Universal human induced pluripotent stem cells, mDAP / mDA cells and applications

By inserting specific short enhancers into the PD-L1 and CTLA4 promoters, human induced pluripotent stem cells were edited using the CRISPR/Cas9 system, which solved the risks of immune rejection and tumorigenesis, enabled immune escape of dopaminergic neural progenitor cells and neurons, and improved the success rate of cell transplantation.

CN121780445BActive Publication Date: 2026-07-03SHANGHAI YUANVORE MEDICINE TECHNOLOGY CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI YUANVORE MEDICINE TECHNOLOGY CO LTD
Filing Date
2026-03-05
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

In existing technologies, human induced pluripotent stem cell transplantation faces the risks of immune rejection and tumorigenesis. Furthermore, existing gene editing methods are random and unpredictable, making it difficult to accurately endow terminally differentiated cells with immune tolerance.

Method used

By inserting specific short enhancers (TSEs) upstream of the transcription start sites of PD-L1 and CTLA4 promoters, gene editing using the CRISPR/Cas9 system ensures efficient expression of PD-L1 and CTLA4 in dopaminergic neural progenitor cells and neurons, thereby enabling immune escape.

Benefits of technology

This method enables effective immune escape of dopaminergic neural progenitor cells and neurons during differentiation, avoiding excessive graft proliferation and tumorigenesis risks, and improving the survival rate and clinical feasibility of cell transplantation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121780445B_ABST
    Figure CN121780445B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering and cell biology, and particularly relates to a universal human induced pluripotent stem cell, PD-L1 The promoter is inserted into a short enhancer sequence, the short enhancer sequence has the characteristics of enhancing the expression of PD-L1 when being differentiated into dopaminergic neural precursor cells or dopaminergic neuron cells, and the short enhancer sequence is selected from any one of TSE012, TSE026, TSE053, TSE075 and TSE089. The present application also relates to a ready-to-use mDAP / mDA cell and application, has cell type-specific immune escape, only when the cell is differentiated into mDAP / mDA, the expression of immune rejection genes PD-L1 and CTLA4 is started, has little influence on genomic stability, and in-situ activation of gene expression is realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and cell biology, and more specifically to the field of human induced pluripotent stem cell technology, particularly universal human induced pluripotent stem cells, ready-to-use mDAP / mDA cells and their applications. Background Technology

[0002] Human pluripotent stem cells (iPSCs) hold immense potential in cell replacement therapy for degenerative diseases, particularly tissue cell transplantation derived from iPSCs, which promises to address donor shortages. However, immune rejection remains a significant obstacle to the clinical application of such therapies (Yamanaka S. Pluripotent stem cell-based cell therapy—promise and challenges. Cell StemCell, 2020, 27:523-531.). While immunosuppressants can improve graft survival, their numerous side effects—especially the increased risk of serious infections and cancer—undermine the long-term efficacy of transplantation. Therefore, there is an urgent need to develop innovative immune tolerance regimens with fewer side effects to fully realize the therapeutic potential of allogeneic cell therapies.

[0003] Genetic engineering technology has shown promising potential in inducing immune tolerance in differentiation derivatives. This has spurred various innovative strategies, such as replacing the classic HLA-I antigen with ectopic HLA-E expression, combined knockout of HLA-I / II with overexpression of CD47, and blocking immune co-regulatory pathways. Given the crucial role of the interaction between graft cells and the recipient immune system in immune tolerance, targeting co-stimulatory or co-inhibitory pathways is an effective approach to promoting immune tolerance. Cytotoxic T-lymphocyte-associated protein 4 (CTLA4Ig) blocks the major co-stimulatory pathway for T cell activation by competitively binding to CD80 and CD86 with CD28 (Adams AB, et al. Costimulation Blockade in Autoimmunity and Transplantation: The CD28 Pathway. J. Immunol., 2016, 197: 2045-2050.). PD-L1, as a ligand of programmed cell death 1 (PD1), is an immune checkpoint that can suppress T cell responses (Fife BT & Bluestone JA Control of peripheral T-cell tolerance and autoimmunity via the CTLA-4 and PD-1 pathways. Immunol. Rev., 2008, 224: 166-182.). These pathways synergistically regulate immune responses and maintain immune homeostasis. Notably, engineered cells constructed by overexpressing CTLA4Ig and PD-L1 in human embryonic stem cells (hESCs) (named CP-hESCs) can effectively avoid allogeneic immune rejection and do not induce systemic immunosuppression (Rong Z., et al. An effective approach to prevent immune rejection of human ESC-derived allografts. Cell Stem Cell, 2014, 14: 121-130.). However, the strategy of comprehensively suppressing immunity with allogeneic cells faces challenges, especially when undifferentiated or immature cells remain in the terminal cell products of human iPS cells. Such an immunization strategy may lead to excessive proliferation of the graft. In addition, the expression of genes such as SURVIVIN, MYC, and E2F2 during differentiation may confer tumorigenic properties to the cells.Therefore, accurately endowing terminally differentiated cells with immune tolerance is the primary consideration for achieving successful allogeneic cell transplantation and therapeutic breakthroughs.

[0004] In recent years, CRISPR genome editing technology has enabled in situ editing-mediated upregulation of gene expression by modifying specific gene promoters. This technology has demonstrated that editing promoter regions can effectively enhance gene expression levels without relying on transgene integration. However, this random promoter editing requires extensive testing and can produce unpredictable results, highlighting the urgent need for a reliable programming method to upregulate gene expression. With advancements in CRISPR-Cas-mediated knock-in technology, precise sequence insertion within the genome is now possible. Therefore, targeting and inserting effective enhancers into gene promoter regions can directly enhance transcription, achieving in situ gene activation and overcoming limitations such as transgene dependence and random promoter editing. Short transcription enhancers suitable for precise knock-in are severely lacking, and research in this area is limited. Therefore, there is an urgent need for short transcription enhancers capable of conferring effective activation capabilities. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by providing a universal human induced pluripotent stem cell, a ready-to-use mDAP / mDA cell, and its applications.

[0006] To achieve the above objectives, the present invention provides a universal human induced pluripotent stem cell (iPSC), the main features of which are: PD-L1 promoters and / or CTLA4 The promoter inserts a short enhancer, which has the property of enhancing the expression of PD-L1 and / or CTLA4 when differentiating into dopaminergic neural progenitor cells or dopaminergic neurons, and the short enhancer is selected from any one of TSE012, TSE026, TSE053, TSE075, and TSE089;

[0007] The nucleotide sequence of TSE012 is as shown in SEQ ID NO. 1 or is at least 90% or at least 95% similar to SEQ ID NO. 1; the nucleotide sequence of TSE026 is as shown in SEQ ID NO. 2 or is at least 90% or at least 95% similar to SEQ ID NO. 2; the nucleotide sequence of TSE053 is as shown in SEQ ID NO. 3 or is at least 90% or at least 95% similar to SEQ ID NO. 3; the nucleotide sequence of TSE075 is as shown in SEQ ID NO. 4 or is at least 90% or at least 95% similar to SEQ ID NO. 4; and the nucleotide sequence of TSE089 is as shown in SEQ ID NO. 5 or is at least 90% or at least 95% similar to SEQ ID NO. 5.

[0008] Better place, PD-L1 The short enhancer sequence is inserted 120 bp upstream of the transcription start site in the promoter region.

[0009] Better place, CTLA4 The short enhancer sequence is inserted 68 bp upstream of the transcription start site in the promoter region.

[0010] Preferably, the sgRNA sequences at the insertion site are as follows:

[0011] Targeting PD-L1 The sgRNA sequence of the promoter region is shown in SEQ ID NO. 6;

[0012] Targeting CTLA4 The sgRNA sequence of the promoter region is shown in SEQ ID NO. 7.

[0013] The present invention also provides a ready-to-use, off-the-shelf dopaminergic progenitor (mDAP) / dopaminergic neuron (mDA) cell, the main feature of which is that it is differentiated from the aforementioned universal human induced pluripotent stem cells.

[0014] The present invention also provides the application of the universal human induced pluripotent stem cells or the ready-to-use mDAP / mDA cells in cell transplantation therapy products.

[0015] The universal human induced pluripotent stem cells of this invention, or the ready-to-use mDAP / mDA cells described herein, have broad application prospects in the following areas:

[0016] Preparation of cell-based drugs: Suitable for the preparation of cell transplantation drugs for the treatment of various genetic and degenerative diseases;

[0017] Tissue-engineered drugs: Drugs used to repair and reconstruct damaged tissues and organs;

[0018] Drug screening and disease models: providing an efficient and stable cell platform for drug development.

[0019] The beneficial effects of the universal human induced pluripotent stem cells, ready-to-use commercial mDAP / mDA cells, and their applications of the present invention are as follows:

[0020] It has an immune escape effect only when cells differentiate into mDAP / mDA cells, avoiding the presence of undifferentiated or immature cells in iPS cell terminal cell products, which could lead to excessive proliferation or tumorigenesis of the graft.

[0021] The selected TSEs are newly identified cell-specific endogenous DNA fragments, providing a new pathway for the specific regulation of gene expression. Attached Figure Description

[0022] Figure 1 This is a schematic diagram of the dual-luciferase reporter vector in Example 1.

[0023] Figure 2 This is an enhanced analysis diagram of the miniCMV by the five TSEs in Example 1.

[0024] Figure 3 This is a graph showing the intensity difference of TSEs at different insertion sites in the PD-L1 and CTLA4 promoters in Example 2.

[0025] Figure 4 This is a diagram showing the enhanced expression effect of TSEs at different base mutation rates in Example 3.

[0026] Figure 5 This is a schematic diagram of the differentiation method of mDAP / mDA in Example 4.

[0027] Figure 6 This is a transcriptional expression diagram of PD-L1 and CTLA4 at different differentiation stages in Example 4.

[0028] Figure 7 This is a diagram showing the protein expression of PD-L1 and CTLA4 at different differentiation stages in Example 4.

[0029] Figure 8 This is a diagram showing the effect of E-mDAP / E-mDA on NK cell proliferation in Example 5.

[0030] Figure 9This is a diagram showing the killing effect of NK cells on the E-mDAP / E-mDA of the present invention in Example 5.

[0031] Figure 10 This is a diagram showing the effect of E-mDAP / E-mDA on T cell proliferation in Example 6.

[0032] Figure 11 This is a diagram illustrating the killing effect of T cells on the E-mDAP / E-mDA of the present invention in Example 6. Detailed Implementation

[0033] To further understand the present invention, preferred embodiments of the present invention are described below in conjunction with examples. However, it should be understood that these descriptions are only for further illustrating the features and advantages of the present invention, and not for limiting the scope of the claims.

[0034] This invention utilizes genetically engineered iPS cells to... PD-L1 promoters and CTLA4 Endogenous specific short enhancers (TSEs) are inserted upstream of the promoter transcription start site to increase their expression in target mDAP / mDA cells, thereby achieving immune rejection of NK cells and T cells, improving the survival rate of transplanted cells and clinical feasibility.

[0035] In this invention, mDAP / mDA cells refer to either mDAP cells or mDA cells.

[0036] This invention screens cell-specific short enhancers using the following method:

[0037] It has the property of specifically enhancing expression in mDA;

[0038] Insertion of the TSE fragment and its highly similar (≥90.0%) fragments upstream of the target gene promoter can significantly enhance its expression.

[0039] This invention prepares mDAP / mDA cells with immune rejection function using the following method:

[0040] Using gene editing technology, the selected TSEs were homologously recombinated and inserted upstream of the PD-L1 and CTLA4 transcription start sites to construct engineered iPS cells;

[0041] Engineered iPS cells were induced to differentiate into mDAP / mDA cells, and the in situ activation of PD-L1 and CTLA4 expression by TSE was detected.

[0042] The sgRNAs used in gene editing are as follows:

[0043] Targeting PD-L1The sgRNA sequence of the promoter region is: gcttccgccgatttcaccga (SEQ ID NO. 6);

[0044] Targeting CTLA4 The sgRNA sequence of the promoter region is: tttgttcagttgagtgcttg (SEQ ID NO. 7).

[0045] Example 1

[0046] Combinatorial promoter library construction and high-throughput sequencing

[0047] The differentiation of iPS cells into middapamine neurons (mDA) mainly involves several key stages, including neuroectoderm, mDA progenitor cells, middapamine neuronal progenitors (mDAP), and mature dopaminergic neurons (mDA). Based on spatiotemporal expression data of genes during the iPS cell-induced differentiation into mDA / mDAP (https: / / www.ncbi.nlm.nih.gov / sra), 118 mDA / mDAP-specific strongly expressed genes were identified. Subsequently, the 820 bp upstream of the transcriptional start site (TSS) of each gene promoter sequence was divided into 10 segments of 100 bp each, with a 20 bp overlap between segments. Finally, 1180 candidate mDA cell-specific transcriptional enhancers (TSEs) were obtained, and the putative enhancers TSEs were cloned to 62. The enhanced version is located upstream of the miniCMV minimal promoter of human cytomegalovirus (CMV), a short synthetic 5' untranslated region (UTR), and the firefly luciferase reporter gene, along with a 9 bp random barcode; CMV Startup driver nLUC The nanoluciferase gene is used as an internal reference gene, specifically as follows: Figure 1 As shown.

[0048] mDA cells were transiently transformed using electroporation. After culturing for 12-16 h, positive cells were collected, total RNA was extracted, and reverse transcribed into cDNA. Barcode-encoded cDNA libraries and corresponding plasmid libraries were amplified and sequenced using high-throughput sequencing (NGS, Illumina HiSeq, PE150). NGS reads were classified based on sequence barcoding, and sequenced reads were merged and counted. Since random control sequences theoretically have no transcriptional enhancement effect, their enhancement baseline was set to 1. Therefore, the fold change mediated by each short transcription enhancer (TSE) was calculated using the following formula:

[0049] Activity TSE =Ratio TSE-cDNA / Ratio TSE-DNA

[0050] like Figure 2 As shown, after analysis, a total of 5 relatively strong TSEs were selected, namely:

[0051] TSE012 (ggtgaacgcagagcggttcccaccttaaaatcggccctgctcgtgacgtcaggtcggaaatataccaaagcgagcgcgggccaggagtccagggagcgcg, SEQ ID NO. 1);

[0052] TSE026 (cgagtgtcagcgcgagtcccggctcgccattggctccgcacacgtgcggccctgactcacgtgcttccggtttgaaggcaaaaagtgtgcctgggtgatt, SEQ ID NO. 2);

[0053] TSE053 (aagtgcaggcttactttggggctgccttcaggggcaggaggctgtgtgcaatgcaggcatcacctggtgcagggctggaacatatcagatgacttaatgg, SEQ ID NO. 3);

[0054] TSE075 (cccgcgtggaaggcgcccgtctagatccgcgacgtctcggaccccccaggcccccgcaccccgtgtccgaggctccgggacgcgcaggacagtggagccgt, SEQ ID NO. 4);

[0055] TSE089 (ttcttggcgtctcgccggccagacccctccctcaaaggcggggcctggagatccacagctggaaagggcggagccccagcagggcagctggaaaggggcg, SEQ ID NO. 5).

[0056] Five strong TSEs increased miniCMV expression by 15.6–42.3 times.

[0057] Example 2

[0058] TSEs Insertion Position Analysis

[0059] The five TSE sequences (TSE012, TSE026, TSE053, TSE075, and TSE089) obtained in Example 1 were inserted respectively. PD-L1 and CTLA4 Different locations of the promoter, such as Figure 1 As shown, it is integrated into a bimolecular luciferase carrier ( fLUC Upstream, driving fLUC Expression. mDA cells were transiently transformed by electroporation. After culturing for 12-16 h, positive cells were collected, total RNA was extracted, reverse transcribed into cDNA, and qPCR analysis was performed to identify TSE insertions. PD-L1 and CTLA4 Enhancement effect at different positions of the promoter.

[0060] like Figure 3 As shown, the experimental results indicate that the insertion site is at... PD-L1 -120 bp upstream of the promoter TSS CTLA4 The enhancement effect is best at -68 bp upstream of the promoter TSS.

[0061] Example 3

[0062] TSE sequence mutation analysis

[0063] To analyze the uniqueness of the enhancement effect of TSEs, the short enhancer sequences TSEs obtained in Example 1 were randomly mutated, with mutation rates controlled at 5.0%, 10.0%, and 15.0%. Ten different mutations were randomly selected from each mutation rate range and integrated upstream of the bimolecular luciferase vector miniCMV to drive fLUC expression. Wild-type TSEs were used as a control to compare and analyze the effect of base mutations on the enhancement effect of TSE expression.

[0064] The results are as follows Figure 4As shown, for all five screened TSEs, the proportion of outliers was >15% when the base mutation rate was greater than 10.0%. This indicates that when the base mutation rate was greater than 10.0%, the enhancement effect of the mutated TSEs was significantly different from that of the wild-type TSEs. That is, when the TSE mutation rate was ≤10.0%, the enhancement effect was similar to that of the wild-type.

[0065] Example 4

[0066] TSEs Transfection into iPS Cells and Expression Analysis

[0067] according to PD-L1 and CTLA4 The promoter sequence was used to design a guide sgRNA using CHOPCHOP (https: / / chopchop.cbu.uib.no / ), where sgRNA1: gcttccgccgatttcaccga (SEQ ID NO. 6) targets PD-L1 120 bp upstream of the promoter TSS; sgRNA2: tttgttcagttgagtgcttg (SEQ ID NO. 7) targets CTLA4 The promoter is located 68 bp upstream of the TSS.

[0068] Using the CRISPR / Cas9 system, iPS cells were transformed via electroporation via homologous recombination to integrate five DNA fragments—TSE012, TSE026, TSE053, TSE075, and TSE089—into cells. PD-L1 and CTLA4 Promoter location. Flow cytometry sorts positively transformed cells, and PCR identifies and screens TSEs that are simultaneously integrated into the promoter. PD-L1 and CTLA4 The double-positive promoter was used to transform pure iPS cells for further analysis.

[0069] Using unengineered iPS cells as a control, and positive pure line iPS cells, differentiation was induced to mDAP / mDA cells. The differentiation procedure followed the experimental steps of iPSC differentiation into mDAP / mDA in Chinese Invention Patent ZL202311783763.3: Step 1 (days 0-10): iPSCs were induced to differentiate into midbrain neural progenitor cells, i.e., mDA neural progenitor cells, using mDA neural progenitor cell induction medium for 10 days. The mDA neural progenitor cell induction medium mainly consisted of the following components: neural basal medium (NB), 1×N2 supplement, 1×B27 supplement without vitamin A, 2mM L-glutamine, 10µM SB431542, 250nM LDN193189, CHIR99021 (D0-D3, 0.7µM; D4-D9, 7.5µM), 1µM SAG, and 10µM Y27632. The specific components of the mDA neural progenitor cell induction medium need to be adjusted according to different time stages. Figure 5 Adjustments are shown below. The second step (days 11-15) involves culturing mDA neural progenitor cells for 5 days using mDA neural progenitor cell induction medium to promote differentiation towards mDAP. The mDAP induction medium mainly consists of the following components: NB, vitamin A-free B27 supplement, 2mM L-glutamine, 20ng / ml BDNF, 20ng / ml GDNF, 0.2mM ascorbic acid, 1ng / ml TGF-β3, 0.5mM cAMP, 10µM DAPT, 3µM CHIR99021, and 10µM PY-60. The specific components of the mDAP induction medium need to be adjusted according to the different time stages. Figure 5 Adjustments are shown below. In the third step (days 16-25), after obtaining mDAP, continue adding mDA maturation medium, changing the medium every two and a half days to promote further differentiation and maturation of mDAP into mDA neurons. The mDA maturation medium mainly consists of the following components: NB, vitamin A-free B27 supplement, 2mM L-glutamine, 20ng / ml BDNF, 20ng / ml GDNF, 0.2mM ascorbic acid, 1ng / ml TGF-β3, and 0.5mM cAMP. Cells cultured to day 15 are mDAP; cells cultured to day 25 are mDA.

[0070] mDAP cells were collected on day 0, day 3, day 7, day 15, and day 25 mDA cells, and total RNA was extracted and reverse transcribed into cDNA (PrimeScript™ RT reagent Kit with gDNA Eraser, Takara). Quantitative primers were designed. PD-L1qPD-L1-F :5'-gccccataccgcaaaatca-3', SEQ ID NO. 8; qPD-L1-R : 5'-accctcagactgctggtcacat-3', SEQ ID NO. 9) ( CTLA4qCTLA4-F :5'-cccaacagagccagaatgtg-3', SEQ ID NO. 10; qCTLA4-R : 5'-acacgtaatttgggttccgc-3', SEQ ID NO. 11), to β-Actin For internal reference gene ( qActin-F : 5'- actcttccagccttccttcc -3', SEQ ID NO. 12; qActin-R : 5'- cgtacaggtctttgcggatg -3', SEQ ID NO. 13), analysis PD-L1 and CTLA4 Expression changes at different differentiation stages. Results are as follows: Figure 6 As shown, iPS cells with inserted enhancing TSE sequences showed significantly higher expression levels of mDAP / mDA compared to other differentiation stages. 。

[0071] Simultaneously, ELISA analysis was performed on changes in PD-L1 (PathScan® Total PD-L1 ELISA Kit) and CTLA4 (Elabscience pre-coated kit), and the results are as follows: Figure 7 As shown, TSE sequences were inserted into the promoter, and the levels of PD-L1 and CTLA4 proteins were significantly higher during the mDAP / mDA stage than during other differentiation stages.

[0072] Example 5

[0073] Experiment on E-mDAP / E-mDA cells evading NK cell killing in this invention

[0074] NK cells were isolated from peripheral blood mononuclear cells (PBMCs) using immunomagnetic beads. The NK cell sorting kit (EasySep™ Human NK Cell Isolation Kit) was used according to the manufacturer's recommended procedures. The isolated NK cells were cultured in RPMI 1640 medium supplemented with 10% FBS and 50 U / mL IL-2. The isolated NK cells were co-cultured with the engineered mDAP / mDA (E-mDAP / E-mDA) of this invention at ratios of 1:1, 3:1, and 10:1. The E-mDAP / E-mDA used in this example was engineered according to the method described in Example 4 and integrated into… PD-L1 and CTLA4 The specific TSEs at the corresponding promoter position are TSE012, with wild-type iPS-induced differentiation of mDAP / mDA as the control.

[0075] NK cell proliferation was measured using the CCK8 assay. A specific amount of CCK8 reagent was added daily, and the cells were incubated for 30 minutes. Changes in absorbance at 450 nm were detected using a microplate reader, and growth curves were plotted. Results are as follows: Figure 8 As shown, there was no significant difference in the proliferation of NK cells when cultured alone and in co-culture, indicating that the E-mDAP / E-mDA of the present invention does not activate NK cells.

[0076] Lactate dehydrogenase (LDH) release assay was used to detect iPSC cell death. For this purpose, the supernatant sample after co-culture was transferred to 96-well plates, and an equal volume of CytoTox 96® reagent was added to each well. Incubation was performed for 30 minutes. Stop solution was added, and the absorbance signal at 490 nm was measured using a microplate reader. The amount of LDH released was used to determine whether iPSCs could effectively evade NK cell killing. Figure 9 It can be seen that, compared with the control of NK cells co-cultured with wild-type iPS-induced differentiation mDAP / mDA, the LDH release of the E-mDAP / E-mDA cells of the present invention co-cultured with NK cells is not significantly different from the LDH release of the E-mDAP / E-mDA cells of the present invention cultured alone, indicating that the E-mDAP / E-mDA of the present invention can evade NK cell killing.

[0077] Example 6

[0078] The E-mDAP / E-mDA cells of this invention are able to evade T cell killing.

[0079] T cells were isolated from peripheral blood mononuclear cells (PBMCs) using immunomagnetic beads. The T cell sorting kit was used following the manufacturer's recommended procedures.

[0080] The isolated T cells were cultured in RPMI 1640 medium supplemented with 10% FBS and 50 U / mL IL-2. The T cells were co-cultured with the universal mDAP / mDA (E-mDAP / E-mDA) of this invention at ratios of 1:1, 3:1, and 10:1. The E-mDAP / E-mDA used in this example was modified according to the method described in Example 4 and integrated into... PD-L1 and CTLA4 The specific TSEs at the corresponding promoter position are TSE012. mDAP / mDA induced by wild-type iPS served as a control.

[0081] T cell proliferation was measured using the CCK8 assay. A specific amount of CCK8 reagent was added to the culture medium daily, and the cells were incubated for 30 minutes. The absorbance at 450 nm was measured using a microplate reader, and an absorbance-growth curve was plotted. Results are as follows: Figure 10 As shown, the proliferation of T cells co-cultured with the E-mDAP / E-mDA of the present invention was not significantly different from that of T cells cultured alone, proving that the E-mDAP / E-mDA of the present invention does not activate T cells.

[0082] The killing effect of T cells on the E-mDAP / E-mDA cells of this invention was detected using an LDH release assay. The supernatant sample after co-culture was transferred to a 96-well plate, an equal volume of CytoTox 96® reagent was added, and incubation was performed for 30 minutes. After adding stop solution, the absorbance at 490 nm was measured using a microplate reader. The amount of LDH released was used to determine whether the universal mDAP / mDA could effectively evade T cell killing. Figure 11 The results showed that, compared with the control group of mDAP / mDA cells induced to differentiate from wild-type iPS cells, the LDH release of the E-mDAP / E-mDA cells of the present invention co-cultured with T cells was not significantly different from the LDH release of the E-mDAP / E-mDA cells of the present invention cultured alone, proving that the E-mDAP / E-mDA cells of the present invention can evade T cell killing.

[0083] The above embodiments demonstrate that the universal human induced pluripotent stem cells and ready-to-use mDAP / mDA cells provided by this invention have cell type-specific immune escape: the screened TSEs are mDAP / mDA cell-specific enhancers that initiate the expression of immune rejection genes PD-L1 and CTLA4 only when the cells differentiate into mDAP / mDA; the TSEs are derived from the endogenous cells and are short in length, inserting into the promoter region, having little impact on genome stability, and achieving in situ activation of gene expression.

[0084] In this specification, the invention has been described with reference to specific embodiments thereof. However, it will be apparent that various modifications and variations can be made without departing from the spirit and scope of the invention. Therefore, this specification should be considered illustrative rather than restrictive.

Claims

1. A universal human induced pluripotent stem cell, characterized in that, PD-L1 The promoter inserts a short enhancer sequence, wherein the short enhancer sequence has the property of enhancing PD-L1 expression when differentiating into dopaminergic neural progenitor cells or dopaminergic neuronal cells, and the short enhancer sequence is selected from any one of TSE012, TSE026, TSE053, TSE075, and TSE089; The nucleotide sequence of TSE012 is as shown in SEQ ID NO. 1 or is at least 90% similar to SEQ ID NO. 1; the nucleotide sequence of TSE026 is as shown in SEQ ID NO. 2 or is at least 90% similar to SEQ ID NO. 2; the nucleotide sequence of TSE053 is as shown in SEQ ID NO. 3 or is at least 90% similar to SEQ ID NO. 3; the nucleotide sequence of TSE075 is as shown in SEQ ID NO. 4 or is at least 90% similar to SEQ ID NO. 4; and the nucleotide sequence of TSE089 is as shown in SEQ ID NO. 5 or is at least 90% similar to SEQ ID NO.

5.

2. The universal human induced pluripotent stem cell according to claim 1, characterized in that, PD-L1 The short enhancer sequence is inserted 120 bp upstream of the transcription start site in the promoter region.

3. The universal human induced pluripotent stem cell according to claim 1, characterized in that, The sgRNA sequence at the insertion site is as follows: Targeting PD-L1 The sgRNA sequence of the promoter region is shown in SEQ ID NO.

6.

4. The universal human induced pluripotent stem cell according to any one of claims 1 to 3, characterized in that, PD-L1 promoters and CTLA4 The promoter is inserted into the short enhancer sequence, which has the property of enhancing the expression of PD-L1 and CTLA4 when differentiating into dopaminergic neural progenitor cells or dopaminergic neurons.

5. The universal human induced pluripotent stem cell according to claim 4, characterized in that, CTLA4 The short enhancer sequence is inserted 68 bp upstream of the transcription start site in the promoter region.

6. The universal human induced pluripotent stem cell according to claim 4, characterized in that, The sgRNA sequence at the insertion site is as follows: Targeting CTLA4 The sgRNA sequence of the promoter region is shown in SEQ ID NO.

7.

7. A ready-to-use, off-the-shelf mDAP / mDA cell line, characterized in that, It is derived from the universal human induced pluripotent stem cells according to any one of claims 1 to 6.

8. The use of the ready-to-use, off-the-shelf mDAP / mDA cells as described in claim 7 in the preparation of cell transplantation therapeutic products.