Molecular marker ClChr022479391 related to watermelon fruit shape and application thereof

The molecular marker Cl_Chr02_2479391, developed by locating SNP sites on chromosome 2 of watermelon, solved the problem of inaccurate fruit shape positioning in watermelon, realizing a rapid and accurate breeding method and improving breeding efficiency and the accuracy of fruit shape selection.

CN121737342AActive Publication Date: 2026-03-27QIQIHAR UNIVERSITY
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-28
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

In existing technologies, the QTL mapping intervals related to watermelon fruit shape are relatively broad, and the markers are not closely associated with the target traits, making it difficult to apply stably and affecting breeding efficiency and accuracy.

Method used

A SNP molecular marker Cl_Chr02_2479391 related to watermelon fruit shape was developed. By locating a tightly linked SNP site on watermelon chromosome 2, a specific primer set was designed for PCR amplification, and fruit shape was detected using seedling leaf DNA.

Benefits of technology

It enables rapid and accurate identification of watermelon fruit shape, improves breeding efficiency, shortens breeding time, and meets market demand for high-quality fruit shape.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121737342A_ABST
    Figure CN121737342A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and discloses a molecular marker ClChr022479391 related to a watermelon fruit shape and application of the molecular marker ClChr022479391. According to the present invention, the watermelon fruit shape is determined, the stable and reliable molecular marker ClChr022479391 closely linked to the watermelon fruit shape is obtained by constructing the high-density genetic linkage map, the molecular marker is the 2479391 site on the second dye of the watermelon reference genome 97103 V1, and the marker for SNP detection is developed based on the site. The invention also provides a method for quickly identifying the shape of the watermelon fruit by using the primer group of the molecular marker, and the method is simple and quick, accurate in identification result and good in popularization and application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker Cl_Chr02_2479391 related to the shape of watermelon fruit and its application. Background Technology

[0002] watermelon( Citrullus lanatus Watermelon (Thunb.) Matsum. & Nakai) is one of the world's important horticultural economic crops, and its fruit shape is a key appearance trait affecting commercial value, mechanized harvesting, and packaging and transportation. Consumers and the market have a clear preference for watermelon fruit shape, generally expecting round or oval fruits. However, in traditional breeding practices, fruit shape, as a quantitative trait controlled by multiple genes, is easily affected by environmental factors and pollination methods, and its phenotypic selection mainly relies on field phenotypic observation and measurement.

[0003] Watermelons exhibit relatively simple variations in fruit shape: round, oval, and oblong. Weetman proposed that fruit shape is regulated by a single gene, and that this variation is incompletely dominant. OO It is an elongated fruit. Oo The fruit is oval-shaped. oo The fruit is round. Lou et al., however, believe that the shape of watermelon fruit is regulated by three alleles at one locus: ObE It is dominant, resulting in an elongated fruit shape. Ob To conceal its presence, it appears as an oval-shaped fruit, while ObR This results in a round fruit. With the publication of the watermelon reference genome, numerous QTL mapping studies have been conducted on watermelon fruit shape. Currently, QTL loci associated with watermelon fruit shape have been located on chromosomes 2, 3, 5, 7, 8, 9, and 10. However, most existing mapping intervals are relatively broad, exhibiting drawbacks such as insufficient correlation between markers and target traits, inadequate stability, and difficulty in direct application. Therefore, there is an urgent need to develop novel, stable, reliable, and easily detectable molecular markers that are closely linked or co-segregated with key genes for watermelon fruit shape.

[0004] This invention aims to discover SNP molecular markers closely linked to watermelon fruit shape traits. By utilizing these markers, breeders can quickly and accurately screen target individuals for genotypes during the seedling stage of watermelons, thereby achieving targeted breeding of fruit shape traits, significantly shortening the breeding cycle, improving selection efficiency and accuracy, and accelerating the cultivation of new high-quality watermelon varieties with fruit shapes that meet market demands. Summary of the Invention

[0005] One of the objectives of this invention is to provide a molecular marker Cl_Chr02_2479391 related to the shape of watermelon fruit.

[0006] The second objective of this invention is to provide the application of the aforementioned molecular markers related to the shape of watermelon fruits.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: In one aspect, this invention discloses a molecular marker related to the shape of watermelon fruit. The inventors measured the fruit shape index (fruit longitudinal diameter / fruit transverse diameter) at the ripening stage of watermelon fruit, constructed a high-density genetic linkage map, and performed QTL mapping analysis. A linkage region was located on chromosome 2 of watermelon, containing a SNP locus named Cl_Chr02_2479391. This locus is located at position 2479391 on chromosome 2 of the watermelon reference genome 97103 V1. This locus has a G / A base mutation. The nucleotide sequence of this SNP locus is shown in SEQ ID NO.1. When the base at this locus is G, the fruit shape index is >1.11, and the watermelon fruit shape is oval. When the base at this locus is A, the fruit shape index is ≤1.11, and the watermelon fruit shape is round.

[0008] Specifically, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein a G / A base mutation exists at position 174 of the sequence shown in SEQ ID NO.1, and the sequence is: AGGGTGATTCCAATGTTGCGATGAGTGTTGTATTGAACAGCGAGGGATTCGCCGCCGAGTTTTATACCGGTGGCCCAACCGGCGACACCGACGGCGTAGGCGGAGGCTTGACAAGCGACATGGAGGTAAAACCAAGCTGGATCTGCTCCTTTGAAAACCTTCAAATATCTTGC G / A AAAATTGTCCCCATCGGCATAGTCCCCCAACTAACAGCGTTCAAAACTCCATGAGTCTGAAAAATCAAAACCCTTCAATCAGATGGTGAAATTCAGGAAATCCTCAAAAGGGTTTCATGAATGGAAACAATCAAACCGACCCAGATCAGAAAAAAGAAGAAAAAGGGGAAAATCCTTAACAAACACTTACGTTTCTCTTTCTGAGAACTGAATTCCCGGCT (SEQ ID As shown in NO.1, bold and underlined are the SNP site Chr02_2479391 (G / A)).

[0009] Based on this SNP site, a primer set for the SNP marker was designed, and a primer set for amplifying the molecular marker related to watermelon fruit shape was developed. The primer sequence corresponding to the molecular marker Cl_Chr02_2479391 is as follows: Cl_Chr02_2479391-F: AGGGTGATTCCAATGTTGCG (shown as SEQ ID NO.2); Cl_Chr02_2479391-R: AGCCGGGAATTCAGTTCTCAAG (shown in SEQ ID NO.3).

[0010] Secondly, this invention also discloses the application of the primer pairs of the aforementioned molecular markers in marker-assisted breeding related to watermelon fruit shape. In other words, the primer pairs of the molecular markers of this invention can be used in future marker-assisted breeding to identify watermelon fruit shape by extracting DNA from seedling leaves and detecting the presence of the molecular markers of this invention.

[0011] Thirdly, this invention also discloses the application of the aforementioned molecular marker primer pairs in identifying the shape of watermelon fruits. Specifically, the specific steps for identifying the shape of watermelon fruits are as follows: Using watermelon germplasm DNA as a template for PCR amplification, primers with the aforementioned molecular marker Cl_Chr02_2479391 were used for PCR amplification. The PCR reaction system consisted of: 1 μL genomic DNA, 4 μL 2×PCR Mix, 1 μL upstream primer F, 1 μL downstream primer R, and 3 μL sterile distilled water, for a total volume of 10 μL. PCR reaction conditions were: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 25 cycles, followed by a final extension at 72℃ for 7 min, and storage at 4℃.

[0012] Fourthly, the present invention also protects a reagent for detecting the molecular marker Cl_Chr02_2479391, the reagent containing the primer pair Cl_Chr02_2479391-F and Cl_Chr02_2479391-R.

[0013] Fifthly, the present invention also protects a kit for identifying the shape of watermelon fruits, the kit containing the reagents or the primer pairs. Other components of the kit are conventional reagents, specifically including a 2×PCR Mix. The present invention does not impose any particular limitation on the concentration of the primer pairs; a concentration of 10 μM can be used. The present invention does not impose any particular limitation on the source of the 2×PCR Mix.

[0014] Sixthly, the present invention also discloses the application of the reagents and kits in molecular marker-assisted breeding of watermelon fruit shape and in the identification or auxiliary identification of watermelon fruit shape.

[0015] The reagents or kits of this invention can be used to rapidly identify the shape of watermelon fruits. The specific method follows the steps for identifying watermelon fruit shape. By sequencing the PCR amplification products, if the SNP site in the PCR product of the tested variety is located at position 174 of the sequence shown in SEQ ID NO. 1 and the sequencing result is G, the fruit shape index is >1.11, and the watermelon fruit shape is oval; when the sequencing result at this site is A, the fruit shape index is ≤1.11, and the watermelon fruit shape is round.

[0016] The present invention has the following advantages: (1) The inventors of this invention screened out a molecular marker Cl_Chr02_2479391 that is related to the shape of watermelon fruit. This molecular marker is located on chromosome 2. The molecular marker Cl_Chr02_2479391 of this invention can be used to quickly identify the shape of watermelon fruit.

[0017] (2) Using markers linked to the shape of watermelon fruit for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.

[0018] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity. They can be easily, quickly and with high throughput applied to molecular marker-assisted breeding practices and material identification of watermelon fruit shape. Attached Figure Description

[0019] Figure 1 The results of QTL localization analysis for the shape of watermelon fruit.

[0020] Figure 2 This is a box plot showing the distribution of fruit shape index corresponding to the genotype at the Cl_Chr02_2479391 locus in the watermelon population of Example 1 of this invention. G represents the homozygous oval genotype at the Cl_Chr02_2479391 locus, and A represents the homozygous round genotype at the Cl_Chr02_2479391 locus.

[0021] Figure 3 This is an analysis diagram of the sequence alignment results of the Cl_Chr02_2479391 site in 20 natural watermelon materials of this invention. Detailed Implementation

[0022] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0023] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0024] Experimental materials The maternal and paternal parent materials used in this invention, as well as the 62 watermelon materials used for verification in Example 2, are all watermelon materials disclosed in the article "Duan, YR; Li, HW; Amanullah, S; Bao, XP, Guo, Y; Liu, X; Xu, HG; Liu, JX; Gao, Y; Yuan, CZ; Zhao, W; Li, Z; Gao, ML (2023) A single nucleotide mutationin ClphyB gene is associated with ashort lateral branch phenotypeinwatermelonMolecular mapping of candidate gene regulating fruit stripe traitin watermelon. Scientia Horticulturae 321, 112378". The maternal and paternal parents were donated by the Zhengzhou Fruit Research Institute of the Chinese Academy of Agricultural Sciences, and the remaining 62 watermelon materials were obtained from the Zhengzhou Fruit Research Institute of the Chinese Academy of Agricultural Sciences through purchase or donation. All of the above materials can be obtained through purchase or donation.

[0025] Example 1: Development of molecular markers related to watermelon fruit shape This study used GWAS38 (oval shape, fruit shape index = 1.54 ± 0.13, unified number in the China Crop Germplasm Information Network (National Science and Technology Resource Sharing Service Platform) 00000847, variety name disease-resistant watermelon-1) and slb (Roundness and fruit shape index = 1.11 ± 0.07, unified number in China Crop Germplasm Information Network (National Science and Technology Resource Sharing Service Platform) is 00000807, variety name is Zhengzi 100) as the female parent and male parent ( Figure 1The watermelon was crossbred to obtain F1 (elliptical) and F2 populations. A high-density genetic map was constructed using whole-genome resequencing of both parents combined with GBS-seq technology. Using phenotypic data on fruit shape obtained from the F3 population, QTL loci associated with fruit shape were located on chromosome 2 of the watermelon genome, such as... Figure 1 As shown, the candidate region is located within the 2420291~4810430 segment of chromosome 2. Through sequence alignment of the parents and validation in a natural population, a SNP site was found at position 2479391 on chromosome 2 of the watermelon genome 97103 V1, with a G / A mutation at this site. A molecular marker was developed based on this mutation site and named Cl_Chr02_2479391. The nucleotide sequence of the molecular marker Cl_Chr02_2479391 is shown in SEQ ID NO.1. The parental sequences are located at positions 2479218 to 2479616 on chromosome 2 of the watermelon genome 97103 V1, respectively, with a size of 399 bp. Position 174 of the sequence in SEQ ID NO.1 is the SNP site. Based on the mutation site, upstream primer Cl_Chr02_2479391-F and downstream primer Cl_Chr02_2479391-R were designed, with the sequences as follows: Cl_Chr02_2479391-F: AGGGTGATTCCAATGTTGCG (shown as SEQ ID NO.2); Cl_Chr02_2479391-R: AGCCGGGAATTCAGTTCTCAAG (shown in SEQ ID NO.3).

[0026] Statistical analysis revealed that at the SNP sites, the base with a fruit shape index > 1.11 was G, and the base with a fruit shape index ≤ 1.11 was A.

[0027] Example 2: Accuracy verification of the molecular markers described in this invention The molecular markers were validated in natural populations using the fruit shape index and resequencing data of 62 watermelon germplasm materials. The specific fruit shape index and genotypes corresponding to the Cl_Chr02_2479391 locus of the watermelon germplasm materials used are shown in Table 1. Table 1. Fruit shape index and genotype corresponding to Chr02_2479391 locus for 62 germplasm materials

[0028]

[0029] Round watermelon varieties slbThe fruit shape index is used as a standard to classify fruit shape: oval watermelons have a fruit shape index > 1.11; round watermelons have a fruit shape index ≤ 1.11.

[0030] As shown in Table 1, oval watermelons with a fruit shape index > 1.11 are represented by the base G at the aforementioned SNP sites; round watermelons with a fruit shape index ≤ 1.11 are represented by the base A at the aforementioned SNP sites. This demonstrates that the SNP sites provided in this embodiment of the invention can accurately distinguish the shape of watermelon fruits. Therefore, the SNP molecular markers of this invention can effectively identify the size of watermelon fruits and can be used for the breeding of large-fruited, heavy watermelon materials.

[0031] Example 3: A method for identifying the shape of a watermelon fruit This embodiment provides a method for identifying the shape of watermelon fruits using the molecular marker Cl_Chr02_2479391 or specific detection primers or kits. The specific method is as follows: Step 1: Extract DNA from seedling-grown watermelons for testing using a modified CTAB method. Twenty watermelon germplasm materials were randomly selected from those shown in Table 1 and planted under the same conditions. When the plants had three leaves and one heart, they were used as test samples. The young leaves were taken into 2 mL centrifuge tubes, brought back with ice packs, frozen and dried, and then ground into powder using a grinder. The 20 materials in this step consisted of watermelon materials with a fruit shape index >1.11 and a fruit shape index ≤1.11 that were randomly selected.

[0032] (2) Add 1000 μL of 2% CTAB that has been preheated in a 65°C water bath for 1 h to the centrifuge tube, shake to ensure that the powder and liquid are in full contact, and place in a 65°C water bath for 1 h, mixing once every 10 min during the process. (3) After water bath, air dry to room temperature, then centrifuge at 13000 r / min for 15 min at 4℃; (4) After centrifugation, aspirate the supernatant and transfer it to a new 2 mL centrifuge tube. Add 900 μL of chloroform / isoamyl alcohol (volume ratio 24:1) solution, shake well, and centrifuge at 13000 r / min for 15 min at 4℃. Repeat this step twice. (5) Aspirate 600-700 μL of supernatant and place it in a 1.5 mL centrifuge tube. Add 700 μL of anhydrous ethanol pre-cooled at 4℃, shake well, and precipitate at 4℃ for 1 h. (6) Remove the centrifuge tube and centrifuge at 13000 r / min for 15 min at 4℃. After centrifugation, aspirate the supernatant and retain the precipitate. (7) Wash with 75% ethanol 2 to 3 times, air dry at room temperature, add distilled water to make up to 50 μL, and obtain the watermelon DNA sample to be tested. The watermelon DNA sample to be tested can be permanently stored in a -80℃ refrigerator.

[0033] Step 2: Using the watermelon DNA sample obtained in Step 1 as a template, perform PCR amplification with detection primers or kits to obtain PCR amplification products. The PCR amplification reaction system is a 10 μL reaction volume, consisting of the following components: 1 μL DNA template, 4 μL 2×Es TaqMasterMix, 1 μL forward primer F, 1 μL reverse primer R, and 3 μL distilled water. The Es TaqMasterMix contains Es Taq DNA Polymerase and Mg... 2+ and dNTPs; PCR reaction conditions: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 25 cycles, followed by 72℃ extension for 7 min, and storage at 4℃.

[0034] Step 3: The PCR amplification products obtained in Step 2 were analyzed using 1.5% agarose gel electrophoresis to confirm the presence of the target band. The PCR amplification products showing the target band were purified, and the purified PCR amplification products were subjected to Sanger sequencing by Shanghai Sangon Biotech Co., Ltd. (Changchun). Figure 3 As can be seen from the nucleotide sequence comparison, the selected 20 watermelon materials have an SNP site at position 2479391 on chromosome 2, that is, position 174 of the nucleotide sequence shown in SEQ ID NO. 1. Furthermore, the base at the SNP site of the 10 selected watermelon materials with a fruit shape index > 1.11 is G, and the base at the SNP site of the 10 selected watermelon materials with a fruit shape index ≤ 1.11 is A. This detection result is consistent with the watermelon fruit shape characteristics results in Table 1, thus proving that the method provided in this embodiment of the invention can accurately identify the shape of watermelon fruits.

[0035] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. The SNP molecular marker Cl_Chr02_2479391 associated with watermelon fruit shape, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein there is a G / A base mutation at position 174 of the sequence shown in SEQ ID NO.

1. When the base at this position is G, the watermelon fruit is oval in shape, and when the base at this position is A, the watermelon fruit is round in shape.

2. A primer pair for detecting the SNP molecular marker Cl_Chr02_2479391 as described in claim 1, characterized in that, The primer pair includes: Cl_Chr02_2479391-F: AGGGTGATTCCAATGTTGCG; Cl_Chr02_2479391-R: AGCCGGGAATTCAGTTCTCAAG.

3. A reagent for detecting the SNP molecular marker Cl_Chr02_2479391 as described in claim 1, characterized in that, The reagent contains the primer pair as described in claim 2.

4. A kit for detecting the SNP molecular marker Cl_Chr02_2479391 as described in claim 1, characterized in that, The kit contains the primer pair as described in claim 2 or the reagent as described in claim 3.

5. The application of the SNP molecular marker Cl_Chr02_2479391 of claim 1, the primer pair of claim 2, the reagent of claim 3, and the kit of claim 4 in molecular marker-assisted breeding of watermelon fruit shape.

6. The application of the SNP molecular marker Cl_Chr02_2479391 as described in claim 1, the primer pair as described in claim 2, the reagent as described in claim 3, and the kit as described in claim 4 in identifying or assisting in the identification of watermelon fruit shape.

7. A method for identifying the shape of a watermelon fruit, characterized in that, The method includes the following steps: (1) Extract genomic DNA from the watermelon sample to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair described in claim 2, the reagent described in claim 3, or the kit described in claim 4; (3) Purify the PCR amplification products and perform gene sequencing to detect the genotype; (4) The detected genotype is compared with the SNP molecular marker Cl_Chr02_2479391 described in claim 1. If the base at position 174 of the sequence shown in SEQ ID NO.1 is G, the watermelon fruit is oval in shape. If the base at position 174 of the sequence shown in SEQ ID NO.1 is A, the watermelon fruit is round in shape.

Citation Information

Patent Citations

  • CAPS molecular marker capable of synchronously identifying watermelon (Citrullus lanatus) fruits with long, oval and round shapes, and primers and application of CAPS molecular marker

    CN110791588A

  • Molecular marker, primer pair, kit and method for identifying watermelon seed size character and application

    CN120400407A

  • Application of SNP (Single Nucleotide Polymorphism) site in identifying or screening watermelon fruit shape

    CN121272102A

  • Molecular marker for validating seed size of watermelon and use thereof

    KR1020170045779A