Application of BMP4 agonist in improving hypoxia resistance of fishes
By activating the BMP4 signaling pathway in fish and using BMP4 agonists such as SB4, the problems of long cycle, high cost and ecological safety controversy in improving fish hypoxia tolerance have been solved, and the survival ability of fish in hypoxia environment has been improved, making it suitable for large-scale aquaculture.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-23
- Publication Date
- 2026-04-03
AI Technical Summary
Existing technologies for improving fish's tolerance to low oxygen levels suffer from problems such as long development cycles, high costs, complex operations, and ecological safety controversies, making large-scale application in aquaculture difficult.
By using BMP4 agonists such as SB4, the BMP4 signaling pathway in fish can be activated exogenously, thereby enhancing their resistance to hypoxia and promoting angiogenesis in accessory respiratory organs.
It significantly enhances the survival ability of fish in low-oxygen environments, avoids the ecological risks brought about by gene editing, is suitable for large-scale pond and factory-style recirculating aquaculture, and is easy to operate and safe and controllable.
Smart Images

Figure CN121775145A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of aquaculture technology and relates to the application of bone morphogenetic protein 4 (BMP4) agonists in improving the hypoxia tolerance of fish. This invention also relates to a method for coping with hypoxia stress in aquaculture environment by regulating the fish's own stress resistance. Background Technology
[0002] Dissolved oxygen is a crucial environmental factor for maintaining the normal growth, development, and survival of fish. With the increasing intensification of aquaculture and the growing stocking density, uneaten feed and fish metabolic products accumulate in the water, leading to frequent occurrences of hypoxia. Hypoxia stress severely disrupts fish physiological metabolism, inhibits growth, reduces immunity, and can even cause large-scale mortality, resulting in significant economic losses to the aquaculture industry. Therefore, improving the hypoxia tolerance of farmed fish has become an urgent need for the sustainable development of the industry.
[0003] Traditional solutions mainly rely on physical aeration (such as aerators) and improved aquaculture management, but these methods are costly and their effectiveness is limited by facilities and the environment. Selecting hypoxia-tolerant varieties through genetic breeding is the fundamental approach, but traditional selection breeding and hybridization breeding are time-consuming and inefficient. While gene-editing-based molecular breeding technologies (such as CRISPR / Cas9) are precise, they face multiple challenges, including ecological safety assessments, regulatory approvals, and public acceptance, making large-scale industrial application difficult in the short term.
[0004] Therefore, developing a fish stress resistance regulation technology that is simple to operate, safe and controllable, effective, and easy to promote in conventional aquaculture scenarios is of significant practical importance. The inventors have noted that some fish have evolved specialized auxiliary respiratory mechanisms to adapt to hypoxic environments. For example, loach (… Misgurnus anguillicaudatus It possesses a highly developed hindgut respiratory capacity, with its hindgut mucosa being highly vascularized, allowing it to directly utilize atmospheric oxygen and thus exhibiting extremely strong hypoxia tolerance. Studies have shown that an efficient vascular network is the structural basis for gas exchange function, and angiogenesis is precisely regulated by a variety of growth factors.
[0005] Bone morphogenetic protein 4 (BMP4) is a member of the transforming growth factor-β (TGF-β) superfamily and plays a crucial role in embryonic development, tissue homeostasis, and injury repair. Extensive evidence suggests that BMP4 is a potent pro-angiogenic factor that can promote endothelial cell proliferation, migration, and lumen formation by activating signaling pathways such as SMAD1 / 5 / 9. However, the role of BMP4 in hypoxic adaptation in fish, particularly in the vascularization of accessory respiratory organs, remains unclear.
[0006] In previous studies, the applicant discovered through comparative genomics and transcriptomics analysis that the BMP4 gene is specifically highly expressed in the hindgut of loach, and that its expression is induced by hypoxia. Further research using CRISPR / Cas9 technology to construct a loach bmp4 gene knockout model revealed that the mutant's survival time under air exposure was significantly shortened, and the expression of hindgut angiogenesis-related genes was downregulated. These results indicate that BMP4 is a key factor regulating the hypoxia tolerance trait of loach.
[0007] Based on the above findings, this invention proposes to use small molecule agonists of BMP4 (such as SB4) to activate this pathway, aiming to safely and efficiently improve the hypoxia tolerance of farmed fish and provide a new technical solution for stress management in aquaculture. Summary of the Invention
[0008] To address the problems of long cycles, high costs, complex operations, or ecological safety controversies in existing methods for improving the hypoxia tolerance of farmed fish, this invention provides a method that is simple to operate, safe and controllable, quick to take effect, and easy to promote in the industry. By exogenously regulating the fish's intrinsic BMP4 signaling pathway, it significantly enhances the fish's ability to cope with hypoxia stress in the aquaculture environment.
[0009] To solve the above-mentioned technical problems, the present invention adopts the following technical solution: In a first aspect, the present invention provides the application of bone morphogenetic protein 4 (BMP4) agonists in the preparation of aquaculture formulations for improving the hypoxia tolerance of fish.
[0010] Secondly, the present invention provides a method for improving the hypoxia tolerance of fish in aquaculture, comprising applying an effective amount of a BMP4 signaling pathway agonist to fish in aquaculture water to activate the BMP4 signaling pathway in the fish, thereby enhancing their resistance to hypoxia stress in the aquaculture environment.
[0011] Preferably, the BMP4 agonist is compound SB4.
[0012] Preferably, the working concentration of the BMP4 agonist in the aquaculture water is 1 μM to 10 μM, more preferably 3 μM.
[0013] Preferably, the fish is a freshwater fish with intestinal respiration or similar auxiliary respiration capabilities, such as loach.
[0014] The SB4 has the molecular formula C14H10BrNOS and the CAS registry number 100874-08-6.
[0015] The beneficial effects of this invention are: This invention directly targets the BMP4 signaling pathway, a key pathway regulating hypoxia adaptation in fish. By activating this pathway with exogenous agonists, it effectively promotes angiogenesis in accessory respiratory organs (such as the hindgut) and enhances gas exchange efficiency, thereby significantly extending survival time in hypoxic environments. This method requires no complex equipment or operational skills and can be directly integrated into existing aquaculture processes, making it highly suitable for large-scale pond and recirculating aquaculture systems. This invention does not involve permanent alterations to the fish genome, avoiding the ecological risks and ethical controversies that gene editing technologies may bring. It boasts high environmental safety and broad applicability, providing a novel molecular target and technical pathway for breeding or managing other economically or ecologically valuable hypoxia-tolerant fish species. Attached Figure Description
[0016] Figure 1 Effect of SB4 treatment on the expression level of BMP4 gene in the hindgut tissue of loach.
[0017] Figure 2 Effect of SB4 treatment on the survival time of loach under air exposure conditions. Detailed Implementation
[0018] The following examples illustrate the application of this invention. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of the invention. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of this invention should be included within the protection scope of this invention.
[0019] To elucidate the genetic mechanism by which the bone morphogenetic protein Bmp4 regulates the hypoxia tolerance trait in loaches and to provide theoretical support for breeding new hypoxia-tolerant fish germplasm, we previously used transcriptomics, qPCR, and immunofluorescence techniques to analyze... bmp4 The expression pattern was determined, and a loach model was constructed using CRISPR / Cas9 technology. bmp4 Gene knockout mutants were used to assess their hypoxia tolerance and angiogenesis capacity. The results showed that... bmp4 It is specifically highly expressed in the hindgut of loach and is activated by hypoxia; bmp4 - / - In mutant loaches, the tolerance to hypoxia under air exposure is significantly reduced, and multiple angiogenesis-related genes in the hindgut, such as vegfr3 , cegfd , hif-1α The expression of [various substances] was significantly downregulated. This demonstrates [the following]. bmp4It is a key factor regulating the hypoxia tolerance trait of loaches. It can enhance angiogenesis and mediate hypoxia adaptive responses in the hindgut tissue. Activating this pathway may improve the survival rate of fish under hypoxia. This study reveals a new mechanism of hypoxia adaptation in fish from a genetic and physiological perspective, provides a key molecular target for breeding hypoxia-tolerant aquatic animals, and lays a theoretical foundation for developing strategies to improve the hypoxia tolerance of farmed fish.
[0020] Example 1: The enhancing effect of SB4 on the hypoxia tolerance of loach 1. Experimental Materials Experimental animals: Healthy wild-type diploid loaches, all from a self-bred population at the Genetic Breeding Base of the College of Fisheries, Huazhong Agricultural University. Before the experiment, they were acclimatized in flowing water in square glass tanks for two weeks at a water temperature of (25±1)℃, pH 7.0-7.5, dissolved oxygen of (6.5±0.5) mg / L, and fed twice a day at regular intervals.
[0021] Main reagents: BMP4 agonist SB4 (purchased from MedChemExpress, USA), dimethyl sulfoxide (DMSO), RNA extraction reagent (TaKaRa RNAiso Plus), reverse transcription and qPCR kit (TaKaRa).
[0022] Main instruments: tissue homogenizer, low-temperature high-speed centrifuge, real-time quantitative PCR instrument (AppliedBiosystems QuantStudio series), ultraviolet spectrophotometer.
[0023] 2. Experimental Methods 2.1 Experimental Grouping and Processing Loaches of similar body length and weight were randomly divided into two groups: Solvent control group: placed in 500 mL of aquaculture water containing 0.01% (v / v) DMSO; SB4 treatment group: SB4 was prepared into a 30 mM stock solution with DMSO, and then diluted with aquaculture water to a final concentration of 3 μM. The treatment volume was 500 mL.
[0024] Each group has 3 parallels, with 15 loaches per parallel. During the treatment, the corresponding treatment solution is completely replaced every 48 hours, and the treatment continues for 4 days.
[0025] 2.2 Sample Collection and Gene Expression Analysis On the fourth day after treatment, six loaches were randomly selected from each group, euthanized, and then quickly dissected to remove the hindgut tissue, which was flash-frozen in liquid nitrogen and stored at -80°C.
[0026] Total RNA extraction and cDNA synthesis: Total RNA was extracted according to the TaKaRa RNAiso Plus instructions. After the quality was verified by agarose gel electrophoresis and spectrophotometry, cDNA was synthesized using the PrimeScript™ 1st Strand cDNASynthesis Kit.
[0027] Real-time quantitative PCR (qPCR): The following specific primers were designed based on the conserved sequence of the loach BMP4 gene (GenBank accession number: XM_055172581.2): BMP4 upstream primer: CACCTGAACTCCACCAAT; BMP4 downstream primer: GTCCGTATATGTCCGCTTA.
[0028] Primers for the internal reference gene β-actin: Upstream primer: TTCCTGGGTATGGAGTCTTGCG Downstream primer: AGAGGTTTAGGTTGGTCGTTT.
[0029] qPCR reaction system (10 μL): 5 μL SYBR Premix Ex Taq™ II (2×), 0.4 μL each of forward and reverse primers, 1 μL cDNA template, and RNase-free water to a final volume of 10 μL. Reaction program: 95℃ pre-denaturation for 30 s; 95℃ for 5 s, 60℃ for 30 s, for a total of 40 cycles; finally, melting curve analysis was performed. 2... The relative expression level of the BMP4 gene was calculated using the ΔΔCt method.
[0030] 2.3 Hypoxia tolerance test (air exposure test) After the initial treatment, 15 loaches from each group were used for a survival experiment. The loaches were removed from the water and placed in a clean glass tank (at room temperature) lined with damp gauze. The gauze was kept moist during the experiment, and the time when each loach stopped gill movement and did not respond to external stimuli was continuously observed and recorded as the time of death. The average survival time of each group was calculated.
[0031] 2.4 Data Processing Experimental data are expressed as mean ± standard error. Independent samples t-tests were performed using SPSS software, with P < 0.05 as the criterion for statistical significance.
[0032] 3. Experimental Results 3.1 SB4 significantly upregulated BMP4 gene expression in the hindgut of loach. like Figure 1As shown, compared with the solvent control group, the mRNA expression level of BMP4 gene in the hindgut tissue of loach treated with SB4 was significantly upregulated at the sampling time (day 4 after treatment) (P<0.01), indicating that 3μM SB4 treatment can effectively activate the BMP4 signaling pathway in loach.
[0033] 3.2 SB4 significantly prolonged the survival time of loaches exposed to air. like Figure 2 As shown, in the air exposure experiment, the average survival time of loaches in the SB4 treatment group reached (620±80 min), which was significantly longer than that in the solvent control group (400±80 min) (P<0.05). This indicates that short-term SB4 treatment to activate the BMP4 pathway can significantly enhance the survival ability of loaches under extreme hypoxic (air exposure) conditions.
Claims
1. Application of bone morphogenetic protein 4 (BMP4) agonists in the preparation of aquaculture formulations to improve the hypoxia tolerance of fish.
2. A method for improving the hypoxia tolerance of fish in aquaculture, characterized in that, include: Applying an effective amount of BMP4 signaling pathway agonist to fish in aquaculture waters activates the BMP4 signaling pathway in the fish, thereby enhancing their resistance to hypoxic stress in the aquaculture environment.
3. The method according to claim 2, characterized in that, The BMP4 agonist is compound SB4.
4. The method according to claim 3, characterized in that, The working concentration of the BMP4 agonist in aquaculture water is 1 μM to 10 μM.
5. The method according to claim 2, characterized in that, The fish in question is a loach.