in a 3:1 (effector:target) ratio for 5 hours and then photographed. [Figure 5] This shows the percentage of surviving HeLa target cells after 5 hours of incubation of NK92, NK92-FasLmod1, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cells in a 2:1 or 5:1 (effector:target) ratio. [Figure 6] This shows the percentage of surviving HEK293 target cells after NK92, NK92-FasLmod1, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cells were incubated for 5 hours in a 2:1 or 5:1 (effector:target) ratio. [Figure 7] This shows the percentage of surviving A172 target cells after NK92, NK92-FasLmod1, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cells were incubated for 5 hours in a 2:1 or 5:1 (effector:target) ratio. [Figure 8] The growth dynamics of NK92, NK92-FasLmod1, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cell cultures are shown. [Figure 9A] This shows Fas ligand expression in NK92 cells into which a vector encoding FasLmod1 has been introduced under transcriptional regulation by a natural faslg promoter (1), a cleaved faslg promoter (2), or a cytomegalovirus promoter (3). [Figure 9B] The proliferation rates of NK92-FasLmodl cells using the natural faslg promoter (1), the truncated faslg promoter (2), or the cytomegalovirus promoter (3) are shown. M is a marker. [Figure 10A] The images show Fas ligand expression in NK92 cells (1), NK92-FasLmod1 cells with a cleaved faslg promoter in the presence of ATRA (2), and NK92-FasLmod1 cells with a cleaved faslg promoter after ATRA removal (3). [Figure 10B] This shows the proliferation rate of NK92-FasLmod1 cells with a truncated faslg promoter, regardless of the presence or absence of ATRA. NK92 cells were used as a control. [Figure 10C] This study shows the viability of HeLa target cells after incubation of NK92-FasLmod1 cells with a cleaved faslg promoter and ATRA in a 2:1 or 5:1 ratio (effector:target) for 5 hours. NK92 cells were used as a control. [Figure 11A]The images show Fas ligand expression in NK92 cells (1), NK92-FasLmod1 cells with a cleaved faslg promoter in the presence of vitamin E (2), and NK92-FasLmod1 cells with a cleaved faslg promoter after vitamin E removal (3). [Figure 11B] This study shows the proliferation rates of NK92-FasLmod1 cells with a cleaved faslg promoter and cells with and without vitamin E (vitE). NK92 cells were used as a control group. [Figure 11C] This study shows the viability of HeLa target cells after incubation for 5 hours with NK92-FasLmod1 cells containing a cleaved faslg promoter and vitamin E in a 2:1 or 5:1 (effector:target) ratio. NK92 cells were used as a control group. [Figure 12] This paper presents exemplary strategies for improving recombinant cells, such as recombinant NK cells for immunotherapy, by preferentially redistributing FasL variant transport to intracellular storage, including secretory lysosomes, thereby enhancing the anti-cancer cytotoxicity of recombinant cells and improving NK cell survival. Figure 12A shows the distribution of unmodified FasL(F) inside and on the cell membrane of NK cells. When NK cells make intercellular contact with cancer tissue (C), only a small amount of extracellular vesicles containing unmodified FasL(F) are released from secretory lysosomes, indicating that the cytotoxic effect of NK cells on cancer tissue is very localized. Figure 12B shows the distribution of modified FasL(F), i.e., FasL variants, inside and on the cell membrane of recombinant NK cells. Compared to unmodified FasL(F), FasL variant(F) is more abundantly distributed in secretory lysosomes (than on the cell membrane). Therefore, variant (F) released by secretory lysosomes of recombinant cells upon intercellular contact with cancer tissue (C) can reach and act on cancer (C) tissue that is not in immediate vicinity of the recombinant cells or is not in direct intercellular contact with the recombinant cells. [Modes for carrying out the invention]

[0097] In the following description, similar reference symbols indicate similar elements or steps.

[0098] definition Unless otherwise stated, all technical and scientific terms used herein have meanings generally understood by those skilled in the art. General definitions of many of the terms used in the subject matter disclosed in this invention are provided to those skilled in the art by the following literature: *Dictionary of Microbiology and Molecular Biology* (2nd Edition, Singleton, P. & Sainsbury, D. 1988), *Concise Dictionary of Biomedicine and Molecular Biology* (2nd Edition, 2001, Pei-Show Juo), *Oxford Dictionary of Biochemistry and Molecular Biology* (2nd Edition, Eds. Richard Cammack et al., 2006), and *The Dictionary of Cell and Molecular Biology* (5th Edition, 2012, Ed. John Lackie).

[0099] All publications referenced herein are expressly incorporated herein by reference for the purpose of disclosing and describing the manner and / or material by which they are cited.

[0100] The term "immunotherapy" refers to the treatment of disease by methods including induction, enhancement, suppression, or other modification of the immune response. Examples of immunotherapy include, but are not limited to, NK cell therapy. It should be understood that the methods disclosed herein enhance the effectiveness of any NK cell therapy.

[0101] The terms “NK cell” or “natural killer (NK) cell” refer to a subset of peripheral blood lymphocytes defined by the expression of CD56 or CD16 and the absence of the T cell receptor (CD3). In some embodiments, NK cells are derived from umbilical cord blood, peripheral blood, bone marrow, CD34-positive cells, iPSCs, ESCs, or NK cells infiltrating tissue. In some respects, NK cells are human NK cell lines such as NKL (CVCL_0466), YTS (CVCL_JD324), NK3.3 (CVCL_7994), NK-92 (CVCL_2142), KHYG-1 (CVCL_2976), haNK (CVCL_JM23), and laNK (CVCL_VN54). In one embodiment, NK cells are modified NK cells modified to express the Fas ligand variant of this disclosure.

[0102] The terms “Fas ligand,” “FasL,” “CD95L,” or “CD178,” as used herein, refer to type II transmembrane proteins belonging to the tumor necrosis factor (TNF) superfamily that induce apoptosis in cells harboring the death receptor Fas / CD95, or induce apoptosis via a reverse signaling pathway. Wild-type FasL includes an extracellular domain, a transmembrane domain, and an intracellular domain.

[0103] As used herein, the term "variant" means a sequence or sequence fragment (of nucleotides or amino acids) that is inserted, substituted, deleted, or chemically modified by one or more nucleotides / amino acids, and which is different from the corresponding unmodified parent molecule.

[0104] The terms “FasL variant,” “FasL mutein,” “modified FasL,” or “modified form of FasL” mean any FasL molecule obtained by site-directed mutagenesis, insertion, substitution, deletion, recombination, and / or any other protein engineering technique, which results in a FasL variant with an amino acid sequence different from that of the parent FasL. Here, parent FasL is either wild-type FasL or the FasL variant itself. The terms “wild-type FasL,” “wild type,” or “wt” mean, according to this disclosure, FasL or a fragment thereof having a naturally occurring amino acid sequence. The gene encoding this variant may be synthesized, or the parent gene may be modified by genetic techniques, such as site-directed mutagenesis, which is a technique for introducing one or more mutations at one or more defined sites within the polynucleotide encoding the parent polypeptide.

[0105] The term "FasL variant" may be referred to using the name given to the variant, for example, FasLmod1-6, or any one of sequence numbers 1 through 6.

[0106] As used herein, the “intracellular domain” of a FasL variant refers to the amino acids of the FasL variant corresponding to amino acids 1-80 of wild-type FasL in SEQ ID NO: 47, and constitutes the intracellular domain of wt FasL. For example, the intracellular domains of FasL variants according to SEQ ID NOs: 1-6 contain amino acids 1-80 of SEQ ID NOs: 1-6, respectively.

[0107] As used herein, the term “polypeptide” refers to an amino acid sequence comprising a number of sequentially polymerized amino acid residues. For the purposes of this disclosure, a polypeptide may contain more than 20 amino acid residues. A polypeptide may include modified amino acid residues, naturally occurring amino acid residues not encoded by codons, and amino acid residues not naturally occurring. As used herein, “protein” may refer to a peptide or polypeptide of any size. A protein may be a receptor protein, a transmembrane protein, a membrane protein, a peptide hormone, an enzyme, an antibody, a regulatory factor, or any other protein.

[0108] As used herein, "sequence identity" refers to the percentage of perfectly matching amino acid residues between two optimally aligned sequences, relative to the number of positions where amino acid residues exist in both sequences. If one sequence has residues that do not correspond to the other sequence, the alignment program allows for gaps in the alignment, and these positions are not counted in the denominator of the identity calculation. As used herein, "sequence alignment" of amino acid sequences refers to VectorNTI using default settings. TM AlignX from (Invitrogen Corp., Carlsbad, CA) TM This means aligning arrays using a module.

[0109] As used herein, the terms “corresponding positions” or “corresponding amino acid position” mean aligning at least two amino acid sequences as a pairwise alignment or multiple sequence alignment according to identified regions of similarity or identity, thereby pairing corresponding amino acids. Examples of corresponding amino acid positions are provided in SEQ ID NOs: 1–6. Amino acids 1–281 present in each of these sequences are corresponding amino acids. For example, at amino acid position 10, amino acid L(L) of SEQ ID NO: 1 10 ) and amino acid I of sequence number 2 (I 10 ) is the corresponding amino acid.

[0110] As used herein, superscript numbers used in the context of amino acid sequences refer to the amino acid position of the first amino acid following that number, or the last amino acid located before that number. For example, 6 GYGYL 10 This notation means that the first amino acid G is at position 6 (G 6 ) is located at position 10 (L 10 This refers to the amino acid sequence located at ).

[0111] As used herein, the term “activated natural killer (NK) cells” means activated NK cells that exhibit enhanced cytotoxic activity, cytokine production (such as interferon-gamma), and / or proliferation in response to activation, such as contact with target cells. The term “cytotoxicity” refers to the ability to kill viable cells, and in particular describes the properties of recombinant cells, such as NK cell activity that kills target cells. The degree of cell death may be expressed as the percentage of target cell death above the background, with total target cell death set at 100%.

[0112] The term "cell survival" refers to the period of time during which a cell can survive and maintain the integrity of its cellular processes. Survival mechanisms enable cells to continue cellular activities such as metabolism, growth, replication, certain responsiveness, and adaptability.

[0113] The term “secretory lysosomes” refers to lysosome-associated effector vesicles (LREVs) that function as common storage sites for cytotoxic effector proteins and are released only within immune synapses formed between effector cells and target cells. As used herein, the term “secretory lysosomes” includes all membrane-bound vesicles smaller in diameter than the cell from which they originate. In this invention, the term “secretory lysosomes” includes any selected group consisting of exosomes, ectosomes and microvesicles, and any other vesicles. As used herein, the term “intracellular depot” means any cellular structure or compartment within a cell in which a particular molecule or substance is stored, including any intracellular secretory lysosomes.

[0114] The term "genetic modification" refers to methods of altering a cell's genome, including, but not limited to, removing coding regions or non-coding regions or parts thereof, or inserting coding regions or parts thereof. Constructs or sequences may include regulatory or regulated sequences, such as start, stop, promoter, signaling, secretion, or other sequences used by the cell's genetic mechanisms. In some embodiments, the target of genetic modification is a cell. In some embodiments, the cell to be modified is an NK cell, which may be obtained from a patient or donor. This cell may be modified to express an exogenous construct, such as FasL, which is inserted into the cell's genome. In some embodiments, the exogenous construct is a FasL variant, which is inserted into the cell's genome. In some embodiments, the target of genetic modification is FasL.

[0115] As used herein, the term "amino acid substitution" means the substitution of an amino acid residue with an amino acid residue different from the original amino acid at a given position. The term "amino acid substitution" can refer to both conservative and non-conservative amino acid substitutions, meaning that an amino acid residue is substituted with an amino acid residue having a side chain similar to (conservative) that of the original amino acid residue at that position, or with an amino acid residue having a different side chain (non-conservative).

[0116] As used herein, “recombinant cell” means any cell type that has been genetically engineered through transformation, transfection, transduction, or similar means with a nucleic acid construct or expression vector containing polynucleotides. The term “recombinant cell” encompasses any offspring that are not identical due to mutations occurring during replication. The terms mutant cell, modified cell, manipulated cell, or host cell may also be used, but these may be used interchangeably with the term “recombinant cell.” Recombinant cells as referred herein refer to recombinant cells that contain genetic elements that enable them to produce at least one FasL variant.

[0117] The term "promoter" refers to a portion of a gene containing a DNA sequence that enables RNA polymerase binding and transcription initiation. Promoter sequences are typically, though not always, found in the 5' non-coding regions of genes.

[0118] As used herein, the term "domain" may be used interchangeably with the terms "region" or "site."

[0119] As used herein, the term “trafficking domain” refers to the sequence YXXφ or GYXXφ of the intracellular domain of FasL, where X is any amino acid and φ is a hydrophobic amino acid selected from leucine, isoleucine, or valine (L;I;V).

[0120] The following abbreviations are used for amino acids: alanine (A), cysteine ​​(C), aspartic acid (D), glutamic acid (E), phenylalanine (F), glycine (G), histidine (H), isoleucine (I), lysine (K), leucine (L), methionine (M), asparagine (N), proline (P), glutamine (Q), arginine (R), serine (S), threonine (T), valine (V), tryptophan (W), and tyrosine (Y).

[0121] As used herein, the term "comprising" includes the relatively broad meanings of "including," "containing," and "comprehending," as well as the relatively narrower meanings of "consisting of" and "consisting only of."

[0122] As used herein, the amino acid symbol "φ" refers to an amino acid as defined in the corresponding context, and the symbol "B" may also be used for that amino acid. Therefore, wherever the symbol "φ" is used for at least one amino acid, the symbol "B" may be used instead of "φ".

[0123] Various aspects of the disclosure of this invention are described in more detail in the following subsections.

[0124] NK cell immunotherapy Immunotherapy, particularly CAR-modified cell therapy, holds great potential due to its high cytotoxicity and specificity, and CAR-T cell immunotherapy is a well-studied and fairly widely used major form of immunotherapy. However, the use of CAR-modified T cells has numerous limitations. The production of personalized CAR-T products is time-consuming and expensive. A drawback of this approach is the need to use autologous cells to prevent the induction of a graft-versus-host response in the patient. CAR-T cells can also cause significant toxic effects due to cytokine release syndrome. In addition, the outcomes of CAR-T cell therapy for solid tumors are not optimal. These shortcomings of CAR-T cells have led to great interest in NK cell therapy. NK cells are cytotoxic lymphocytes of the innate immune system characterized by their ability to spontaneously detect and kill infected or malignant cells, and are also involved in regulating the adaptive immune response by producing numerous cytokines and chemokines. NK cells use activating receptors to recognize germline-encoding ligands that are upregulated on cancer cells without requiring tumor neoantigen presentation by MHC molecules, as T cells do. Activated NK cells can destroy tumor cells by a) releasing cytoplasmic granules containing perforin and granzymes, b) expressing and secreting TNF family proteins such as FasL and TRAIL that induce tumor cell apoptosis, and c) antibody-dependent cytotoxicity mediated by the Fc receptor CD16. Overexpression of Fas ligand on the plasma membrane (within lipid rafts) can lead to the death of the cells that produce it (AICD). The retention of Fas ligand intracellularly, particularly within secretory lysosomes, is both a defense mechanism and a crucial factor in the cytotoxic activity of NK cells. The ability of NK cells to control AICD is essential for NK cell therapy for cancer. Therefore, in some embodiments of the present invention, a method is provided to solve this problem by creating a gene construct that confers both higher NK recombinant cell viability and increased cytotoxicity of natural killer cells in order to promote NK killing of target cells. The gene construct is designed to redistribute Fas ligand transport toward intracellular depots rather than the plasma membrane.

[0125] FAS ligand intracellular domain As described above, NK cells can recognize and destroy tumor and infected cells by FasL, which induces apoptosis in target cells. Fas ligands (FasL, CD95L, or CD178) are type II transmembrane proteins belonging to the tumor necrosis factor (TNF) family that induce apoptosis via the death receptor Fas / CD95 or through reverse signaling pathways. FasL contains an extracellular domain, a transmembrane domain, and an intracellular domain. The extracellular portion is involved in the recognition of the corresponding receptors, Fas antigen and DcR3, as well as the self-assembly of the ligand (Orlinick et al., J Biol Chem. 1997 Dec 19;272(51):32221-9). The transmembrane domain of FasL is involved in the "fixation" and / or migration of this molecule within / on the plasma membrane. The intracellular portion of FasL is required for sorting to secretory lysosomes, translocation of the ligand to rafts, which are "signaling platforms" on the plasma membrane, and FasL-dependent reverse signaling. The 45-65 amino acid polyproline region (PRD) is required for interactions with many enzymes and adapter proteins, as well as for targeted ligand transport. Ubiquitination sites at lysine residues at positions 72 and 73, and phosphorylation of tyrosine residues (amino acids 7, 9, and 13) play a role in the intracellular distribution of ligands (Zuccato et al., J Cell Sci. 2007 Jan 1;120(Pt 1):191-9). The target signal that directs the FasL protein to the lysosomal compartment contains the amino acid sequence YXXφ, where X is any amino acid and φ is a hydrophobic amino acid (leucine, isoleucine, or valine (L;I;V)). Chimeric proteins containing this amino acid motif are efficiently directed to this lysosomal compartment (Wu et al., Proc Natl Acad Sci US A. 1995 Dec 5;92(25):11671-5). As described herein, the ability of NK cells to reduce AICD is of significant importance to NK cell therapy.In one embodiment, the redistribution of FasL from the cell surface to the lysosomal compartment can reduce AICD in activated NK cells. Therefore, in one embodiment, the intracellular domain of the Fas ligand variant includes a YXXφ site (9YPQI 12) involved in its transport to secretory lysosomes. In some embodiments, a glycine residue preceding tyrosine facilitates the transport of the FasL variant protein to the lysosomal compartment.

[0126] In one embodiment, the presence of several consecutively arranged "trafficking domains" (GYXXφ) facilitates the targeting of the protein to the lysosomal compartment. In some embodiments, modified forms of the Fas ligand include amino acid substitutions that result in several consecutively repeated GYXXφ sites, thereby facilitating transport to secretory lysosomes.

[0127] In certain embodiments, the Fas ligand variant comprises the amino acid sequence described in SEQ ID NO: 1. An exemplary nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 1 is described in SEQ ID NO: 7.

[0128] In certain embodiments, the Fas ligand variant includes the amino acid sequence described in SEQ ID NO: 2. An exemplary nucleic acid sequence encoding the amino acids of SEQ ID NO: 2 is described in SEQ ID NO: 8.

[0129] In certain embodiments, the Fas ligand variant includes the amino acid sequence described in SEQ ID NO: 3. An exemplary nucleic acid sequence encoding the amino acids of SEQ ID NO: 3 is described in SEQ ID NO: 9.

[0130] In certain embodiments, the Fas ligand variant comprises the amino acid sequence described in SEQ ID NO: 4. An exemplary nucleic acid sequence encoding the amino acids of SEQ ID NO: 4 is described in SEQ ID NO: 10.

[0131] In certain embodiments, the Fas ligand variant includes the amino acid sequence described in SEQ ID NO: 5. An exemplary nucleic acid sequence encoding the amino acids of SEQ ID NO: 5 is described in SEQ ID NO: 11.

[0132] In certain embodiments, the Fas ligand variant includes the amino acid sequence described in SEQ ID NO: 6. An exemplary nucleic acid sequence encoding the amino acids of SEQ ID NO: 6 is described in SEQ ID NO: 12.

[0133] Due to the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any particular protein. For example, the codons CTT, CTC, CTA, CTG, TTA, and TTG all encode the amino acid leucine. Therefore, at any position where leucine is identified by a codon, that codon can be changed to any of the corresponding codons without altering the encoded polypeptide. Such variations of nucleic acids are called "silent variations," and they are a type of conserved modification variation. Every nucleic acid sequence encoding a polypeptide described herein also describes all possible silent variations of that nucleic acid. Those skilled in the art will recognize that each codon in a nucleic acid (with the exception of AUG, which is usually the sole codon for methionine, and TGG, which is usually the sole codon for tryptophan) can be modified to produce a functionally identical molecule. Thus, each silent variation of a polypeptide-encoding nucleic acid is implicitly included in each sequence described. In some embodiments, the substituted amino acids (leucine, isoleucine, or valine (L;I;V)) in the modified forms of Fas ligand, FasLmod1-6, are encoded by codons optimized for the use of human codons for expression in human cells. Unless otherwise specified, specific nucleic acid sequences of modified forms of Fas ligand implicitly include their conserved modified variants (e.g., degenerate codon substitutions).

[0134] Since increased FasL expression can lead to cell death in the cells that produce it, a truncated hfaslg promoter may be included in expression vectors encoding a modified form of FasL to enhance the viability of modified NK cells. The sequence of the truncated vector was selected based on data from Holtz-Heppelmann et al., which showed that deletion of the -2365 to -452 region of the FASLG gene promoter resulted in a several-fold increase in the gene in Jurkat T cell lines. The activity of the truncated (cleaved) promoter is higher than that of the native promoter but lower than that of the commonly used viral CMV promoter. Using such a cleaved promoter makes it possible to achieve high levels of Fas ligand expression. At the same time, as shown in Figure 9B, the cleaved promoter has less cytotoxicity to cells than CMV, thereby enhancing the viability of recombinant cells. Therefore, in some embodiments, a cleaved version of the hfaslg promoter may be included in expression vectors encoding a modified form of FasL to enhance intracellular Fas ligand expression.

[0135] The sequence of the truncated version of the FasL gene promoter (hfaslg promoter) is described in Sequence ID No. 13.

[0136] Adding total trans retinoic acid (ATRA) during in vitro culture of modified NK cells may achieve further positive effects on the viability of the modified cells. ATRA is known to suppress FasL expression and, consequently, the death of activated thymocytes and T cells (Iwata et al., J Immunol. 1992 Nov 15;149(10):3302-8; Szondy et al., J Infect Dis. 1998 Nov; 178(5): 1288-98). One of the mechanisms of action of ATRA is based on the inhibition of NFAT (nuclear factor of activated T cells) protein activity (Lee et al., Eur J Biochem. 2002 Feb;269(4):1162-70). NFAT is one of the major effectors that trigger FasL transcription by interacting with the GGAAA sequence located at -276 relative to the transcription start site. Therefore, in some embodiments of the present invention, further positive effects can be achieved in obtaining modified recombinant cells by adding total trans retinoic acid (ATRA) when culturing recombinant cells, such as modified NK cells, in vitro. NK cells can be cultured in the presence of ATRA before the recombinant cells are added to target cells. In some embodiments of the present invention, compositions combining the use of a cleavage promoter with the addition of ATRA during culture result in the suppression of FasL expression during cell production in vitro. As a result, the viability of modified NK cells and the yield of cell products at the end of the culture cycle are increased. After removing ATRA in the final stage of culture, the expression level of FasL and the cytotoxic activity of the cells are restored. Therefore, using a cleavage promoter in combination with ATRA to express modified FasL morphology makes it possible to obtain a greater yield of NK cells with high cytotoxic activity during in vitro culture.

[0137] Vitamin E, a natural free radical scavenger, suppresses the activity of transcription factors NF-κB and AP-1, thereby inhibiting CD95L expression and preventing AICD in immune cells. Vitamin E administration suppresses CD95L mRNA expression and protects immune cells from CD95-mediated apoptosis. Therefore, in some embodiments, adding vitamin E and its derivatives when culturing modified NK cells in vitro can achieve further positive effects in obtaining modified cells. In some embodiments of the present invention, compositions involving the use of a cleavage promoter and the addition of vitamin E or its derivatives during culture result in suppression of FasL expression during cell production in vitro. As a result, the viability of modified NK cells and the yield of the cell product at the end of the culture cycle are increased. After removing vitamin E or its derivatives in the final stage of culture, the FasL expression level and the cytotoxic activity of the cells are restored. Therefore, using a cleavage promoter for the expression of modified FasL morphology in combination with vitamin E or its derivatives allows for a greater yield of NK cells with high cytotoxic activity during in vitro culture.

[0138] Compositions and Uses In some embodiments, the pharmaceutical compositions containing NK cells disclosed herein include pharmaceutically acceptable carriers, diluents, emulsifiers, preservatives, and / or adjuvants. In some embodiments, the compositions include excipients. Suitable carriers and their formulations are described, for example, in Remington: The Science and Practice of Pharmacy (23rd Edition, Adejare A., Ed., Academic Press, 2020). The pharmaceutical compositions should not contain agents that may inactivate or kill NK cells. In some embodiments, the pharmaceutical compositions include physiological solutions, preferably phosphate-buffered saline or sterile physiological solutions or tissue culture media.

[0139] The present invention provides a method for treating pathological conditions such as hematological malignancies in a subject. In certain embodiments, the method involves administering to a subject an effective amount of a pharmaceutical composition or recombinant cells, such as NK cells containing a modified Fas ligand variant that increases their cytotoxicity and viability.

[0140] The present invention provides a method for treating solid tumors in a subject. In a particular embodiment of the present invention, the method involves administering to a subject an effective amount of NK cells, which are NK cells whose cytotoxicity and viability are increased by containing a modified variant of Fas ligand.

[0141] The methods disclosed herein may be used to treat cancer in a subject, to reduce tumor size, to kill tumor cells, to prevent tumor growth, to prevent tumor recurrence, to prevent tumor metastasis, to induce remission in a patient, or any combination thereof. In some embodiments, the methods induce a complete response. In other embodiments, the methods produce a partial response.

[0142] The present invention provides a method for preventing and / or treating pathogenic infections in a subject. In certain embodiments of the present invention, the method comprises administering to a subject an effective amount of NK cells, wherein the NK cells are enhanced in their cytotoxicity and viability by containing a modified variant of Fas ligand. In some embodiments, the pathogen is selected from the group consisting of viruses, bacteria, fungi, parasites, and protozoa capable of causing disease.

[0143] Various additional therapeutic agents may be used in combination with the compositions described herein. For example, potentially useful additional therapeutic agents include PD1, PDL1, CTLA4, and LAG-3 inhibitors (e.g., nivolumab (OPDIVO®), pembrolizumab (KEYTRUDA®), pizilizumab (CureTech), atezolizumab (Tecentriq®), avelumab (Bavencio®), semiprimab (Libtayo®), dostallimab (Jemperli), and durvalumab (Imfinzi)). TM Examples include, but are not limited to, ipilimumab (Yervoy®) and relatrimab (BMS).

[0144] Those skilled in the art can easily determine the amounts of cells and any additives and / or carriers in a composition, as well as the amount administered. For any composition administered to animals or humans, toxicity, dosage form of the composition, concentration of components therein, and administration time of the composition that induces a suitable response can be determined by determining the lethal dose (LD) and LD50 in a suitable animal model.

[0145] The following examples are provided to those skilled in the art to provide a complete disclosure and description of how the cells and compositions of this disclosure are prepared and used, and are not intended to limit the scope of what the inventors consider to be the present invention. [Examples]

[0146] [Example 1] - Construction of an expression vector encoding a modified Fas ligand The physical map of the 5975bp expression vector shown in Figure 1 consists of the hfaslg promoter (233-685bp), FasLmod1-6 (686-1531bp, shown as FasLmod in Figure 1), BGH pA (1575-1799bp), f1 ori (1845-2273bp), SV40 initial promoter (2278-2647bp), Neo(R) (2683-3477bp), SV40 pA (3651-3781 bp), pUC origin (4164-4834bp), Amp(R) (4979-5839 bp) (complementary strand), and bla promoter (5840-5938bp) (complementary strand).

[0147] Fragments representing the truncated FASLG gene promoter (hfaslg promoter) were synthesized by polymerase chain reaction using primers hfaslgprom_f and hfaslgprom_r, respectively, corresponding to sequence numbers 14 and 15. The primer sequences for the polymerase chain reaction were designed using OLIGO 4.0 software. hfaslgprom_f ttatagccccactgaccattctcctgtagctg hfaslgprom_r ctgcatggcagctggtgagtcaggc

[0148] Chromosomal DNA from peripheral blood mononuclear cells was used as the matrix. Thermo Fisher Scientific Pfu DNA polymerase was used for synthesis according to the manufacturer's instructions. The PCR reaction was performed in an Eppendorf thermal cycler. 10 ng of DNA was used as a template in a 25 μL reaction volume containing 20 mM Tris-HCl (25°C, pH 8.8), 10 mM (NH4)2SO4, 10 mM KCI, 0.1 mg / mL BSA, 0.1% (v / v) Triton X-100, 2 mM MgSO4, 0.2 mM dNTPs (Thermo Scientific, USA), 0.4 μM primers, and 1.25 U of PFU DNA polymerase (Thermo Scientific, USA). The amplification protocol was as follows: initial denaturation at 95°C for 2 minutes, followed by 30 cycles of 30 seconds at 95°C, 30 seconds at 59°C, and 1 minute at 72°C, and a final extension at 72°C for 10 minutes. The size of each amplified product was resolved by electrophoresis on a 1.2% agarose gel (w / v) prepared in TAE buffer (40 mM Tris, pH 8.3, 20 mM acetic acid, 1 mM EDTA) containing 0.4 μg / ml ethidium bromide. A 6X DNA loading dye containing 10 mM Tris-HCl (pH 7.6), 0.03% bromophenol blue, 0.03% xylene cyanol FF, 60% glycerol, and 60 mM EDTA was used to load the samples.

[0149] The fragments encoding the 1-258 bp sequence of the modified Fas ligand were synthesized by polymerase chain reaction using overlapping oligonucleotides, based on the method described by Stemmer et al. (Gene. 1995 Oct 16;164(1):49-53).

[0150] The following oligonucleotide mixtures: F1GL, F2L, F3, F4, F5, F6, R1, R2, R3, R4, R5, and R6GL were used in the synthesis of FasLmodl.

[0151] The following oligonucleotide mixtures: F1GI, F2I, F3, F4, F5, F6, R1, R2, R3, R4, R5, and R6GI were used in the synthesis of FasLmod2.

[0152] The following oligonucleotide mixtures: F1GV, F2V, F3, F4, F5, F6, R1, R2, R3, R4, R5, and R6GV were used in the synthesis of FasLmod3.

[0153] The following oligonucleotide mixtures—F1GL, F2L, F3, F4, F5, F6GYL, R1, R2GYL, R3, R4, R5, and R6GL—were used in the synthesis of FasLmod4.

[0154] The following oligonucleotide mixtures—F1GI, F2I, F3, F4, F5, F6GYI, R1, R2GYI, R3, R4, R5, and R6GI—were used in the synthesis of FasLmod5.

[0155] The following oligonucleotide mixtures: F1GV, F2V, F3, F4, F5, F6GYV, R1, R2GYV, R3, R4, R5, and R6GV were used in the synthesis of FasLmod6.

[0156] The PGR reaction was performed using an Eppendorf thermal cycler. Equal volumes of oligonucleotides were mixed to obtain a final concentration of 100 μM oligonucleotide mixture. 0.5 μl of the oligonucleotide mixture was used as a template for a total reaction volume of 25 μl containing Tris-HCl (25°C, pH 8.8) 20 mM, (NH4)2SO4 10 mM, KCl 10 mM, BSA 0.1 mg / mL, 0.1% (v / v) Triton X-100, MgSO4 2 mM, dNTPs (Thermo Scientific, USA) 0.2 mM, primer 0.4 μM, and 1.25 U PFU DNA polymerase (Thermo Scientific, USA). The PGR reaction was performed as follows: initial denaturation at 95°C for 2 minutes, followed by 55 cycles of 30 seconds at 95°C, 30 seconds at 52°C, and 30 minutes at 72°C, with a final extension at 72°C for 5 minutes. Thermo Fisher Scientific Pfu DNA polymerase was used for synthesis according to the manufacturer's instructions. The size of each amplification product was resolved by electrophoresis on a 1.2% agarose gel (w / v) prepared in TAE buffer (Tris 40 mM, pH 8.3, Acetate 20 mM, EDTA 1 mM) containing 0.4 μg / ml ethidium bromide. A 6X DNA loading dye containing 10 mM Tris-HCl (pH 7.6), 0.03% bromophenol blue, 0.03% xylene cyanol FF, 60% glycerol, and 60 mM EDTA was used to load the samples.

[0157] In the next step, the synthesized fragments were amplified using LNKF1 and LNKR1 primers, which are sequence numbers 40 and 41, respectively.

[0158] Eight μl of the synthesized fragment mix was used as a template in a 25 μl reaction volume containing 20 mM Tris-HCl (pH 8.8 at 25°C), 10 mM (NH4)2SO4, 10 mM KCl, 0.1 mg / mL BSA, 0.1% (v / v) Triton X-100, 2 mM MgSO4, 0.2 mM dNTPs (Thermo Scientific, USA), 0.4 μM primer, and 1.25 U of PFU DNA polymerase (Thermo Scientific, USA). The PCR reaction was performed as follows: initial denaturation at 95°C for 2 minutes, followed by 25 cycles of 30 seconds at 95°C, 30 seconds at 59°C, and 30 minutes at 72°C, with a final extension of 5 minutes at 72°C. Pfu DNA polymerase from Thermo Fisher Scientific was used for synthesis according to the manufacturer's instructions. The size of each amplification product was resolved by electrophoresis using 0.4 μg / ml ethidium bromide in a 1.2% agarose gel (w / v) prepared in TAE buffer (Tris 40 mM, pH 8.3, 20 mM acetate, 1 mM EDTA). A 6X DNA loading dye containing Tris-HCl (pH 7.6) 10 mM, 0.03% bromophenol blue, 0.03% xylene cyanol FF, 60% glycerol, and 60 mM EDTA was used to load the samples.

[0159] The fragment encoding the Fas ligand sequence (231–846 bp) was synthesized by polymerase chain reaction using primers LNKF3 and FaslR_Xho (sequence IDs 42 and 43, respectively).

[0160] The plasmid vector pcDNA4 / TO-FasL, previously described by Glukhova et al. (2018, (17)), was used as the matrix. 5 ng of plasmid DNA was used as a template in a 25 μl reaction volume containing Tris-HCl (25°C, pH 8.8) 20 mM, (NH4)2SO4 10 mM, KCl 10 mM, BSA 0.1 mg / mL, 0.1% (v / v) Triton X-100, MgSO4 2 mM, dNTPs (Thermo Scientific, USA) 0.2 mM, primer 0.4 μM, and 1.25 U of PFU DNA polymerase (Thermo Scientific, USA). The PCR reaction was performed as follows: initial denaturation at 95°C for 2 minutes, followed by 30 cycles of 30 seconds at 95°C, 30 seconds at 59°C, and 80 seconds at 72°C, with a final extension of 10 minutes at 72°C. Pfu DNA polymerase from Thermo Fisher Scientific was used for synthesis according to the manufacturer's instructions. The size of each amplification product was resolved by electrophoresis using 0.4 μg / ml ethidium bromide in a 1.2% agarose gel (w / v) prepared in TAE buffer (Tris 40 mM, pH 8.3, 20 mM acetate, 1 mM EDTA). A 6X DNA loading die containing Tris-HCl 10 mM (pH 7.6), 0.03% bromophenol blue, 0.03% xylene cyanol FF, 60% glycerol, and 60 mM EDTA was used to load the samples.

[0161] The FaslP_Mlu (SEQ ID NO: 44) and FaslR_Xho (SEQ ID NO: 43) primers were used to synthesize DNA fragments encoding the FasLmod1 (SEQ ID NO: 1) to FasLmod6 (SEQ ID NO: 6) sequences and the cleaved hfaslg promoter.

[0162] A mixture of DNA fragments representing the cleavage type of the hfaslg promoter, fragments encoding sequence numbers 1-258 of FasLmod1-FasLmod6, and fragments encoding sequence numbers 231-846 of Fas ligand was used as the matrix. One ng of fragments encoding sequence numbers 1-258 of FasLmod1-FasLmod6 and two ng of fragments encoding sequence numbers 231-846 of Fas ligand were used as templates in a 25 μl reaction volume containing Tris-HCl 20 mM (pH 8.8, 25°C), (NH4)2SO4 10 mM, KCl 10 mM, BSA 0.1 mg / mL, 0.1% (v / v) Triton X-100, MgSO4 2 mM, dNTPs 0.2 mM (Thermo Scientific, USA), 0.4 μM primer, and 1.25 U of Pfu DNA polymerase (Thermo Scientific, USA). The PCR reaction was performed as follows: initial denaturation at 95°C for 2 minutes, followed by 30 cycles of 30 seconds at 95°C, 30 seconds at 59°C, and 105 seconds at 72°C, and a final extension at 72°C for 10 minutes. Thermo Fisher Scientific Pfu DNA polymerase was used for synthesis according to the manufacturer's instructions. The size of each amplification product was separated by electrophoresis using 0.4 μg / ml ethidium bromide in a 1.2% agarose gel (w / v) prepared in TAE buffer (Tris 40 mM, pH 8.3, 20 mM acetate, 1 mM EDTA). A 6X DNA loading dye containing Tris-HCl (pH 7.6) 10 mM, 0.03% bromophenol blue, 0.03% xylene cyanol FF, 60% glycerol, and 60 mM EDTA was used for sample loading.

[0163] Fragments encoding the sequences of modified Fas ligands containing the hfaslg promoter were cloned into pcDNA3.1(+) vectors (Invitrogen) at Mlul and Xhol restriction sites. The DNA sequences of selected plasmid vectors pFasLmod1, pFasLmod2, pFasLmod3, pFasLmod4, pFasLmod5, and pFasLmod6 were confirmed by DNA sequencing.

[0164] Modified NK cells were obtained by introducing plasmid vectors pFasLmod1, pFasLmod2, pFasLmod3, pFasLmod4, pFasLmod5, and pFasLmod6 into cells using Lipofectamine2000 or Lipofectamine3000 transfection (Thermo Fisher Scientific) or electroporation using a Gene Pulser Xcell instrument (Bio-Rad), following the manufacturer's instructions.

[0165] [Example 2] - Morphological changes of target cells during interaction with NK cells Human NK cells were isolated from peripheral blood mononuclear cell samples derived from healthy donors using an NK cell isolation kit (Miltenyi Biotec). The NK cells were transfected with pFasLmod1, pFasLmod2, pFasLmod3, pFasLmod4, pFasLmod5, and pFasLmod6 vectors by electroporation using a Gene Pulser Xcell System (Bio-Rad) according to the manufacturer's instructions. Three days after electroporation, the cells were purified using a dead cell removal kit (Miltenyi Biotec) and then incubated for 6 hours in DMEM medium (containing 500 iu / ml IL-2 and 10% FBS) with target cells HEK293 (transformed human fetal kidney cells) (Figure 2), HeLa (human cervical adenocarcinoma) (Figure 3), or A172 (human glioma) (Figure 4) in a 1:3 ratio (target:effector). The cells were observed under a phase-contrast optical system equipped with a 10x objective lens.

[0166] The data in Figures 2–4 show typical morphological changes induced in sensitive tumor target cells during interaction with NK cells. All strains of target cells tested experienced morphological changes associated with cell death. Dying tumor target cells became rounded, contracted, and showed plasma membrane bleb formation and the presence of apoptotic bodies (Ziegler, Groscurth. News Physiol Sci. 2004 Jun; 19:124-8). Simultaneously, NK cells became fully rounded and formed multicellular clusters surrounding and enveloping the target cells. These allogeneic NK-NK interactions that form multicellular clusters are known to be important for optimal cytolytic activation of NK cells, IFN-γ secretion, and tumor cell elimination in vivo (Lee et al., Blood. 2006 Apr 15;107(8):3181-8; Kim et al., Sci Rep. 2017 Jan 11; 7:40623).

[0167] All NK cells tested induced HEK293 cell death. However, all modified NK cells were more destructive to target cells compared to control NK cells. Notably, there was a higher number of viable NK-FasLmod cells compared to mock NK cells. The most significant changes in the morphology of HEK293 cells were observed when target cells collided with NK-FasLmod2 cells.

[0168] All NK cells tested induced HeLa cell death (Figure 3). However, all modified NK cells were more destructive to target cells compared to control NK cells. Also noteworthy was the higher number of surviving NK-FasLmod cells compared to unmodified NK cells. The most significant changes in HeLa cell morphology were observed when target cells encountered NK-FasLmod2 or NK-FasLmod4 cells.

[0169] All NK cells tested induced A172 cell death (Figure 4). However, all modified NK cells were more harmful to target cells compared to control NK cells. Also noteworthy was the higher number of viable NK-FasLmod cells compared to mock NK cells. The most significant changes in the morphology of A172 cells were observed when target cells interacted with NK-FasLmod2, NK-FasLmod3, or NK-FasLmod5 cells.

[0170] In summary, these data demonstrate that, according to several embodiments disclosed herein, NK cells expressing FasL mutein can be activated and successfully generate enhanced cytotoxic effects against tumor target cells.

[0171] [Example 3] - Evaluation of cytotoxic activity of NK92 and NK92-FasLmod1, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cells against HeLa target cells (human cervical adenocarcinoma). To evaluate the potency of modified NK92 cells, cytotoxic assays were performed using NK cell-sensitive cell lines HEK293, HeLa, and A172 cells. NK92 cells were transfected with pFasLmod1, pFasLmod2, pFasLmod3, pFasLmod4, pFasLmod5, and pFasLmod6 vectors by electroporation using a Gene Pulser Xcell System (Bio-Rad) according to the manufacturer's instructions. Following electroporation, cells were incubated in αMEM selective medium supplemented with 2 mM glutamine, sodium bicarbonate (1.5 g / L), 0.2 mM inositol, 0.1 mM 2-mercaptoethanol, 0.02 mM folic acid, 400 U / ml recombinant interleukin-2, 25% fetal bovine serum, and 50 μg / ml G418. Target cells (HEK293 cells, HeLa cells, or A172 cells) were seeded into the wells of a 96-well plate. The following day, regulatory NK92 cells and modified cells (NK92-FasLmodl, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6) were added to the wells of the 96-well plate along with the previously seeded target cells and incubated at 37°C and 5% CO2 in a 2:1 or 5:1 ratio (effector:target) for 5 hours. The wells were then washed with buffered saline, and the number of viable target cells was estimated by staining with neutral red dye (Wallach J Immunol. 1984 May;132(5):2464-9). Figures 5-7 show the percentage of cytotoxicity of different NK92 cell lines against target cells (all experiments were performed in triplicate).

[0172] As shown in Figure 5, NK92 cells expressing FasL mutein exhibited significantly higher cytotoxicity against HeLa cells compared to mock NK92 cells. Even at a low E:T ratio of 2:1, 60%, 57%, 62%, 45%, 50%, and 52% of HeLa cells were killed by NK92-FasLmod1, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cells, respectively. The cytotoxicity of mock NK-92 at this ratio was 35%. At an E:T ratio of 5:1, the cytotoxic effect of NK92-FasL mutein was even more pronounced. NK92-FasLmod1, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cells killed 85%, 83%, 82%, 78%, 80%, and 75% of HeLa cells, respectively. NK92-FasLmod1, NK92-FasLmod2, and NK92-FasLmod3 cells showed the highest potential for killing HeLa cells compared to other modified NK92 cells.

[0173] Figure 6 shows the mortality rate of HEK293 cells when NK92 cells expressing FasL mutein were co-cultured with HEK293 cells in ratios of 2:1 and 5:1, demonstrating a significant increase in killing rate compared to mock NK92 cells. At an E:T ratio of 2:1, 92%, 93%, 94%, 81%, 87%, and 86% of HEK293 cells were killed by NK92-FasLmod1, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cells, respectively. At an E:T ratio of 5:1, NK92-FasLmod1, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cells killed 97%, 94%, 97%, 88%, 91%, and 89% of HEK293 cells, respectively. Similar to HeLa cells, NK92-FasLmod1, NK92-FasLmod2, and NK92-FasLmod3 cells showed the highest cytotoxicity against HEK293 compared to other modified NK92 cells.

[0174] Figure 7 shows the cytotoxicity of mock NK92, NK92-FasLmod1, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cells against A172 cells. As with other tumor cells, modified NK92 cells expressing FasL mutein showed higher killing activity against A172 cells than mock NK92 cells. At an E:T ratio of 2:1, 39%, 40%, 39%, 35%, 31%, and 35% of A172 cells were killed by NK92-FasLmod1, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cells, respectively. The cytotoxicity of mock NK-92 against A172 cells at this ratio was 18%. At an E:T ratio of 5:1, 65%, 68%, 68%, 68%, 67%, and 60% of A172 cells were killed by NK92-FasLmod1, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cells, respectively. The cytotoxicity of mock NK-92 against A172 cells at this ratio was 48%. It should be noted that the cytotoxic activity of various modified TL92 cells against A172 cells was nearly equivalent and not as different as against other tumor target cells (HeLa cells and HEK293 cells) described above.

[0175] Notably, these data show that modified NK cells exhibit high cytotoxic activity even at a modest E:T ratio (2:1). This suggests that the desired cytotoxic effect of modified FasL-mutein-expressing NK cells can be achieved even when NK cells are present in moderate numbers relative to target cells, which is likely to be applicable in clinical settings. Furthermore, these data demonstrate that the modified NK cells disclosed herein have significantly increased cytotoxicity compared to unmodified NK cells.

[0176] [Example 4] - Comparative evaluation of proliferation rates of NK92 and NK92-FasLmod1, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cell cultures. Cell proliferation rates were assessed at different time points (63) by trypan blue staining and light microscopy quantification of live cells. NK92 cells, NK92-FasLmod1, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5 and NK92-FasLmod6 were seeded in αMEM medium containing 2 mM glutamine, sodium bicarbonate (1.5 g / L), 0.2 mM inositol, 0.1 mM 2-mercaptoethanol, 0.02 mM folic acid, 400 U / ml recombinant interleukin 2, and 25% fetal bovine serum (0.5 x 10⁻¹). 6 Cells ( / mL) were incubated at 37°C and 5% CO2 for 14 days. Samples for analysis were collected on days 7, 11, and 14. All experiments were performed in triplicate, and data are expressed as the mean of the three samples with standard deviation. The results of the growth activity assessment are shown in Figure 8.

[0177] In all groups, cell proliferation steadily increased until day 14. However, as early as day 11, the fold change in NK92 cells transfected with wild-type FasL was significantly lower than that of regulatory NK92 cells and NK92 cells transfected with FasL mutein. By day 14, the differences between regulatory NK92, NK92-FasLmod1, NK92-FasLmod2, NK92-FasLmod3, NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cells were 2.5, 1.6, 1.4, 1.5, 1.9, 2.0, and 2.1 times, respectively. The catalytic changes in NK92-FasLmod1, NK92-FasLmod2, and NK92-FasLmod3 cells were slightly lower than those in NK92-FasLmod4, NK92-FasLmod5, or NK92-FasLmod6 cells. The differences in viability and cytotoxicity levels between NK92-FasLmod1, NK92-FasLmod2, and NK92-FasLmod3 cells and NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cells are clearly determined by the presence of additional "trafficking domains" in the intracellular portions of NK92-FasLmod4, NK92-FasLmod5, and NK92-FasLmod6 cells. Thus, according to some embodiments disclosed herein, these data indicate that, in contrast to wild-type FasL, overexpression of FasL mutein promotes the survival of transfected cells and enhances their cytotoxic activity.

[0178] [Example 5] - Effects of cleavage promoter, ATRA, and vitamin E on Fas ligand expression levels and survival in modified NK92 cells NK92 cells were transfected with plasmid vectors encoding the recombinant FasLmod1 gene, possessing either a native faslg promoter, a truncated faslg promoter, or a cytomegalovirus promoter. Following selection in a medium containing G418, the expression levels of the recombinant gene were evaluated by polymerase chain reaction (RT-PCR) with reverse transcriptase using primers ExF (SEQ ID NO: 45) and ExR (SEQ ID NO: 46).

[0179] Following the manufacturer's recommendations, a two-step RT-PCR reaction was performed using RevertAid M-MuLV reverse transcriptase (Thermo Scientific, USA) and Taq DNA polymerase (Thermo Scientific, USA). 5 μg of RNA was mixed with 0.5 ng of oligo-dT12-18mer and incubated in water at 65°C for 5 minutes, followed by incubation on ice. First strand synthesis was carried out at 42°C for 60 minutes in a buffer containing 50 mM Tris-HCl (pH 8.3 at 25°C), 50 mM KCl, 4 mM MgCl2, 10 mM DTT, 1 mM dNTPs, and 10 U / μl of RevertAid M-MuLV reverse transcriptase. The reaction was stopped by heating at 70°C for 10 minutes. One-fifth of the reaction mixture was used as a template in a 25 μl reaction volume containing 10 mM Tris-HCl (pH 8.8 at 25°C), 50 mM KCl, 0.08% (v / v) nonidet P40, 2 mM MgCl2, 0.2 mM dNTP (Thermo Scientific, USA), 0.2 μM primer, and 0.6 U Taq DNA polymerase (Thermo Scientific, USA). The amplification protocol was as follows: initial denaturation at 95°C for 10 minutes, followed by 30 cycles of 30 seconds at 95°C, 30 seconds at 59°C, and 30 seconds at 72°C, and final extension at 72°C for 10 minutes. The size of each amplification product was resolved by electrophoresis on a 1.2% agarose gel (w / v) prepared in TAE buffer (40 mM Tris, pH 8.3, 20 mM acetic acid, 1 mM EDTA) containing 0.4 μg / ml ethidium bromide. A 6X DNA loading dye containing 10 mM Tris-HCl (pH 7.6), 0.03% bromophenol blue, 0.03% xylene cyanol FF, 60% glycerol, and 60 mM EDTA was used to load the DNA marker and sample. A GeneRuler 100 bp DNA Ladder (Thermo Scientific, USA) was used as the molecular weight standard. The results are shown in Figure 9A. The activity of the cleavage promoter was higher than that of the native promoter but lower than that of the commonly used CMV promoter.These data indicate that, according to some embodiments disclosed herein, the use of this truncated promoter enables the achievement of a considerably higher level of Fas ligand expression compared to the native one.

[0180] Cell growth rate was evaluated by trypan blue staining and optical microscopy quantification of live cells at different time points (Strober. Curr Protoc Immunol. 2015 Nov 2; 111 : A3.B.1 - A3.B.3). Transfected cells were seeded in αMEM medium containing 2 mM L - glutamine, 1.5 g / L sodium bicarbonate, 0.2 mM inositol, 0.1 mM 2 - mercaptoethanol, 0.02 mM folic acid, 400 IU / mL recombinant interleukin 2, and 25% fetal bovine serum (0.5x10 6 cells / mL) and incubated at 37 °C, 5% CO2 for 15 days. Samples for analysis were taken on day 7, day 11, and day 15. All experiments were performed in triplicate, and the data are presented as the mean of three samples with standard deviation. The results of this growth activity evaluation are shown in Figure 9B. Expression of Fas ligand under the control of the truncated hfaslg promoter ensures greater survival of NK92 cells than under the action of the CMV promoter. According to some embodiments disclosed herein, a truncated version of the hfaslg promoter can be incorporated into an expression vector encoding a modified form of FasL to enhance Fas ligand expression in cells and maintain cell viability.

[0181] The effect of ATRA on the expression level of Fas ligand and the survival of modified NK92 cells was evaluated as follows. NK92 - FasLmod1 having the truncated faslg promoter was incubated for 72 hours in the presence or absence of 1 μM ATRA. RNA was isolated from the cells, and the expression level of FasL was evaluated by polymerase chain reaction (PCR) with reverse transcriptase reaction (RT - PCR) using primers ExF (SEQ ID NO: 45) and ExR (SEQ ID NO: 46) as described above. The results are shown in Figure 10A.

[0182] Cell proliferation rates were evaluated by trypan blue staining and optical microscopy quantification of live cells at different time points (63). Control NK92 cells and NK92-FasLmod1 cells with a truncated faslg promoter were seeded in αMEM medium containing 2 mM L-glutamine, 1.5 g / L sodium bicarbonate, 0.2 mM inositol, 0.1 mM 2-mercaptoethanol, 0.02 mM folic acid, 400 U / ml recombinant interleukin 2, 25% fetal bovine serum (0.5x10 6 cells / mL) and incubated for 72 hours in the presence or absence of 1 μM or 0.1 μM ATRA. Thereafter, the cells were incubated for 13 days. Samples for analysis were taken on days 7 and 13. All experiments were performed in triplicate, and the data are presented as the mean of three samples with standard deviation. The evaluation of the fold change in cell number is shown in Figure 10B.

[0183] To evaluate the effect of ATRA on the cytotoxic activity of control NK92 cells and NK92-FasLmod1 cells with a truncated faslg promoter, a cytotoxicity assay was performed using HeLa cells as targets. Modified cells were incubated for 13 days in medium containing 1 μM ATRA, then switched to ATRA-free medium and cultured for an additional 48 hours. Next, the cells were added to wells of a 96-well plate with previously seeded target HeLa cells at a ratio of 2:1 or 5:1 (effector:target) and incubated at 37 °C and 5% CO2 for 5 hours. Thereafter, the wells were washed with buffered saline and the number of viable target cells was estimated by staining with neutral red dye. Data summarizing the percent cytotoxicity of NK92 cells and NK92-FasLmod1 cells pre-incubated with ATRA are shown in Figure 10C.

[0184] These data demonstrate that, according to several embodiments of the present invention disclosed herein, the use of a cleavage promoter during culture and the addition of ATRA result in suppression of FasL expression during in vitro cell culture. As a result, the viability of the modified NK cells and the yield of the cell product at the end of the culture cycle are increased. After the removal of ATRA in the final stage of culture, the expression level of FasL and the cytotoxic activity of the cells are restored. Therefore, the use of a cleavage promoter in combination with ATRA for the expression of a modified FasL type makes it possible to obtain NK cells with increased viability and higher yields of NK cells with higher cytotoxic activity.

[0185] The effects of vitamin E on Fas ligand expression levels and the viability of modified NK92 cells were evaluated as follows: NK92-FasLmod1 cells with a cleaved faslg promoter were incubated for 4 hours in or without 40 μM vitamin E. RNA was isolated from the cells, and FasL expression levels were evaluated by polymerase chain reaction (RT-PCR) coupled with reverse transcriptase using primers ExF (SEQ ID NO: 45) and ExR (SEQ ID NO: 46), as described above. The results are shown in Figure 11A.

[0186] Cell proliferation rates were assessed by trypan blue staining and light microscopy quantification of viable cells at different time points. Control NK92 cells and NK92-FasLmod1 cells with a cleaved faslg promoter were seeded in αMEM medium containing 2 mM L-glutamine, sodium bicarbonate (1.5 g / L), 0.2 mM inositol, 0.1 mM 2-mercaptoethanol, 0.02 mM folic acid, 400 U / ml recombinant interleukin 2, and 25% fetal calf serum (0.5 × 10⁻¹). 6 Cells (cells / mL) were incubated for 13 days in or without 25 μM vitamin E. Samples for analysis were collected on days 7 and 13. All experiments were performed in triplicate, and data are expressed as the mean of the three samples with standard deviation. The evaluation of this fold change in cell count is shown in Figure 11B.

[0187] To evaluate the effect of vitamin E on the cytotoxic activity of regulatory NK92 cells and NK92-FasLmod1 cells with a cleaved faslg promoter, cytotoxicity assays were performed using HeLa cells as targets. Modified cells were incubated in medium containing 40 μM vitamin E for 4 hours, then replaced with vitamin E-free medium and cultured for 24 hours. The cells were then added to wells of a 96-well plate containing previously seeded target HeLa cells in a 2:1 or 5:1 ratio (effector:target) and incubated at 37°C and 5% CO2 for 5 hours. The wells were then washed with buffered saline, and the number of viable target cells was estimated using neutral red staining (62). Summarized percentage cytotoxicity data for NK92 and NK92-FasLmod1 cells pre-incubated with vitamin E are shown in Figure 11C.

[0188] These data demonstrate that, according to several embodiments of the invention disclosed herein, the use of a cleavage promoter and the addition of ATRA during culture result in suppression of FasL expression during in vitro cell culture. As a result, the viability of modified NK cells and the yield of the cell product at the end of the culture cycle are increased. After ATRA is removed in the final stage of culture, FasL expression levels and the cytotoxic activity of the cells are restored. Therefore, using a cleavage promoter in combination with ATRA for the expression of modified FasL forms allows for a greater yield of NK cells with increased viability and high cytotoxic activity.

[0189] According to several embodiments, further positive effects on obtaining transformed cells can be achieved by adding vitamin E and its derivatives when culturing transformed NK cells in vitro. In some embodiments of the present invention, compositions involving the use of a cleavage promoter and the addition of vitamin E during culture result in the suppression of FasL expression during cell production in vitro. As a result, the viability of transformed NK cells and the yield of cell products at the end of the culture cycle are increased. After removing vitamin E in the final stage of culture, the expression level of FasL and the cytotoxic activity of the cells are restored. Therefore, using a cleavage promoter in combination with vitamin E for the expression of modified FasL forms makes it possible to obtain a greater yield of NK cells with increased viability and high cytotoxic activity.

[0190] Accordingly, this disclosure provides Fas ligand variants, recombinant cells such as recombinant NK cells, pharmaceutical compositions, vectors providing genetic material for FasL variant production in recombinant cells, methods for producing the same, and FasL variants for use in the treatment of immune-related diseases.

[0191] Sequence listing reference This application includes a sequence listing submitted as an electronic ST26XML file, which is incorporated herein by reference in its entirety.

Claims

1. A Fas ligand (FasL) variant having an intracellular domain comprising at least one amino acid sequence GYXXφ, wherein (X) is any amino acid, (φ) is an amino acid selected from amino acids L, I, or V, and the amino acid position of the amino acid sequence corresponds to the amino acid position of SEQ ID NO:

1.

2. The intracellular domain is an amino acid sequence 6 GYGYφQIYWVZ 16 The FasL variant according to claim 1, comprising (φ) and (Z) both independently selected from amino acids L, I, or V, and the amino acid positions of the amino acid sequence correspond to the amino acid positions of SEQ ID NO:

1.

3. where the intracellular domain is an amino acid 6 GYGYLQIYWVL 16 or 6 GYGYIQIYWV I 16 or 6 GYGYVQIYWVV 16 or 6 GYGYLQIYWVL 16 and 67 GYPPL 71 or 6 GYGYIQIYWV I 16 and 67 GYPP I 71 or 6 GYGYVQIYWVV 16 and 67 GYPPV 71 and the amino acid positions corresponding to the amino acid positions of SEQ ID NO: 1, the FasL variant according to claim 1 or 2.

4. A FasL variant according to any one of claims 1 to 3, comprising an amino acid sequence selected from any one of SEQ ID NOs: 1 to 6.

5. The FasL variant according to any one of claims 1 to 4, wherein the FasL variant comprises at least one amino acid substitution compared to wild-type FasL, and the amino acid substitution is configured to promote the transport of the FasL variant to secretory lysosomes when expressed in a cell.

6. Recombinant cells comprising a gene element that enables the production of at least one FasL variant according to any one of claims 1 to 5.

7. The recombinant cell according to claim 6, wherein the recombinant cell is a human natural killer (NK) cell.

8. A vector comprising a polynucleotide encoding a FasL variant according to any one of claims 1 to 5 and a FasL promoter.

9. The vector according to claim 8, wherein the FasL promoter is a cleavage-type FasL promoter, preferably having the nucleotide sequence of SEQ ID NO:

13.

10. A pharmaceutical composition comprising recombinant cells according to claim 6 or 7, comprising a FasL variant according to any one of claims 1 to 5, and at least one further component selected from pharmaceutically acceptable excipients, carriers, and / or adjuvants.

11. Natural killer (NK) cells modified to express the Fas ligand variant according to any one of claims 1 to 5, for use in immunotherapy in individuals requiring immunotherapy, The modification comprises administering to the individual a therapeutically effective amount of NK cells modified to express the Fas ligand variant, The aforementioned NK cells are natural killer (NK) cells configured to treat disease by having enhanced cytotoxicity and viability compared to unmodified FasL-producing cells.

12. NK cells modified to express the Fas ligand variant according to any one of claims 1 to 5 for use according to claim 11, wherein the NK cells are autologous or allogeneic to the individual.

13. NK cells modified to express the Fas ligand variant according to any one of claims 1 to 5 for use according to claim 11 or 12, wherein the NK cells are derived from umbilical cord blood, peripheral blood, bone marrow, cells infiltrating tissue, CD34-positive cells, iPSCs (induced pluripotent stem cells), ESCs (embryonic stem cells), or human NK cell lines.

14. NK cells modified to express the Fas ligand variant according to any one of claims 1 to 5, for use according to any one of claims 11 to 13, wherein the NK cells expressing the FasL variant are cultured, proliferated, activated or stimulated prior to administration to an organism.

15. NK cells modified to express a Fas ligand variant according to any one of claims 1 to 5 for use according to claim 14, wherein the NK cells expressing the FasL variant are cultured, grown, activated or stimulated with varying concentrations of all-trans retinoic acid (ATRA) or vitamin E or its derivatives prior to administration to an organism.