Method for breeding high-disease-resistance Tibetan sheep with assistance of molecular marker and application of high-disease-resistance Tibetan sheep
By detecting SNP molecular markers on specific chromosomes in Tibetan sheep and assessing the content of immune cytokines, the problems of lag and accuracy of traditional breeding methods have been solved, enabling early and accurate screening of Tibetan sheep with high disease resistance.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-28
- Publication Date
- 2026-03-27
AI Technical Summary
Traditional disease resistance breeding methods in Tibetan sheep suffer from lag and poor accuracy, and existing technologies lack SNP molecular markers related to key immune cytokines.
A SNP molecular marker is provided, located at 47,395,962 bases on chromosome 10 of the International Sheep Reference Genome Oar_v4.0, with a variant type of A/G. The levels of IL-1α, IL-6, TNF-β, TNF-α, IL-1Ra, and IL-10 in Tibetan sheep are assessed by detecting their genotypes. PCR amplification and sequencing analysis are performed using primers.
This approach enables early and accurate screening of Tibetan sheep with high disease resistance, improving breeding efficiency and accuracy, and providing new SNP molecular marker resources for assisted selection.
Smart Images

Figure CN121737313A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of Tibetan sheep assisted breeding technology, and particularly relates to a method for selecting Tibetan sheep with high disease resistance using molecular markers and its application. Background Technology
[0002] Tibetan sheep, a unique livestock resource of the Qinghai-Tibet Plateau, have long adapted to the extreme environment of high altitude, low oxygen, and strong radiation, developing unique genetic characteristics. They are not only an important means of production and livelihood for herders in the plateau region, but also a resource pool containing valuable stress-resistant genes. The disease resistance of Tibetan sheep is directly related to breeding efficiency, animal welfare, and public health safety. Therefore, breeding new breeds or strains of Tibetan sheep with high disease resistance is of great significance for ensuring the healthy and sustainable development of plateau animal husbandry.
[0003] Traditional disease resistance breeding relies primarily on phenotypic selection, which involves screening sheep by observing their disease incidence records, mortality rates, or responses to vaccination. However, this method suffers from significant time lag, is time-consuming, and has poor accuracy.
[0004] With the development of molecular biology, marker-assisted selection has brought revolutionary progress to livestock breeding. Among them, single nucleotide polymorphisms (SNPs) have become ideal genetic markers due to their wide distribution, abundance, high stability, and ease of high-throughput automated detection in the genome. By identifying SNP loci significantly associated with important traits (including disease resistance), early, accurate, and non-destructive assessment of the genetic potential of breeding livestock can be achieved, thereby significantly improving the efficiency and accuracy of selection.
[0005] The body's resistance to disease is closely related to the functional state of the immune system, and cytokines, as key messenger molecules that transmit information between immune cells and regulate immune responses, play a central role in anti-infective immunity. Currently, although there are some reports on disease-resistance-related SNP markers in livestock such as cattle, pigs, and chickens, research on SNP molecular markers directly related to the levels of key immune cytokines (such as IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10) in Tibetan sheep, a specific species, remains lacking. Summary of the Invention
[0006] In view of this, the purpose of this invention is to provide a method for breeding Tibetan sheep with high disease resistance using molecular markers and its application.
[0007] This invention provides an SNP molecular marker for assisting in the breeding of Tibetan sheep with high disease resistance. The SNP molecular marker is located at 47,395,962 bases on chromosome 10 of the International Sheep Reference Genome Oar_v4.0. The variant type is A / G, with three genotypes: AA, AG, and GG. Tibetan sheep individuals with genotype AA have significantly higher levels of IL-1α, IL-6, and TNF-β than those with genotype GG. Tibetan sheep individuals with genotypes AA and AG have significantly higher levels of TNF-α and IL-1Ra than those with genotype GG. Tibetan sheep individuals with genotypes AA and AG have significantly lower levels of IL-10 than those with genotype GG.
[0008] This invention provides the application of reagents for detecting the aforementioned SNP molecular markers in the assisted breeding of Tibetan sheep with high disease resistance.
[0009] Preferably, the reagent includes primers as shown in SEQ ID NO.2 and SEQ ID NO.3.
[0010] This invention provides a method for detecting the SNP molecular marker genotype, comprising the following steps: 1) Extract genomic DNA from the blood of the Tibetan sheep samples to be tested; 2) Using the genomic DNA obtained in step 1) as a template, perform PCR amplification with the primers to obtain the amplification product; 3) Sequencing the amplification products and analyzing the genotype of the 298th position of the amplification products to determine the genotype of the SNP molecular marker.
[0011] Preferably, the PCR amplification system, in 25 μL, includes the following components: 22 μL PCR premix, 1 μL upstream primer, 1 μL downstream primer, and 1 μL template.
[0012] Preferably, the PCR amplification program is as follows: 98℃ for 2 min; 98℃ for 10 s, 57℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.
[0013] Compared with the prior art, the present invention has the following beneficial effects: The SNP molecular marker described in this invention is located at position 47,395,962 on chromosome 10 of the International Sheep Reference Genome Oar_v4.0; the variant type is A / G, named g47395962A>G, and three genotypes exist. When position 47,395,962 on chromosome 10 is A, the genotype is AA or AG; when position 47,395,962 on chromosome 10 is G, the genotype is GG; different genotypes are correlated with IL-1α and IL-12. 6. Association analysis of TNF-α, TNF-β, IL-1Ra, and IL-10 levels revealed that the levels of IL-1α, IL-6, and TNF-β in Tibetan sheep individuals with the AA genotype were significantly higher than those with the GG genotype (p<0.05). The levels of TNF-α and IL-1Ra in Tibetan sheep individuals with the AA and AG genotypes were significantly higher than those with the GG genotype (p<0.05), while the levels of IL-10 in Tibetan sheep individuals with the AA and AG genotypes were significantly lower than those with the GG genotype (p<0.05). This invention demonstrates that the bases at the g47395962A>G SNP site on Tibetan sheep chromosome 10 are SNP markers related to IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 in Tibetan sheep. By detecting the bases at the 47395962nd nucleotide site on Tibetan sheep chromosome 10, the levels of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 in an individual Tibetan sheep can be determined. This invention provides a new SNP molecular marker resource for the selection of immune trait markers in Tibetan sheep for non-diagnostic purposes.
[0014] This invention provides a method for selecting Tibetan sheep with high disease resistance using the aforementioned molecular markers. By analyzing the genotype of the SNP molecular markers of the Tibetan sheep to be tested, the disease resistance trait of the Tibetan sheep to be tested is determined, and Tibetan sheep with high disease resistance are screened for subsequent breeding. Attached Figure Description
[0015] Figure 1 The results of agarose gel electrophoresis for detecting the amplification products of the g47395962A>G SNP site on chromosome 10 of Tibetan sheep, where M is the Marker and 1-3 are three replicates of the amplification product; Figure 2 The peak diagram and sequence of SNP sites obtained after purification and sequencing of PCR amplification products. Detailed Implementation
[0016] This invention provides an SNP molecular marker for assisting in the breeding of Tibetan sheep with high disease resistance. The SNP molecular marker is located at 47,395,962 bases on chromosome 10 of the International Sheep Reference Genome Oar_v4.0. The variant type is A / G, with three genotypes: AA, AG, and GG. Tibetan sheep individuals with genotype AA have significantly higher levels of IL-1α, IL-6, and TNF-β than those with genotype GG. Tibetan sheep individuals with genotypes AA and AG have significantly higher levels of TNF-α and IL-1Ra than those with genotype GG. Tibetan sheep individuals with genotypes AA and AG have significantly lower levels of IL-10 than those with genotype GG.
[0017] This invention provides the application of a reagent for detecting the aforementioned SNP molecular marker in the assisted breeding of Tibetan sheep with high disease resistance. In this invention, the reagent includes primers, as shown in SEQ ID NO.2 and SEQ ID NO.3, specifically as follows: F: 5'-CTTTGATCATGCCCATTCCT-3' (SEQ ID NO. 2); R: 5'-GGATTCTTTACCACTTGAGCC-3' (SEQ ID NO. 3).
[0018] In this invention, the reagents also include a PCR premix, which is preferably Gold Mix (green).
[0019] The present invention also provides a method for detecting the molecular genotype of the aforementioned SNP, comprising the following steps: 1) Extract genomic DNA from the blood of the Tibetan sheep samples to be tested; 2) Using the genomic DNA obtained in step 1) as a template, perform PCR amplification with the primers to obtain the amplification product; 3) Sequencing the amplification products and analyzing the genotype of the 298th position of the amplification products to determine the genotype of the SNP molecular marker.
[0020] In this invention, genomic DNA is extracted from the blood sample to be tested. The method for extracting the blood genomic DNA is not particularly limited in this invention; conventional genomic DNA extraction methods in the art can be used.
[0021] In this invention, the PCR amplification system, in 25 μL units, preferably includes the following components: 22 μL PCR premix, 1 μL upstream primer, 1 μL downstream primer, and 1 μL template; the preferred PCR amplification program is as follows: 98℃ for 2 min; 98℃ for 10 s, 57℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.
[0022] After obtaining the amplification product, this invention sequences the amplification product and analyzes the genotype at position 298 to determine the genotype of the SNP molecular marker. In this invention, the amplification product is preferably sequenced after passing agarose gel electrophoresis. The sequencing is preferably performed using direct sequencing. The nucleotide sequence of the amplification product is shown in SEQ ID No. 1, and the SNP marker is located at position 298 of the nucleotide sequence shown in SEQ ID No. 1. In this invention, the sequencing results of the amplification product are preferably compared using the bioanalysis software MEGA 6.0 to analyze the sequencing peaks and complete genotyping.
[0023] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0024] Example 1
[0025] 1. Sample collection
[0026] The samples were collected from Tibetan sheep populations under natural grazing conditions, including 50 samples from Gannan Tibetan Autonomous Prefecture in Gansu Province, 35 samples from Yushu Tibetan Autonomous Prefecture in Qinghai Province, and 43 samples from Shigatse City in Tibet Autonomous Region. 5 mL of blood samples were collected from 128 fasting Tibetan sheep in clean, anticoagulant vacuum blood collection tubes. The tubes were allowed to stand for 30 min, then centrifuged at 3500 rpm for 15 min. The supernatant was collected into clean PE tubes, sealed, and stored at -20°C as serum samples for the detection of pro-inflammatory and anti-inflammatory factors. Separately, 5 mL of blood samples were collected in blood collection tubes containing EDTA-K2 anticoagulant. After collection, the samples were quickly mixed, placed in a sampling box with ice packs for temporary storage, and then transported back to the laboratory and frozen at -20°C for DNA extraction.
[0027] 2. Main Reagents and Instruments
[0028] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomics extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; the NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL1000 markers, agarose, and nucleic acid dyes were purchased from Beijing Solarbio Science & Technology Co., Ltd.; the gold-labeled mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; the electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; and the PCR instrument was purchased from BioRad. The IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.
[0029] 3 Methods
[0030] 3.1 Detection of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra and IL-10
[0031] The assay was performed using the enzyme-linked immunosorbent assay (ELISA) method according to the test kit from Nanjing Jiancheng Biotechnology Research Institute. The assay steps were as follows: (1) Serial dilution of the standard according to the instructions; (2) Add 100 μL of antibody to each well, coat for 2 hours, discard the liquid and spin dry; (3) Add 300 μL of diluted washing buffer to each well, shake for 30 seconds, discard the washing buffer and pat dry with absorbent paper, repeat 5 times; (4) Add 200 μL of blocking buffer to each well, gently shake to mix, let stand at room temperature for 30 minutes, discard the liquid and spin dry; (5) Add 300 μL of diluted washing buffer to each well, shake for 30 seconds, discard the washing buffer and pat dry with absorbent paper, repeat 5 times; (6) Add 25 μL of coating buffer, 25 μL of serum sample and 50 μL of standard to each well, gently shake to mix; (7) Add 100 μL of antibody to each well. (8) Gently shake HRP to mix, let stand at room temperature for 60 min, then discard the liquid and spin dry; (9) Add 300 μL of diluted washing solution to each well, shake for 30 s, then discard the washing solution and pat dry with absorbent paper, repeat 5 times; (10) Add 100 μL of color developing solution to each well, gently shake to mix, and develop color for 15 min; (11) Add 100 μL of stop solution to each well to stop the reaction (at this time, the blue color immediately turns yellow); (12) Zero the blank well and measure the OD value of each well at a wavelength of 450 nm; (13) Make a standard curve using the OD value of the standard and obtain the curve formula, then substitute the OD measured by the sample test tube into the calculation formula to obtain the result.
[0032] 3.2 Extraction of genomic DNA from blood
[0033] Genomic DNA was extracted from blood samples using the blood genome extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The concentration and purity of the extracted DNA were detected by ultraviolet spectrophotometer. A concentration >20 ng / μL and an OD260 / OD280 between 1.7 and 1.9 were sufficient for the experiment. The DNA was stored at -20℃ for later use.
[0034] 3.3 Primer Design
[0035] Based on the gene sequence of chromosome 10 in the Oar_v4.0 version of the international sheep genome (GenBank accession number: NC_019467.2), a pair of specific primers containing the g47395962A>G SNP site was designed using Primer Premier 5.0 software.
[0036] Primer sequences: F: 5'-CTTTGATCATGCCCATTCCT-3' (SEQ ID NO. 2); R: 5'-GGATTCTTTACCACTTGAGCC-3' (SEQ ID NO. 3).
[0037] The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0038] 3.4 PCR amplification and sequencing
[0039] PCR amplification system 25μL: Gold Mix (green) 22μL, upstream and downstream primers 1μL each, template 1μL.
[0040] PCR amplification program: 98℃ for 2 min; 98℃ for 10 s, 57℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.
[0041] PCR products were detected by 1.5% agarose gel electrophoresis. After passing the agarose gel electrophoresis test, the PCR products were sequenced using direct sequencing, which was performed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID No. 1, with a fragment length of 665 bp. The SNP marker is located at position 298 of the nucleotide sequence shown in SEQ ID No. 1, as detailed below: CTTTGATCATGCCCATTCCTTGTTCAAAAACCTCCAAAGGTGCCACATTGCCGAGAGGTGGGTTTTCCAGCAGGCTGATCACAGATCTTTGCCAGATGGATCATAAAACCACATTACCACATTGTGGGCTTCCTCCTCTCCACTGTTGTTGACTCATACATTTGAAATGCACAGGGAGGGCTGCCATGCCAGTCACTTACTTGCATTTCAAATGCCCCAGATTAAAGAGAATATGAATGATTAGAAGCTTTCAGCGTGTCCCTCTTCTCTGCCACGTCCCATTCATTTGGGGGAGTT G GCTAGAAACCACACAGACTGAAATACCACAGGCAGCCTGCAAACTTCTAATTCTTCCCTTGATCCTTGTGGGATTCTGACAGATCTTCCCTTTTATCAAAATGTCTGATACTTTTCTCAATTTCTTTCCTTGAGCAAATATTTAAAAATATCAAGCTGCCCAATTCAAAATGCATGCCCCCAGATCTCAGAGATGTCGGTTTACAAGATACAATGCAAACTCCTTACCCTGTATTCACACTCTTTGTAATTTGGCACCATCTCCCATTTAGCTTTATTTTCACTGCTTTCCCAACATTCACCTTGGACTTCAGTGATCCCTGACTACTGGCTAAAACTTACCAGGTGGCTCAAGTGGTAAAGAATCC。
[0042] The sequencing results of the PCR products were aligned using the bioinformatics software MEGA 6.0, and the sequencing peak maps were analyzed to complete genotyping.
[0043] 4 Statistical analysis
[0044] Based on the genotyping results, the number of individuals with different genotypes at each locus was counted. The frequency of the g47395962A>G gene, genotype frequency, effective allele count (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test were calculated using Popgen32 software. The polymorphism information content (PIC) was calculated using PIC software. The association between different genotypes in Tibetan sheep and IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 was analyzed using a general linear model in IBM SPSS Statistics 22 software. Results are expressed as mean ± standard error.
[0045] 5 Results
[0046] 5.1 PCR amplification and sequencing results
[0047] The amplification products of the g47395962A>G SNP site on chromosome 10 of Tibetan sheep were detected using 1.5% agarose gel electrophoresis (see [link to article]). Figure 1 The bands were clear and free of impurities, indicating good specificity. The PCR product fragment size was 665 bp, which is in line with the expected size, and the next step of the experiment can be carried out.
[0048] The peak chromatogram and sequence obtained after purification and sequencing of the PCR product are shown below. Figure 2 .Depend on Figure 2 It can be seen that the AG mutation occurs at the g47395962A>GSNP site, resulting in three genotypes: AA, AG, and GG.
[0049] 5.2 Statistical Analysis Results
[0050] Genotype and allele frequencies of the g47395962A>G SNP locus on chromosome 10 of Tibetan sheep were analyzed from a population genetics perspective. Table 1 shows that the GG genotype had the highest frequency at the g47395962A>G SNP locus, indicating it was the dominant genotype, while the G allele frequency was 93.0%, also indicating it was the dominant allele. The χ² fitness test showed that the SNP locus significantly deviated from Hardy-Weinberg equilibrium (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.131, and the PIC was 0.122, indicating low polymorphism.
[0051] Table 1. Polymorphism of SNP site g47395962A>G on chromosome 10 of Tibetan sheep
[0052] 5.3 Association analysis between different genotypes and IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10
[0053] The association between different genotypes of Tibetan sheep and the levels of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 was analyzed using a general linear model in IBM SPSS Statistics 22 software. The results showed that the levels of IL-1α, IL-6, and TNF-β in Tibetan sheep with the AA genotype were significantly higher than those with the GG genotype (p<0.05). The levels of TNF-α and IL-1Ra in Tibetan sheep with the AA and AG genotypes were significantly higher than those with the GG genotype (p<0.05), while the levels of IL-10 in Tibetan sheep with the AA and AG genotypes were significantly lower than those with the GG genotype (p<0.05). This indicates that the base at the g47395962A>G SNP site on chromosome 10 of Tibetan sheep is a SNP marker associated with IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10. The results are shown in Table 2.
[0054] Table 2. Correlation analysis between different genotypes and the relative levels (concentrations) of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10.
[0055] Note: Different lowercase letters in the intercalation of data in the same row indicate significant differences (P < 0.05).
[0056] As demonstrated by the above embodiments, the genotype of the SNP molecular markers described in this invention is significantly correlated with the cytokine levels of Tibetan sheep. By detecting the genotype of the SNP molecular markers, the levels of IL-1α, IL-1β, IL-6, TNF-β, IL-1Ra, and IL-10 in individual Tibetan sheep can be determined. This invention provides a new SNP molecular marker resource for marker-assisted selection of immune traits in Tibetan sheep for non-diagnostic purposes. By analyzing the genotype of the SNP molecular markers in the Tibetan sheep to be tested, the disease resistance trait of the Tibetan sheep to be tested can be determined, providing an effective means for early and rapid screening of Tibetan sheep with high disease resistance.
[0057] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A SNP molecular marker for assisting in the breeding of Tibetan sheep with high disease resistance, characterized in that, The SNP molecular marker is located at nucleotide 47,395,962 on chromosome 10 of the International Sheep Reference Genome Oar_v4.
0. The variant type is A / G, with three genotypes: AA, AG, and GG. Tibetan sheep individuals with genotype AA have significantly higher levels of IL-1α, IL-6, and TNF-β than those with genotype GG. Tibetan sheep individuals with genotypes AA and AG have significantly higher levels of TNF-α and IL-1Ra than those with genotype GG. Tibetan sheep individuals with genotypes AA and AG have significantly lower levels of IL-10 than those with genotype GG.
2. The application of the reagent for detecting the SNP molecular marker described in claim 1 in the assisted breeding of Tibetan sheep with high disease resistance.
3. The application according to claim 2, characterized in that, The reagent includes primers, as shown in SEQ ID NO.2 and SEQ ID NO.
3.
4. A method for detecting the SNP molecular marker genotype as described in claim 1, characterized in that, Includes the following steps: 1) Extract genomic DNA from the blood of the Tibetan sheep samples to be tested; 2) Using the genomic DNA obtained in step 1) as a template, perform PCR amplification using the primers described in claim 3 to obtain the amplification product; 3) Sequencing the amplification products and analyzing the genotype of the 298th position of the amplification products to determine the genotype of the SNP molecular marker.
5. The method according to claim 4, characterized in that, The PCR amplification system, in 25 μL units, includes the following components: 22 μL PCR premix, 1 μL upstream primer, 1 μL downstream primer, and 1 μL template.
6. The method according to claim 5, characterized in that, The PCR amplification program is as follows: 98℃ for 2 min; 98℃ for 10 s, 57℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.