Application of ycgH gene in controlling yield of hydroxytyrosol produced by fermentation of bacillus licheniformis

By knocking out the ycgH gene in Bacillus licheniformis and introducing hpaB and hpaC gene expression vectors, the problem of low hydroxytyrosol extraction rate in traditional methods was solved, and the yield of hydroxytyrosol was significantly improved.

CN121780562APending Publication Date: 2026-04-03HUBEI UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-31
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Traditional methods for obtaining hydroxytyrosol suffer from problems such as low extraction rate, complex process, seasonality, and use of toxic reagents. Furthermore, no studies have been reported on the correlation between ycgH in Bacillus subtilis and hydroxytyrosol.

Method used

By knocking out or inhibiting the ycgH gene in Bacillus licheniformis, and using CRISPR gene editing technology in combination with hpaB and hpaC gene expression vectors, the production of hydroxytyrosol was increased.

Benefits of technology

This study significantly increased the yield of hydroxytyrosol from Bacillus licheniformis by at least 26.4%, providing a novel strategy for the efficient synthesis of hydroxytyrosol by microorganisms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
Patent Text Reader

Abstract

The invention belongs to the technical field of genetic engineering and microorganisms, and discloses application of a ycgH gene in controlling the yield of bacillus hydroxytyrosol. According to the method, a molecular biological technology is adopted, a ycgH gene is knocked out from bacillus licheniformis, a bacillus licheniformis engineering strain DW-10-ycgH with the deletion of the ycgH is obtained, and hydroxylase HpaBC coding genes hpaB and hpaC are introduced into the constructed tyrosol strain DW-10-ycgH, so that the synthesis of hydroxytyrosol can be realized. The hydroxytyrosol yield of the obtained DW-10-ycgH / pHY-P43-hpaBC is increased by at least 26.4% compared with that of a control strain. The technology is successfully applied to fermentation production of hydroxytyrosol, and a new thought is provided for improving the production level of metabolites.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and microbial technology, specifically relating to the application of the ycgH gene in controlling the yield of hydroxytyrosol produced by Bacillus licheniformis fermentation. Background Technology

[0002] Hydroxytyrosol (3,4-dihydroxyphenylethanol) is one of the most abundant natural phenolic antioxidants found in olives and their processing byproducts such as olive leaves and olive oil pomace. Its antioxidant capacity is significantly superior to common antioxidants such as vitamin C and vitamin E, primarily due to its catechol (catechol) structure, which efficiently scavenge free radicals and inhibit lipid peroxidation. Numerous studies have demonstrated that hydroxytyrosol possesses a wide range of biological activities, including anti-inflammatory, anticancer (e.g., inducing tumor cell apoptosis and inhibiting angiogenesis), antibacterial, antiviral, neuroprotective, and cardiovascular protective effects. Based on solid scientific evidence, the European Food Safety Authority has approved a health claim regarding the protection of low-density lipoprotein (LDL) from oxidative damage by olive oil polyphenols (in the form of hydroxytyrosol and its derivatives). Furthermore, it has been designated as "generally considered safe" by the US FDA and is widely used in functional foods, dietary supplements, cosmetics, and pharmaceuticals.

[0003] However, traditional methods for obtaining hydroxytyrosol face significant challenges. Plant extraction (typically extracting its precursor oleuropein from olive leaves or olive oil processing waste, followed by acid or enzymatic hydrolysis) uses natural raw materials, but suffers from low extraction rates (usually <1%), complex processes, seasonal limitations, and the extensive use of organic solvents. Chemical synthesis involves multiple reactions, uses toxic reagents (such as boranes and boron tribromide), poses safety and environmental risks, and makes controlling the optical purity of the product difficult, thus failing to meet the principles of green chemistry.

[0004] Currently, there are no studies on the correlation between ycgH and hydroxytyrosol in Bacillus. This application, using Bacillus licheniformis as an example, found that knocking out ycgH in Bacillus licheniformis can significantly increase the yield of hydroxytyrosol, which has important scientific research significance and application value in the high-yield production of hydroxytyrosol in Bacillus. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the ycgH gene in controlling the yield of hydroxytyrosol produced by Bacillus licheniformis fermentation.

[0006] To achieve the above objectives, the present invention adopts the following technical measures:

[0007] The application of the ycgH gene in controlling the production of hydroxytyrosol by Bacillus licheniformis fermentation, wherein the protein encoded by the ycgH gene is shown in SEQ ID NO.2, and the Bacillus licheniformis is a strain capable of producing hydroxytyrosol.

[0008] The above-described application specifically involves increasing the production of hydroxytyrosol by knocking out or inhibiting the ycgH gene, resulting in its non-expression or low expression in Bacillus licheniformis.

[0009] In the above-described applications, preferably, the knockout is performed using homologous recombination or CRISPR gene editing methods, and the protein translated from the knocked-out gene has no original function or cannot be translated into a protein.

[0010] In the above-described applications, preferably, the Bacillus licheniformis is obtained by transfecting the hpaB and hpaC gene expression vector pHY-P43-hpaBC into Bacillus licheniformis DW-10.

[0011] The scope of protection of this invention also includes:

[0012] In the preferred embodiment of the above-described application, the process involves microbial fermentation of Bacillus licheniformis with the ycgH gene knocked out or inhibited. The fermentation medium used in the fermentation process is as follows: sucrose 40-60 g / L, peptone 3-10 g / L, yeast extract 1-5 g / L, NaCl 8-12 g / L, dipotassium hydrogen phosphate 17-19 g / L, potassium dihydrogen phosphate 4-6 g / L, A5 mix 0.5-1.5 ml / L, pH 6.5-7.5.

[0013] In the above-described applications, the preferred fermentation medium is:

[0014] Sucrose 50 g / L, peptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L, dipotassium hydrogen phosphate 18.6 g / L, potassium dihydrogen phosphate 5.2 g / L, A5 mix 1 ml / L (boric acid 2.86 g / L, manganese chloride tetrahydrate 1.81 g / L, zinc sulfate heptahydrate 0.22 g / L, sodium molybdate 0.39 g / L, copper sulfate pentahydrate 0.08 g / L, cobalt nitrate hexahydrate 0.05 g / L), sterilized at 115℃ for 20 min, pH 7.0.

[0015] Compared with the prior art, the present invention has the following advantages:

[0016] This study significantly increased the hydroxytyrosol production of Bacillus licheniformis by deleting the ycgH gene. The results indicate that deleting the ycgH gene is a highly effective method for enhancing the ability of microorganisms to synthesize hydroxytyrosol. The Bacillus licheniformis DW-10-△ycgH / pHY-P43-hpaBC obtained using the method provided in this invention showed at least a 26.4% increase in hydroxytyrosol production under different fermentation media. This study provides a novel strategy for high-yield hydroxytyrosol production from sucrose by microorganisms. Attached Figure Description

[0017] Figure 1 Schematic diagram of HPLC detection results for hydroxytyrosol;

[0018] Where: A is a schematic diagram of the HPLC detection results of hydroxytyrosol standard, and B is a schematic diagram of the HPLC detection results of fermentation samples of engineered strains. Detailed Implementation

[0019] The present invention will be further illustrated by the following examples, but these should not be construed as limiting the scope of the invention. The content disclosed in this invention can be improved simultaneously in terms of materials, methods, and reaction conditions; all such improvements should fall within the spirit and scope of this invention. Unless otherwise specified, the technical solutions described in this invention are conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all derived from commercial sources.

[0020] Example 1:

[0021] Construction of Bacillus licheniformis ycgH knockout vector

[0022] Step 1: Based on the upstream and downstream sequences of the ycgH gene (the gene sequence is shown in SEQ ID NO.1, and the protein encoded by the ycgH gene is shown in SEQ ID NO.2) in the genomic DNA sequence of Bacillus licheniformis DW2 (CN117402802A), primers for the upstream homologous arm of the ycgH gene (AF and AR) and primers for the downstream homologous arm (BF and BR) were designed. Using the genomic DNA of Bacillus licheniformis DW2 as a template, PCR amplification was performed using the primers for the upstream and downstream homologous arms of the ycgH gene to obtain the upstream homologous arm (500 bp) (upper homologous arm sequence is SEQ ID NO.3) and the downstream homologous arm (500 bp) (lower homologous arm sequence is SEQ ID NO.4) of the ycgH gene.

[0023] The sequences of AF, AR, BF, and BR are as follows:

[0024] AF: AACGAATTCCTGCAGCCCaatgtcaaaagcaaaagacttgtca

[0025] BR:cagcgagaacaagcaccgcgtttcaacccctctaaa

[0026] BF:tttagaggggttgaaacgcggtgcttgttctcgctg

[0027] BR:GATCTTTTCTACGAGCTCtttttgtgggacttggccatgt.

[0028] Step 2: The upstream and downstream homologous arms of the ycgH gene are ligated together by overlap extension PCR (primers AF and BR are used) to form the target gene fragment.

[0029] Step 3: The above fusion fragment and the T2(2)-Ori plasmid backbone were ligated using Gibison and transformed into E. coli DH5α. The transformation product was plated on LB solid medium containing kanamycin resistance and cultured at 37℃ for 18 h. Transformants were picked from the LB solid medium, and the plasmids of the transformants were verified by colony PCR (primers used: T2-F and T2-R). If the PCR verification result of the transformant showed an electrophoretic band at 1295 bp, it indicated that the integration expression vector was successfully constructed, and the above transformant was a positive transformant, named the knockout vector T2(2)-△ycgH.

[0030] T2-F: ATGTGATAACTCGGCGTA

[0031] T2-R: GCAGAGCAGCAGATTACGC.

[0032] Example 2:

[0033] Construction of ycgH gene knockout strain:

[0034] Step 1: The recombinant vector T2(2)-ycgH was transformed into competent cells prepared from Bacillus licheniformis DW-10 (CN114874960A). After incubation for three hours, the cells were plated on solid medium containing kanamycin and cultured at 37°C for 36 hours. Positive transformants were screened, and plasmids from the transformants were selected for colony PCR verification (primers used: T2-F and T2-R). If the PCR verification result of the transformant showed an electrophoretic band at 1295 bp, it proved that the knockout expression vector T2(2)-ycgH was successfully transformed into Bacillus licheniformis DW-10.

[0035] Step 2: The positive transformants obtained in Step 1 were transferred and cultured three times at 45°C on a medium containing kanamycin, each time for 12 hours, and then diluted 10⁻⁶. 6 The samples were coated with a mixture of primers T2-F and ycgH-YR and incubated at 37°C for 12 h. Single-exchange strains were detected by colony PCR using primers T2-F and ycgH-YR.

[0036] The sequences of primers ycgH-YF and ycgH-YR are as follows:

[0037] ycgH-YF:aatccggtaacagcttctgcagcatg

[0038] ycgH-YR:agagcctggtcaaggcgaagga.

[0039] Step 3: The strains showing a 1446 bp band in the PCR test obtained in Step 2 are considered single-crossover strains. A single colony of one of these single-crossover strains is inoculated into liquid LB medium and cultured at 37°C in a kanamycin-free medium for several subcultures. Transformants are then selected for colony PCR verification (primers are ycgH-YF and ycgH-YR). If the PCR verification result of the transformant is: an electrophoretic band at 2397 bp, it indicates a gene reversion mutation, and the transformant is *Bacillus licheniformis* DC5; if an electrophoretic band at 1397 bp, it indicates successful ycgH gene knockout. Further verification is then performed using DNA sequencing on the positive transformants, yielding a double-crossover ycgH knockout strain, namely *Bacillus licheniformis* DW-10-△ycgH.

[0040] Example 3:

[0041] Construction of the hydroxytyrosol engineered strain DW-10-△ycgH / pHY-P43-hpaBC:

[0042] To achieve the synthesis of hydroxytyrosol, the hydroxylase HpaB and HpaC encoding genes from E. coli were heterologously introduced into DW-10-△ycgH, with DW-10 as the control strain. The hpaB and hpaC gene expression vectors pHY-P43-hpaBC (Zhan, Y., Zhou, F., Ruan, W., Yin, H., Li, Z., Wang, H., Li, T.,Cai, D., Yang, S., Ma, X., & Chen, S. Systematic metabolic engineering of Bacillus licheniformis for hyperproduction of the antioxidant hydroxytyrosol.2023. Green Chemistry, 25(21), 8718–8729) were electroporated into competent cells of DW-10-ΔycgH and DW-10. After incubation for three hours, the cells were plated on solid medium containing tetracycline hydrochloride and cultured at 37°C for 36 hours. Single colonies were picked and colony PCR was performed using primers pHY300plk-yf and pHY300plk-yr for verification. The obtained band size was 2992 bp, which was a positive transformant. The transformants were named DW-10-△ycgH / pHY-P43-hpaBC and DW-10 / pHY-P43-hpaBC.

[0043] pHY300plk-yf: CCTCTCGGTTATGAGTTAGTTCAA

[0044] pHY300plk-yr:TCAAAGAGTTGGTAGCTCAGAGA.

[0045] Example 4:

[0046] Application of Bacillus licheniformis DW-10-△ycgH / pHY-P43-hpaBC in high-yield hydroxytyrosol production:

[0047] Seed fermentation: Activated Bacillus licheniformis DW-10-△ycgH / pHY-P43-hpaBC and DW-10 / pHY-P43-hpaBC were picked from plates and inoculated into 250 mL Erlenmeyer flasks containing 50 mL of liquid LB. The flasks were incubated at 37°C and 230 rpm for 12 h. Subsequently, 2% (v / v) of the inoculum was added to fermentation medium, with 50 mL of fermentation medium in each 250 mL Erlenmeyer flask.

[0048] The applicant selected nine culture medium formulations for the fermentation medium, numbered 1-9 as hydroxytyrosol fermentation medium (Table 1). In addition to the components listed in Table 1, each culture medium contains 10 g / L NaCl, 18.6 g / L dipotassium hydrogen phosphate, 5.2 g / L potassium dihydrogen phosphate, 1 ml / L A5 mix, and pH 7.0.

[0049] Table 1. Culture medium formulations for hydroxytyrosol fermentation

[0050]

[0051] The culture conditions were 37℃, 230 rpm for 72 h, and the yield of hydroxytyrosol was measured after fermentation.

[0052] The method for determining hydroxytyrosol is as follows:

[0053] Sample pretreatment: The fermentation broth was diluted with water to an appropriate ratio, centrifuged at 12000 rpm for 5 min to remove bacterial cells, and 1 mL of the supernatant was filtered through a 0.22 μm aqueous filter membrane for high-performance liquid chromatography (HPLC) detection. Detection conditions were as follows: a Hypersil ODS2 C18 column (5 μm, ID 4.6 mm * 250 mm) was used; the detection wavelength was 224 nm; the injection volume was 10 μL; the mobile phase was a 1:4 ratio of 100% methanol and 1 / 1000 formic acid aqueous solution; the flow rate was 1 mL / min; and the hydroxytyrosol content in the fermentation broth was calculated using a standard curve prepared with hydroxytyrosol standards.

[0054] The applicant also measured the yield of hydroxytyrosol in the aforementioned culture media numbered 1-9. Table 2 shows that, under the same seed fermentation and production fermentation conditions, the use of *Bacillus licheniformis* DW-10-△ycgH / pHY-P43-hpaBC of this invention significantly improved the strain's ability to synthesize tyrosol, with an increase ranging from a minimum of 26.4% to a maximum of 36.3%. The technical solution of this invention has significant scientific research value and application value in the high-yield production of hydroxytyrosol by *Bacillus*.

[0055] Table 2 Comparison of hydroxytyrosol production by Bacillus licheniformis DW-10 / pHY-P43-hpaBC and DW-10-ΔycgH / pHY-P43-hpaBC

[0056]

[0057] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. ycgH The application of genes in controlling the yield of hydroxytyrosol produced by Bacillus licheniformis fermentation, as described above ycgH The protein encoded by the gene is shown in SEQ ID NO.2, and the Bacillus licheniformis strain is capable of producing hydroxytyrosol.

2. The application according to claim 1, wherein the application process includes knockout or inhibition. ycgH Genes that enable Bacillus licheniformis ycgH The gene is not expressed or is expressed at low levels, thereby increasing the production of hydroxytyrosol.

3. In the application according to claim 2, the knockout is performed using homologous recombination or CRISPR gene editing methods, and the protein translated from the knocked-out gene has no original function or cannot be translated into a protein.

4. The application according to claim 1, wherein the Bacillus licheniformis is obtained by transfecting Bacillus licheniformis DW-10. hpaB and hpaC Gene expression vector pHY-P43- hpaBC get.

5. The application according to claim 1, wherein the application process involves knocking out or inhibiting... ycgH The gene-producing Bacillus licheniformis was used for microbial fermentation. The fermentation medium used in the fermentation process was: sucrose 40-60 g / L, peptone 3-10 g / L, yeast extract 1-5 g / L, NaCl 8-12 g / L, dipotassium hydrogen phosphate 17-19 g / L, potassium dihydrogen phosphate 4-6 g / L, A5 mix 0.5-1.5 ml / L, pH 6.5-7.

5.

6. The application according to claim 5, characterized in that, The fermentation medium consisted of: 50 g / L sucrose, 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 18.6 g / L dipotassium hydrogen phosphate, 5.2 g / L potassium dihydrogen phosphate, and 1 ml / L A5 mix.

Citation Information

Patent Citations

  • Bacillus licheniformis for producing tyrosol by fermentation method as well as construction method and application of bacillus licheniformis

    CN114874960A

  • Method for producing ectoine with high yield by bacillus licheniformis for weakening phosphoenolpyruvate carboxykinase gene and application

    CN117402802A