Novel anti-echinococcus monoclonal antibody, hybridoma cell strain and application of novel anti-echinococcus monoclonal antibody
By preparing and purifying the novel monoclonal antibody Anti-Em-11 against Echinococcus granulosus, the problem of insufficient specificity in the diagnosis of echinococcosis was solved, achieving highly specific detection of Echinococcus multilocularis infection and improving the accuracy and efficiency of diagnosis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-18
- Publication Date
- 2026-03-31
AI Technical Summary
The existing serological diagnosis of echinococcosis lacks specificity and is difficult to achieve highly specific targeted diagnosis, so there is an urgent need to develop highly specific diagnostic technologies.
A novel monoclonal antibody against Echinococcus granulosus, Anti-Em-11, was obtained through secretion by the hybridoma cell line Anti-Em-11. Combined with gene amplification and recombinant protein expression technology, a highly specific monoclonal antibody was prepared and purified for the detection of echinococcosis.
It enables accurate identification of mid- and late-stage Echinococcus multilocularis infections, improves the specificity and sensitivity of echinococcosis diagnosis, reduces the misdiagnosis rate of Echinococcus granulosus infection, and provides a reliable serological detection tool.
Smart Images

Figure CN121759412A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biomedicine and immunology, and more specifically to a novel monoclonal antibody against Echinococcus tapeworm, a hybridoma cell line, and their applications. Background Technology
[0002] Echinococcosis, caused by Echinococcus tapeworm, is a neglected tropical disease that poses a serious threat to global public health and economic development, and has shown an alarming global spread in recent years. Current serological diagnosis of echinococcosis lacks specificity due to cross-reactivity with various helminth infections, necessitating the development of highly specific targeted diagnostic technologies. Echinococcus tapeworm-specific antigens have become key targets for echinococcosis diagnosis, and the application of monoclonal antibody technology offers a transformative solution to overcome the bottleneck of rapid early clinical diagnosis of echinococcosis.
[0003] Therefore, providing a novel monoclonal antibody against Echinococcus tapeworm, a hybridoma cell line, and their applications are problems that urgently need to be solved by those skilled in the art. Summary of the Invention
[0004] In view of this, the present invention provides a novel monoclonal antibody against Echinococcus tapeworm, a hybridoma cell line, and their applications.
[0005] To achieve the above objectives, the present invention adopts the following technical solution: A hybridoma cell line, Anti-Em-11, with accession number CGMCC No. 46598, has been deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. The deposit date is September 26, 2025, and it is classified as a hybridoma cell.
[0006] Furthermore, a novel monoclonal antibody against Echinococcus tapeworm is obtained from the hybridoma cell line Anti-Em-11.
[0007] Furthermore, the application of the hybridoma cell line Anti-Em-11 or the monoclonal antibody in the preparation of agents for detecting echinococcosis.
[0008] As described above, compared with existing technologies, this invention discloses a novel monoclonal antibody against *Echinococcus granulosus*, a hybridoma cell line, and their applications. The *Echinococcus multilocularis* Em18 gene was obtained through gene amplification and cloned into the pET-28a expression vector. After optimization of induction conditions (0.4 mmol / L isopropyl-β-D-thiogalactoside, 16℃ for 20 hours), recombinant His-tag protein was successfully expressed in *E. coli*. Six-week-old female BALB / c mice were immunized with purified antigen, and a highly specific monoclonal antibody, Anti-Em-11, was obtained using hybridoma technology. SDS-PAGE analysis showed specific bands at 25 kDa (light chain) and 50 kDa (heavy chain) for the purified antibody, identifying the antibody subtype as IgG1κ. Indirect ELISA titer in ascites fluid was 1:6553600, and the ELISA titer of the purified monoclonal antibody Anti-Em-11 was 1:256000. The specific monoclonal antibody successfully prepared and identified in this invention has been confirmed by Western blot and indirect immunofluorescence experiments to have high specificity. Furthermore, the *Echinococcus granulosus* antigen molecules selected in this invention show high homology with other *Echinococcus granulosus* species. The prepared monoclonal antibody can not only accurately identify intermediate and late-stage infections of *Echinococcus multilocularis*, providing a reliable detection tool for assessing the progression of *Echinococcus multilocularis* disease; more importantly, its blocking ELISA clinical detection of *Echinococcus granulosus* infection serum has a high concordance rate, highlighting the antibody's good broad-spectrum potential in the serological diagnosis of echinococcosis. Attached Figure Description
[0009] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0010] Figure 1 This study aimed to amplify the Em18 gene of Echinococcus multilocularis and construct a recombinant protein expression plasmid. In the diagram, A represents PCR amplification results; lane M: Marker DL 2000; lane 1: PCR product; lane 2: negative control (template ddH2O); B represents bacterial culture PCR identification results; lane M: Marker DL 2000; lanes 1-8: positive clones.
[0011] Figure 2For the induction, expression, and purification of recombinant proteins; where M: protein molecular weight standard; lanes 1-3: loading components (whole bacterial lysate, supernatant, and precipitate); lane 4: flow-through buffer; lane 5: 40 mM Elution Buffer washing component; lanes 6-10: gradient elution components (100-500 mM Elution Buffer); lane 11: pET28a-BL21(DE3) bacterial lysate control.
[0012] Figure 3 The results show the serum titer of mice immunized with recombinant protein.
[0013] Figure 4 The image shows a hybridoma cell line with high activity and stable antibody secretion; scale bar is 100 μm.
[0014] Figure 5 The monoclonal antibody Anti-Em-11 was detected by SDS-PAGE electrophoresis combined with Coomassie brilliant blue staining; lane M: protein molecular weight standard; lane 1: monoclonal antibody Anti-Em-11 purified by Protein G agarose.
[0015] Figure 6 For the Western blot specificity identification of monoclonal antibodies; lane M: protein molecular weight standard; lane 1: pET28a-BL21(DE3) bacterial cell lysate; lane 2: purified protein.
[0016] Figure 7 For IFA specificity identification of monoclonal antibody Anti-Em-11; scale bar is 100 μm.
[0017] Figure 8 For amino acid sequence homology analysis. Detailed Implementation
[0018] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0019] The gene sequence before optimization is shown in SEQ ID NO.1.
[0020] ATGAAGGAGTCTGACTTAGCGGATATGAAGAATAAGGCGTCTGCCTATGAAAGTAAGATTGCAGAGCTGGAGATGCTGCTACAGCAGGAGCGACATGCGCGTGAGAGTCTTCAGAAGAGCCAAGACAAACTGGCGGAGATGAACAGAAAGCTGAAGGAGGAGACTGCGGCATCAGCCGAAGAGCGCAACCGTCTGATGGCCCAGCGTGACGAGGTGCAGCGCGAAGTTGAGGCTCAGAAGGTCGCCATGGCCAAGAAGGAGGCTGAAAAGGCTCAGGCTGAAGCTGAGCTTCGCAGAATGCGTGAGAAACACGATGCAAAGCACAAGTCCCAGGTCAATGGCAGTGGTGACGCTGCTTCGCAGGATGATGAAAGTGAAGCCAAGGAACTTGAGGTGATACCAAATGTGAGGCGGACGGAGGAATCGAGGGTGACGGCCGTCTCTAAGAACGAGACGCTCCAGACGAAGCTGGCCAACCTCAAATAG; SEQ ID NO.1.
[0021] The optimized gene sequence is shown in SEQ ID NO.2.
[0022] ATGAAAGAATCAGACCTAGCTGATATGAAGAACAAAGCGAGCGCATACGAAAGCAAGATCGCCGAGCTCGAAATGCTGTTGCAACAAGAACGTCATGCTCGTGAGTCGCTGCAGAAGAGCCAGGACAAATTAGCCGAGATGAATCGCAAACTGAAGGAAGAAACGGCCGCGTCTGCGGAGGAGCGCAACCGCCTGATGGCTCAGAGAGATGAAGTCCAGCGTGAAGTTGAAGCGCAAAAAGTTGC CATGGCAAAGAAAGAGGCGGAGAAGGCGCAGGCAGAGGCGGAGCTGCGTCGTATGCGTGAGAAGCACGATGCGAAACACAAAAGCCAGGTAAATGGCAGCGGTGATGCAGCGTCCCAAGACG ACGAGTCCGAAGCGAAGGAGTTGGAAGTGATTCCGAACGTGCGTCGCACCGAAGAGTCTCGTGTTACCGCTGTGAGCAAGAACGAAACTCTGCAAACCAAATTGGCTAATCTGAAGTAA; SEQ ID NO.2.
[0023] Example 1: Gene amplification, purification, and recovery Based on the gene sequence of *Echinococcus multilocularis* (GenBank: AY513691) from the NCBI database (as shown in SEQ ID NO.1), the target gene sequence (as shown in SEQ ID NO.2) was synthesized by Shanghai Sangon Biotech Co., Ltd. after codon optimization. PCR amplification was performed using the codon-optimized gene sequence as a template. The specific primer sequences used for PCR amplification are as follows: F:5'-CAGCAAATGGGTCGC GGATCC ATGAAAGAATCAGAC-3'; BamH I; SEQ ID NO.3; R: 5'-GTGGTGGTGGTGGTG CTCGAG TTACTTCAGATTAGC-3'; Xho I; SEQ ID NO.4.
[0024] PCR reaction system (50 μL): 25 μL of 2×Hieff Canace Plus PCR Master Mix (With Dye), 2 μL each of upstream and downstream primers, 1 μL of DNA template, and ddH2O to a final volume of 50 μL. After mixing thoroughly by pipetting, PCR amplification was performed. The reaction conditions were as follows: 95℃ pre-denaturation for 5 min; followed by 35 cycles of denaturation (95℃, 30 s), annealing (63℃, 30 s), and extension (72℃, 90 s); and a final extension at 72℃ for 5 min. After the PCR reaction, the PCR products were separated and identified by 1% agarose gel electrophoresis. The target fragment was purified and recovered using the Mol Pure Gel Extraction Kit (Shanghai Yisheng Biotechnology Co., Ltd.). The specific steps are as follows: A gel block containing the target fragment was cut into a 1.5 mL centrifuge tube. 1% agarose gel block was dissolved by adding 100 µL of sol-dextrose buffer (BD) per 0.1 g of gel. The mixture was placed in a 56°C water bath until the gel was completely dissolved, constantly inverting and mixing to accelerate dissolution. The dissolved mixture was transferred to a DNA adsorption column G1, incubated at room temperature for 1 min, and then centrifuged at 12,000 r / min for 1 min. The waste liquid in the collection tube was discarded. The G1 adsorption column was then reinserted into the collection tube, 600 µL of wash buffer was added, and the column was centrifuged at 12,000 r / min for 30 s at room temperature. The wash buffer in the collection tube was discarded, and the above operation was repeated for a second wash. The G1 adsorption column was then placed back into the collection tube, and an empty column was centrifuged at 12,000 r / min for 2 min. After opening the cap, the column was incubated in a ventilated area for 10 minutes. After 2 min, allow the remaining rinsing solution to dry completely; finally, transfer the adsorption column to a new sterile centrifuge tube, add 30 μL of elution buffer dropwise to the center, let stand for 2 min, centrifuge at 12,000 r / min for 1 min, collect the eluent and determine its concentration, and store it at -20℃ for later use.
[0025] 1% agarose gel electrophoresis showed a clear 486 bp band, consistent with the target image. of Gene size matches expectations ( Figure 1 A).
[0026] Example 2 Construction of recombinant plasmids The circular pET-28a(+) vector was linearized by double digestion with restriction endonucleases. The double digestion system was as follows (50 μL): 5 μL plasmid, 5 µL 10×FuniCut Color Buffer, and restriction endonuclease. BamH I and Xho2.5 µL of each of the following were added, and the volume was adjusted to 50 μL with ddH2O. The mixture was incubated at 37°C for 3 h. Subsequently, the target fragment was ligated into the linearized pET-28a(+) vector using the Beyotime Seamless Cloning Kit, successfully constructing a recombinant plasmid with a His tag. The complete ligation system (10 μL) was as follows: 5 μL of 2×Seamless Cloning Mix, 2 μL of target fragment, 1 μL of pET-28a(+), and the volume was adjusted to 10 μL with ddH2O. The mixture was incubated at 55°C for 20 min. The ligation product was transformed into E. coli DH5α competent cells: 100 μL of competent cells and 10 μL of ligation product were placed on ice for 30 min, heat-shocked at 42°C for 90 s, and then immediately placed on ice for 3 min. The transformed product was plated on LB solid agar plates and incubated overnight at 37°C inverted. The next day, single colonies were picked and inoculated into LB liquid medium containing 100 μg / mL kanamycin. After incubation at 37℃ and 220 rpm for about 12 h, the bacterial culture was subjected to PCR identification. Eight randomly selected single colonies were successfully amplified with a 486 bp fragment by PCR verification. Figure 1 B). Positive single clones with the correct band position were selected and sent to Nanjing Qingke Biotechnology Co., Ltd. for Sanger sequencing. The gene sequencing results were consistent with the reference gene sequence, with no mutations or frameshifts, indicating that the target fragment was successfully ligated into the pET-28a(+) prokaryotic expression vector. The confirmed plasmid was then stored at -80℃ for long-term storage.
[0027] Example 3: Induction and purification of recombinant protein The positive plasmid was inoculated at a ratio of 1:1000 into 10 mL of LB liquid medium containing 100 μg / mL kanamycin for activation, and cultured overnight at 37°C and 220 r / min for 12 h. Subsequently, the activated bacterial culture was inoculated at a ratio of 1:100 into 200 mL of LB liquid medium containing 100 μg / mL kanamycin, and cultured again at 37°C and 220 r / min until the OD600 value reached 0.5. IPTG was added to the bacterial culture to a final concentration of 0.4 mmol / L, and the culture was incubated at 16°C and 180 r / min for 20 h to induce large-scale expression of the recombinant protein. The bacterial culture was centrifuged at 4°C and 4,000 r / min for 10 min, and the supernatant was discarded. The bacterial pellet was resuspended in PBS, washed, and centrifuged twice. Then, 25 mL of Lysis Buffer (formulation: sodium phosphate 3.28 g, sodium chloride 29.22 g, imidazole 0.68 g) was added. The bacterial cells were resuspended in deionized water (to a final volume of 1 L, pH 7.4) and subjected to ultrasonic lysis on ice using an ultrasonic cell disruptor (to obtain whole bacterial lysate). The lysate was then centrifuged at 12,000 r / min for 10 min to remove the broken bacterial cells (precipitate). Finally, the supernatant of the lysate was collected.
[0028] Soluble recombinant proteins were purified using Ni-IDA affinity chromatography media (GenScript Biotechnology Co., Ltd.). The steps are as follows: 3 mL of Ni-IDA affinity chromatography agarose medium was loaded into a protein purification gravity column, followed by 4 column volumes of Binding Buffer (formulation: sodium phosphate 3.28 g, sodium chloride 29.22 g, imidazole 1.36 g, deionized water to 1 L, pH 7.4) to equilibrate the purification system. The equilibrated agarose medium was resuspended using the lysis buffer supernatant and incubated overnight at 4°C using a rotary mixer. The next day, the flow-through was collected, and then the contaminating proteins were washed with a low-concentration imidazole elution buffer (formulation: sodium phosphate 3.28 g, sodium chloride 29.22 g, imidazole 34.04 g, deionized water to 1 L, pH 7.4) (imidazole concentration 40 mmol / L). Finally, high-concentration imidazole elution buffers (imidazole concentrations of 100, 200, 300, 400, and 500 mmol / L) were used. The target protein was eluted with a solution of mmol / L at a flow rate of 0.5–1 mL / min. The flow-through, washing, and elution buffers were collected and subjected to SDS-PAGE. Protein expression and purity were assessed using Coomassie Brilliant Blue staining. Finally, the protein concentration was determined using a BCA protein assay kit, and the resulting aliquots were stored at -80°C.
[0029] Figure 2The study aimed to induce expression and purify the recombinant protein. Results showed that the protein existed mainly in a soluble form. Coomassie brilliant blue staining revealed that the purified protein was the expected size and had high purity, confirming successful purification. The protein can be used for subsequent animal immunization and monoclonal antibody preparation.
[0030] Example 4: Determination of animal immunity and serum titer Equal volumes of recombinant protein (concentration: 0.544 µg / µL) and Freund's complete adjuvant were homogenized using a tissue homogenizer until a water-in-oil (W / O) emulsion was formed. Female BALB / c mice (6-8 weeks old) were subcutaneously injected at multiple sites on the nape of the neck with an immunization dose of 100 µg / mouse, with immunization intervals of 2 weeks, for a total of 3 immunizations (the initial immunization used complete adjuvant, and the booster immunization used incomplete adjuvant). A negative control group was established, and mice in this group were inoculated with phosphate-buffered saline (PBS) emulsified with adjuvant according to the same immunization procedure. Blood was collected from immunized mice via the tail vein, and serum antibody titers were measured using indirect ELISA. The simplified procedure is as follows: Recombinant Em18 protein was diluted to 2 μg / mL in carbonate coating buffer (pH 9.6), and 100 μL / well was coated into 96-well microplates and incubated overnight at 4 °C. After washing with phosphate-buffered saline (PBST) containing 0.05% Tween-20, 100 μL / well of 5% skim milk prepared with PBST was added, and the wells were blocked at 37°C for 1 h. Subsequently, 100 μL / well of serially diluted immunized mouse serum samples and non-immunized mouse serum (1:100, 1:200, 1:400…, 1:102,400) was added, and the wells were incubated at 37°C for 1 h. After washing three times, 100 μL of horseradish peroxidase (HRP)-labeled goat anti-mouse IgG (H+L) (1:3,000 dilution) was added to each well, and the wells were incubated at 37°C for 1 h. Then, 100 μL of TMB chromogenic solution was added to each well, and the reaction was carried out at 37°C in the dark for 10–15 min, followed by 50 μL of stop solution. Finally, the absorbance was measured at 450 nm using a Tecan M200 Pro multi-plate reader.
[0031] Using the detection readings of immunized mouse serum as a positive control (P value) and the serum of non-immunized mice as a negative control (N value), the absorbance ratio of positive to negative samples (P / N) was calculated. When this ratio is greater than or equal to 2.1, the corresponding maximum serum dilution ratio is the final antibody titer.
[0032] Figure 3 The serum titer (OD450 value) of mice immunized with recombinant protein is greater than 1:10. 4 .
[0033] Example 5: Establishment of positive hybridoma cell lines (1) Preparation of SP2 / 0 cells: Approximately 10 days before cell fusion, SP2 / 0 cells were resuscitated and passaged continuously to passage 7-8. Cells with good growth and normal morphology were selected and cultured in three 10 cm culture dishes. At fusion, cells were collected using RPMI 1640 medium containing 1% penicillin-streptomycin, centrifuged, washed, and resuspended for cell counting (7.5 × 10⁻⁶). 7 (each cell / mL) and placed in a 37℃, 5% CO2 incubator for later use.
[0034] (2) Preparation of feeder cells: One day before cell fusion, 6-8 week old female BALB / c mice were euthanized and their bodies were disinfected. Under aseptic conditions, the abdominal skin was peeled off to expose the peritoneum. Cell nutrient solution containing 2% HAT medium (hypoxanthine-aminopterin-thymidine medium) (Beijing Solarbio Biotechnology Co., Ltd.) was injected into the peritoneal cavity using a sterile syringe. After gently patting the abdomen with a sterile cotton swab for 1 min, the cell suspension was aspirated. This operation was repeated 3-4 times. The collected cell suspension was seeded into 96-well plates at 100 μL / well and cultured in a 37℃, 5% CO2 incubator for later use. The next day, the feeder cells were observed to be in good growth condition, at an appropriate density, and free from microbial contamination before subsequent fusion experiments.
[0035] (3) Preparation of spleen cells: Immunize mice with a titer of 1:10 4 Three days prior to fusion, BALB / c mice were intraperitoneally injected with 0.2 mL of sterile PBS solution containing 50 µg of recombinant protein for a shock immunization. After euthanasia, the spleens were harvested to prepare single-cell suspensions. Under aseptic conditions, the spleens were removed, and the surface connective tissue was excised. The spleens were placed on a 70 μm cell sieve and gently ground using a syringe plunger to release the spleen cells. The cells were mechanically ground through the 70 μm cell sieve, washed with 1640 medium containing 1% penicillin and antibiotics, and filtered. After centrifugation at 1000 r / min for 10 min, the cells were collected. This process was repeated once. The cells were then gently pipetted into a single-cell suspension using 10 mL of 1640 medium containing 1% penicillin and antibiotics, and diluted for counting (5.6 × 10⁻⁶). 8 (units / mL).
[0036] (4) Cell fusion: The above-mentioned spleen cells and SP2 / 0 cells were mixed at a ratio of 7.5:1 and centrifuged at 1,000 r / min for 10 min. After centrifugation, the supernatant was discarded and the bottom of the tube was gently tapped to disperse the cell clumps at the bottom. The centrifuge tube containing the cells was placed in a 40℃ water bath. Under light-protected conditions, 1 mL of PEG fusion agent (Sigma, USA) was slowly added to the cell pellet. Then, 1% penicillin-1640 medium was gradually added to the centrifuge tube to stop the fusion. 1 drop was added every 2 s for the first 30 s and 1 drop every 1 s for the next 30 s. 2 mL was added at the second min. 3 mL was added at the third min. The above adding rate was maintained until 10 mL of 1% penicillin-1640 medium was added. After incubating the fused cells in a cell culture incubator for 10 min, centrifuging them at 1,000 r / min for 10 min, discarding the supernatant, and resuspending them in 2% HAT medium (hypoxanthine-aminopterin-thymidine medium, Beijing Solarbio Biotechnology Co., Ltd.). The resuspended cells were then seeded into 96-well plates containing feeder cells and incubated at 37℃ in a 5% CO2 incubator. The fusion status and contamination were observed regularly after fusion, and the medium was changed on day 7. On day 10, the supernatant was collected for ELISA screening.
[0037] (5) Screening and cloning of positive hybridoma cells: The supernatant of fusion cells was used as the primary antibody, and the supernatant of SP2 / 0 cells was used as the negative control. Positive hybridoma cells were screened by indirect ELISA. The steps were as follows: The recombinant protein was diluted to 2 μg / mL in carbonate coating buffer (pH 9.6), and 100 μL / well was coated into 96 microplates and incubated overnight at 4 °C. After washing with phosphate-buffered saline (PBST) containing 0.05% Tween-20, 100 μL / well of 5% skim milk prepared with PBST was added, and the plates were blocked at 37 °C for 1 h. Subsequently, serially diluted hybridoma cell supernatant and SP2 / 0 cell supernatant (1:100, 1:200, 1:400..., 1:102, 400) were added, 100 μL / well, and the plates were incubated at 37 °C for 1 h. After washing three times, 100 μL of goat anti-mouse IgG (H+L) containing horseradish peroxidase (HRP) labeling (1:3,000 dilution) was added to each well, and incubated at 37°C for 1 h. Then, 100 μL of TMB chromogenic solution was added to each well, and the reaction was carried out at 37°C in the dark for 10–15 min, followed by 50 μL of stop solution to each well. Finally, the absorbance was measured at 450 nm using a Tecan M200Pro multi-plate reader.
[0038] Using the detection reading of hybridoma cell supernatant as a positive control (P value) and SP2 / 0 cell supernatant as a negative control (N value), the absorbance ratio of positive to negative samples (P / N) was calculated. When the ratio is greater than or equal to 2.1, the corresponding maximum serum dilution ratio is the final antibody titer. Hybridoma cells with high positive values and good condition were selected and subcloned using the limiting dilution method. The specific steps of subcloning are as follows: feeder cells were prepared one day before subcloning (same as step (2)). The selected positive hybridoma cells were blown off with 2% HT cell nutrient solution (1% penicillin antibody + 2% HT + 15% FBS + 1640 medium), and the cells were counted and the density was adjusted to 1 cell / 0.1 mL. The cells were then seeded into 96-well plates containing feeder cells and cultured in a cell culture incubator. The growth status was observed regularly during the culture process, and the medium was changed halfway on the 7th day. On the 10th day, the supernatant was taken for ELISA detection to screen positive wells. Single cell clusters with high titers and good condition were selected for subcloning until all cell clusters tested positive by ELISA. Finally, single cell clusters with high P / N values were selected for large-scale culture.
[0039] (6) Antibody secretion stability assay: The hybridoma cells that finally screened for antibody secretion were cultured in 6 cm culture dishes and passaged continuously to the 20th generation. Cell supernatant was collected every 5 generations (named F5, F10, F15, and F20, respectively), and antibody titer was determined by indirect ELISA to assess the stability of the antibody secretion ability of hybridoma cells.
[0040] Figure 4 To obtain a highly active and stable antibody-secreting hybridoma cell line, hybridoma cells were screened in HAT medium. After 3-4 rounds of limiting dilution cloning and ELISA screening, the cells were named Anti-Em-11 and showed good growth.
[0041] The hybridoma cell line Anti-Em-11, with accession number CGMCC No.46598, has been deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No.3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. The deposit date is September 26, 2025, and it is classified as a hybridoma cell.
[0042] The indirect ELISA procedure is as follows: The recombinant protein was diluted to 2 μg / mL in carbonate coating buffer (pH 9.6), and 100 μL / well was coated into 96-well microplates and incubated overnight at 4 °C. After washing with phosphate-buffered saline (PBST) containing 0.05% Tween-20, 100 μL / well of 5% skim milk prepared with PBST was added, and the plates were blocked at 37 °C for 1 h. Subsequently, serially diluted hybridoma cell supernatant (F5, F10, F15, F20) and SP2 / 0 cell supernatant (1:100, 1:200, 1:400…, 1:102, 400) were added, 100 μL / well, and the plates were incubated at 37 °C for 1 h. After washing three times, 100 μL of horseradish peroxidase (HRP)-labeled goat anti-mouse IgG (H+L) (1:3,000 dilution) was added to each well, and the plates were incubated at 37 °C for 1 h. Then, add 100 μL of TMB chromogenic solution to each well and incubate at 37°C in the dark for 10-15 min. Next, add 50 μL of stop solution to each well. Finally, measure the absorbance at 450 nm using a Tecan M200 Pro multi-plate reader.
[0043] Using the detection readings of hybridoma cell supernatant as a positive control (P value) and SP2 / 0 cell supernatant as a negative control (N value), the absorbance ratio of positive to negative samples (P / N) was calculated. When this ratio was greater than or equal to 2.1, the corresponding maximum serum dilution ratio was taken as the final titer. Hybridoma cells with high positive values and good condition were selected and subcloned using limiting dilution.
[0044] The results are shown in Table 1.
[0045] Table 1. Potency of culture supernatant from hybridoma cell line Anti-Em-11
[0046] Table 1 shows the culture supernatant titer of the hybridoma cell line Anti-Em-11 obtained in this invention. Positive hybridoma cells were screened using indirect ELISA and subjected to 3-4 rounds of subcloning. One hybridoma cell line capable of stable passage was selected and named Anti-Em-11. The hybridoma cells were continuously passaged to the 20th generation, and the cell supernatant titer was measured every 5 generations. The results showed that the supernatant titer remained stable without a significant decreasing trend.
[0047] Example 6: Preparation and potency determination of mouse ascites fluid Female BALB / c mice aged 6-8 weeks were selected and sensitized 7 days after intraperitoneal injection of 500 μL of liquid paraffin. Then, 1×10⁻⁶ μL of liquid paraffin was injected intraperitoneally into the mice. 6Selected hybridoma cells were collected. Mice were observed daily, and ascites fluid was collected when the abdomen became noticeably distended and fluctuant. The collected ascites fluid was centrifuged at 5000 r / min for 10 min at 4°C. The supernatant was then used to determine the ascites titer using an indirect ELISA method, as follows: The recombinant protein was diluted to 2 μg / mL in carbonate coating buffer (pH 9.6), and 100 μL / well was coated into 96-well microplates and incubated overnight at 4°C. After washing with PBST, 100 μL / well of 5% skim milk prepared with PBST was added, and the plates were blocked at 37°C for 1 h. Subsequently, serially diluted mouse ascites fluid and SP2 / 0 cell supernatant (1:1000, 1:2000, 1:4000…, 1:26,214,400) were added at 100 μL / well, and the plates were incubated at 37°C for 1 h. After washing three times, 100 μL of goat anti-mouse IgG (H+L) containing horseradish peroxidase (HRP) labeling (1:3,000 dilution) was added to each well, and incubated at 37°C for 1 h. Then, 100 μL of TMB chromogenic solution was added to each well, and the reaction was carried out at 37°C in the dark for 10–15 min, followed by 50 μL of stop solution to each well. Finally, the absorbance was measured at 450 nm using a Tecan M200 Pro multi-plate reader.
[0048] Using the detection reading of hybridoma cell supernatant as a positive control (P value) and SP2 / 0 cell supernatant as a negative control (N value), the absorbance ratio of positive to negative samples (P / N) was calculated. When the ratio is greater than or equal to 2.1, the corresponding maximum serum dilution ratio is the final antibody titer.
[0049] The results are shown in Table 2.
[0050] Table 2. Results of indirect ELISA determination of mouse ascites titer (OD450 value)
[0051] Table 2 shows the ascites titer obtained in this invention. Indirect ELISA results showed an ascites titer of 1:6,553,600.
[0052] Example 7: Purification of Ascites Fluid Ascites fluid was first diluted with equilibration / wash buffer (0.15 M NaCl, 20 mM Na2HPO4, pH 7.0), filtered through a 0.45 μm filter, and then loaded onto the column. The rProtein G Beads gravity column was pre-equilibrated 2-3 times with 5 column volumes of equilibration buffer (0.15 M NaCl, 20 mM Na2HPO4, pH 7.0). The sample was added to the gravity column and incubated overnight at 4°C to improve binding efficiency. Non-specific proteins were removed sequentially with 10-15 column volumes of wash buffer (0.15 M NaCl, 20 mM Na2HPO4, pH 7.0), followed by 5-10 column volumes of elution buffer (0.1 M glycine, pH 3.0) for fractional elution. The eluted fractions were immediately adjusted to neutral with neutralization buffer (1 M Tris-HCl, pH 8.5, 1 / 10 of the eluted fraction volume), and the purification effect was assessed by SDS-PAGE.
[0053] Figure 5 The monoclonal antibody Anti-Em-11 was detected using SDS-PAGE electrophoresis combined with Coomassie brilliant blue staining. Clear protein bands (approximately 50 kDa for the heavy chain and 25 kDa for the light chain) were visible at the expected molecular weight positions, indicating good purification results.
[0054] Example 8: Detection of purified antibody titer The purified monoclonal antibody Anti-Em-11 was titered using an indirect ELISA method. The initial dilution was 1:2000, and subsequent serial dilutions were performed to a final dilution of 1:1024000. The purified antibody was aliquoted and stored at -80°C. The results are shown in Table 3.
[0055] Table 3. ELISA titer results (OD450 values) of monoclonal antibody Anti-Em-11
[0056] Table 3 shows the ELISA titer (OD450 value) of the monoclonal antibody Anti-Em-11. This indicates that the purified antibody titer is 1:256000.
[0057] Example 9 Antibody Subtype Identification The mouse monoclonal antibody subtype identification kit (Proteintech Biotechnology Co., Ltd.) was equilibrated at room temperature for 30 minutes. Antibody samples were diluted 100,000-fold with PBST, and 50 μL of the diluted sample was added to each well of an ELISA plate. Then, 50 μL of goat anti-mouse IgA+IgG+IgM-HRP was added, and the plate was incubated at room temperature for 1 hour. After washing three times with PBST, the chromogenic solution was added, and the plate was reacted in the dark for 10 minutes. The reaction was then terminated, and the absorbance was measured at 450 nm. The subtype of the monoclonal antibody was determined based on the antibody class corresponding to the maximum absorbance value. The results are shown in Table 4.
[0058] Table 4. Subtype identification results (OD450 values) of monoclonal antibody Anti-Em18-11
[0059] Table 4 shows the subtype identification results (OD450 values) of the monoclonal antibody Anti-Em-11. The well with the highest OD450 nm value corresponds to the corresponding antibody subtype. All heavy chain types are IgG1 subclass, and all light chain types are Kappa type.
[0060] Example 10 Antibody Specificity Identification (1) Western blot The purified recombinant protein and pET-28(+) empty vector-induced samples were denatured at high temperature and then subjected to SDS-PAGE electrophoresis. The samples were then transferred to nitrocellulose membranes using a semi-dry transfer method at a constant current of 0.3 mA for 35 min. The transferred membranes were blocked at room temperature for 2 h with 5% skim milk powder-TBST blocking solution. After washing with TBST, the membranes were incubated sequentially with monoclonal antibody (1:5,000 diluted) at 4 °C for 12 h and HRP-labeled goat anti-mouse IgG secondary antibody at room temperature for 1 h. After thorough washing with PBST, the membranes were developed with ECL chemiluminescence solution for 1 min and finally detected by a chemiluminescence imaging system.
[0061] Figure 6 Western blot analysis was performed to identify the specificity of the monoclonal antibody. The monoclonal antibody Anti-Em-11 specifically recognizes the target antigen at 18 kDa and shows no reaction with the pET28a(+) empty vector, indicating that the monoclonal antibody Anti-Em-11 has good specificity.
[0062] (2) Indirect immunofluorescence The binding ability of the monoclonal antibody Anti-Em-11 to the protoscolex of *Echinococcus multilocularis* was further evaluated by indirect immunofluorescence. Protoscolex were obtained from a six-month chronic liver cyst infection model in gerbils and purified by sedimentation in 0.9% saline before detection. Samples were first blocked with 5% bovine serum albumin (BSA) at room temperature for 2 hours to eliminate non-specific binding, and then incubated with the purified monoclonal antibody overnight at 4°C. After washing three times with PBS, Alexa Fluor 594 (Thermo Fisher Scientific)-labeled goat anti-mouse IgG (H+L) secondary antibody was added, and the sample was incubated at 37°C in the dark for 1 hour. After thorough washing, the fluorescence signal was observed using an inverted fluorescence microscope.
[0063] Figure 7 The IFA specificity of the monoclonal antibody Anti-Em-11 was identified. Negative (non-immunized mouse serum) and positive serum controls (infected mouse serum) were included in the experiment, and Alexa Fluor 594-labeled goat anti-mouse IgG (H+L) was used as the secondary antibody. Fluorescence signals were observed under a 400× inverted microscope (scale bar: 100 μm). The monoclonal antibody Anti-Em-11 specifically bound to the protoscolex and exhibited a strong red fluorescence signal, while no fluorescence signal was detected in the negative control group. This further demonstrates that the selected monoclonal antibody Anti-Em-11 has good specificity.
[0064] Example 11 Homology Analysis To analyze the homology of the Em18 molecule with other Echinococcus species, other species of the genus Echinococcus were downloaded from the NCBI database, such as *Echinococcus granulosus* (accession number: AY513265, FN582296), *Echinococcus flexucigenia* (accession number: FN582293), *Echinococcus steganacifolius* (accession number: FN582292), and *Echinococcus cantonensis* (accession number: FN582301) for homology analysis. The downloaded sequences were saved as FASTA format sequence files using DNAMAN software for sequence comparison and analysis. Results ( Figure 8 This indicates that the gene sequence has a high degree of homology with other species of the Echinococcus genus.
[0065] Example 12 Clinical Sample Testing Serological responses in mice at 1, 2, and 6 months post-infection were systematically evaluated. Serum samples were collected from wild-type C57BL / 6J mice infected with *Echinococcus multilocularis* (1000 protoscolex segments were inoculated intraperitoneally in each mouse, n=3 per group), and a negative control was included. The inhibition rate (PI) was calculated using a blocking ELISA method: PI (%) = [(OD450 value of negative control - OD450 value of sample) / OD450 value of negative control] × 100%. A sample was considered serologically positive if the inhibition rate exceeded 50%. The results showed that, except for early-stage infection (66.7%), all mid-to-late-stage infection samples were positive. Therefore, the blocking ELISA method established in this invention successfully detected 8 positive samples out of 9 infected serum samples, achieving an overall positive detection rate of 88.9% (Table 5).
[0066] Table 5. Results of serum blocking ELISA detection in mice at different stages of Echinococcus multilocularis infection.
[0067] Subsequently, 47 sheep clinical samples preserved in the laboratory were subjected to blocking ELISA testing, and the results were compared with those obtained using the sheep echinococcosis Eg95 antibody detection kit (Shenzhen Kangbaide Biotechnology Co., Ltd., 20250911). Consistency was calculated using the following formula: Consistency (%) = (Number of positive samples + Number of negative samples) / Total number of samples tested × 100%. As shown in Table 6, the commercial kit detected 31 positive samples and 16 negative samples, while the blocking ELISA method based on this monoclonal antibody detected 28 positive samples and 16 negative samples, with an overall consistency of 93.6% between the two methods.
[0068] Table 6. Concordance rate of ELISA detection of Echinococcus granulosus infection in serum.
[0069] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A hybridoma cell line Anti-Em-11, characterized in that, Its accession number is CGMCC No.46598.
2. A novel monoclonal antibody against Echinococcus tapeworm, characterized in that, It is secreted from the hybridoma cell line Anti-Em-11 as described in claim 1.
3. The use of the hybridoma cell line Anti-Em-11 according to claim 1 or the monoclonal antibody according to claim 2 in the preparation of a preparation for detecting echinococcosis.