Urine exosome miRNA marker combination for bladder cancer diagnosis and diagnostic kit
By detecting specific miRNA marker combinations in urinary exosomes, the sensitivity and invasiveness issues in bladder cancer diagnosis have been resolved, achieving non-invasive and highly efficient early diagnosis and significantly improving the diagnostic performance of bladder cancer.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-31
- Publication Date
- 2026-04-03
AI Technical Summary
Existing methods for bladder cancer diagnosis lack sensitivity and invasiveness, and there is a lack of non-invasive and efficient early screening methods. Furthermore, blood sample testing is invasive and subject to interference, and changes in miRNA expression in urine are easily masked.
Diagnosis was performed using a specific combination of miRNA markers (hsa_miR-196a-5p, hsa_miR-130b-3p, and hsa_miR-124-3p) from urinary exosomes. A combination of urinary exosome miRNA markers and a detection kit were constructed by designing reverse transcription and detection primers and combining them with the SYBR Green reverse transcription-real-time quantitative PCR method.
It achieves efficient and non-invasive diagnosis of bladder cancer, with high diagnostic efficiency and reliability. The area under the ROC curve is as high as 0.9156, and the sensitivity and specificity are significantly improved, enabling early identification of bladder cancer.
Smart Images

Figure CN121780696A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical detection technology, specifically relating to a combination of urinary exosome miRNA biomarkers and a detection kit for bladder cancer diagnosis. Background Technology
[0002] Bladder cancer (BC) is a malignant tumor originating from the urothelial tissue of the bladder and is one of the most common malignant tumors of the urinary system. Its five-year relative survival rate is closely related to tumor stage: according to 2022 cancer treatment and survival statistics, the survival rate of bladder cancer drops significantly from 79% to 12% from stage I to stage IV. Therefore, early diagnosis is crucial for improving the prognosis of bladder cancer. Traditionally, screening or diagnostic methods for bladder cancer include urine cytology, cystoscopy, and imaging examinations. While urine cytology has high specificity (90%-100%), its sensitivity is low (40%-60%), so it is often used as an adjunct method. Cystoscopy, while providing direct visualization of cancerous lesions, is invasive and carries risks of pain, bleeding, and infection. Imaging examinations can assess tumor size and metastasis, but their sensitivity for early-stage, non-muscle-invasive bladder cancer is limited, often only becoming clear after the tumor has progressed to a certain size, by which time the optimal intervention window has often passed. In summary, existing methods have limitations in terms of sensitivity, invasiveness, or early detection capability, and there is an urgent need to develop new strategies for the diagnosis of bladder cancer that are more efficient, minimally invasive, or non-invasive.
[0003] In recent years, researchers have focused on identifying humoral biomarkers for bladder cancer screening, with the combination of microRNAs (miRNAs) and exosomes showing significant potential. miRNAs are short-chain non-coding RNAs that, while not directly involved in protein coding, regulate messenger RNA expression at the post-transcriptional level, thereby influencing key biological processes such as cell growth, differentiation, inflammatory responses, and even tumorigenesis and development. More importantly, exosomes, as nanoscale vesicles secreted by cells, can encapsulate miRNAs and stably release them into body fluids, effectively protecting them from RNase degradation and maintaining the integrity and functionality of exosomal miRNAs in body fluids. Currently, several miRNAs have been shown to be closely related to the occurrence, progression, and prognosis of bladder cancer.
[0004] However, an ideal product for early bladder cancer screening still lacks clinical application. Existing pan-cancer liquid biopsy products on the market mostly rely on high-throughput sequencing and mutation analysis of circulating tumor DNA, circulating tumor cells, or miRNAs in the blood. Although blood contains systemic molecular information, liquid biopsy using miRNA extraction from blood has significant drawbacks: firstly, blood collection is invasive and causes patient discomfort; secondly, blood samples are prone to coagulation, requiring anticoagulation before further testing, and the anticoagulant itself may affect the test results. Finding a more ideal source of liquid biopsy samples is key to overcoming the current predicament.
[0005] Compared to blood, urine has unique advantages as a sample for bladder cancer screening: First, it is completely non-invasive to obtain, which can greatly improve patient acceptance and screening compliance; second, urine directly contacts and flushes the bladder urothelium, which theoretically can more enrich and directly reflect changes in exosomal miRNAs released by tumors.
[0006] However, RNA in urinary exosomes may originate from bladder tumors, normal urothelium, or be filtered by the glomeruli and secreted by the renal tubules. Therefore, directly detected changes in miRNA expression may reflect local events such as inflammation within the urothelium, thus masking tumor-specific miRNA changes.
[0007] Therefore, accurately screening for highly specific miRNA biomarkers from complex backgrounds is crucial. This requires that the selection process not only examine the expression abundance and differences of miRNAs, but also screen for miRNAs that originate from tumor signaling from a biological function perspective, ensuring their specific association with the pathological process of bladder cancer, thereby ensuring the reliability of their diagnostic efficacy. Summary of the Invention
[0008] To address the shortcomings of the existing technologies, this invention provides a combination of urinary exosome miRNA markers for bladder cancer, along with their reverse transcription primers, detection primers, and detection kits, providing support for the early clinical diagnosis of bladder cancer.
[0009] To achieve the above objectives, the present invention adopts the following technical solution:
[0010] A combination of exosomal miRNA biomarkers for early detection of bladder cancer consists of upregulated hsa_miR-196a-5p and hsa_miR-130b-3p and downregulated hsa_miR-124-3p.
[0011] The miRNAs are derived from urinary exosomes.
[0012] The reverse transcription primers and detection primers for the miRNAs in the bladder cancer exosomal miRNA biomarker combination are as follows:
[0013] (1) Reverse transcription primers and forward detection primers for hsa_miR-196a-5p: The sequences of the reverse transcription primers are shown in SEQ ID No. 1, and the sequences of the forward detection primers are shown in SEQ ID No. 2.
[0014] SEQ ID No.1: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCCAAC -3';
[0015] SEQ ID No.2: 5'-CGCGCGTAGGTAGTTTCATGTT-3';
[0016] (2) Reverse transcription primers and forward detection primers for hsa_miR-130b-3p: The sequences of the reverse transcription primers are shown in SEQ ID No. 3, and the sequences of the forward detection primers are shown in SEQ ID No. 4.
[0017] SEQ ID No.3: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATGCCC -3';
[0018] SEQ ID No. 4: 5'-GCGCAGTGCAATGATGAAA-3';.
[0019] (3) Reverse transcription primers and forward detection primers for hsa_miR-124-3p: The sequences of the reverse transcription primers are shown in SEQ ID No. 5, and the sequences of the forward detection primers are shown in SEQ ID No. 6.
[0020] SEQ ID No.5: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTGGCA -3';
[0021] SEQ ID No.6: 5'-CGTAAGGCACGCGGTGAA-3;
[0022] (4) Universal reverse detection primers for the three miRNAs are shown in SEQ ID No. 7:
[0023] SEQ ID No. 7: 5' - AGTGCAGGGTCCGAGGTATT -3'.
[0024] A kit or biochip for the diagnosis of early bladder cancer, comprising reverse transcription primers and detection primers for the aforementioned miRNA.
[0025] This invention, from a biological function perspective, screened out three different miRNAs that are highly associated with the progression of bladder cancer:
[0026] miR-196a-5p is upregulated in bladder cancer cells. It does not act alone, but is regulated by the long non-coding RNA (lncRNA) UCA1. UCA1 recruits the transcription factor CREB, activating the transcription of miR-196a-5p, leading to its abnormal accumulation in cancer cells. miR-196a-5p targets p27Kip1 (CDKN1B), inhibiting cell cycle arrest, thus enhancing the cells' resistance to apoptosis signals and promoting cancer cell proliferation.
[0027] The expression level of miR-130b-3p is significantly elevated in bladder cancer. This upregulation is one of the initial signals of bladder cancer development. miR-130b-3p prevents the translation of PTEN mRNA by binding to the 3' untranslated region (3'-UTR) of the PTEN gene, leading to a decrease in PTEN protein levels.
[0028] Downregulation of PTEN relieves the inhibition of the PI3K / AKT pathway, leading to phosphorylation (activation) of AKT protein, thereby promoting cell proliferation and inhibiting apoptosis; in addition, the phosphorylation levels of integrin β1 and FAK (focal adhesion kinase) are also significantly increased. These pathways collectively promote the malignant phenotype of cancer cells.
[0029] miR-124-3p affects cell behavior by directly binding to the 3'-UTR region of target genes, inhibiting their translation or causing mRNA degradation. miR-124-3p simultaneously targets two key factors in tumor proliferation and metastasis. It blocks EMT (epithelial-mesenchymal transition) by inhibiting ROCK1, thus suppressing cytoskeleton rearrangement and inhibiting cell migration and invasion. miR-124-3p also inhibits EDNRB, reducing cell cycle-related proteins and inducing cell cycle arrest, thereby promoting apoptosis. In bladder cancer cells (such as T24 and J82), the expression level of miR-124-3p is significantly lower than in normal bladder epithelial cells.
[0030] Furthermore, they independently designed their reverse transcription primers and forward and reverse detection primers.
[0031] The expression abundance of target miRNAs in the urine of bladder cancer patients and controls was verified by SYBR Green reverse transcription-real-time quantitative PCR. Receiver operating characteristic (ROC) curve analysis showed that this panel of urinary exosomal miRNA markers had significantly higher diagnostic performance than single miRNA markers, demonstrating high diagnostic efficiency for bladder cancer and making it suitable for the diagnosis and monitoring of bladder cancer. Attached Figure Description
[0032] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used together with the embodiments of the invention to explain the invention and do not constitute a limitation thereof.
[0033] Figure 1 The expression levels of hsa_miR-196a-5p, hsa_miR-130b-3p, and hsa_miR-124-3p in urinary exosomes of bladder cancer patients compared with healthy controls.
[0034] Figure 2 ROC curves for distinguishing bladder cancer patients from healthy subjects using hsa_miR-196a-5p, hsa_miR-130b-3p, and hsa_miR-124-3p.
[0035] Figure 3 ROC curves for differentiating bladder cancer patients from healthy subjects using a combination of miRNA biomarkers. Detailed Implementation
[0036] To facilitate understanding of the present invention, a more comprehensive description will be provided below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired implementation. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.
[0037] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0038] Example 1: Comparison of expression levels of three miRNAs between bladder cancer patients and healthy patients
[0039] 1. Research Subjects
[0040] Specimens were collected from 30 bladder cancer patients and 30 healthy controls who had excluded urinary tract tumors, with the participants' consent. All bladder cancer patients were newly admitted for treatment, and all urine samples were obtained before any drug or surgical treatment was administered. The staging and pathological type were confirmed by cystoscopy or postoperative pathological examination. A total of 60 subjects were included, and 30 ml of midstream urine was collected from each of them.
[0041] 2. Exosome isolation
[0042] Exosomes were extracted from urine using ultracentrifugation: First, the urine sample was centrifuged at 500g for 5 minutes, and the supernatant was transferred to a new centrifuge tube. The sample was then centrifuged at 2000 × g, 4 °C, for 30 min. The supernatant was transferred to another centrifuge tube and centrifuged again at 10,000 × g, 4 °C, for 45 min to remove larger vesicles. The supernatant was then filtered through a 0.45 μm filter membrane, and the filtrate was collected. The filtrate was transferred to a new centrifuge tube and centrifuged at 4 °C, 100,000 × g, for 90 min. The supernatant was removed, and the exosomes were resuspended in 10 mL of pre-chilled 1×PBS. The resuspended exosomes were then ultracentrifuged again at 4 °C, 100,000 × g, for 90 min. The supernatant was removed, and the exosomes were resuspended in 150 μL of pre-chilled 1×PBS and stored at -80 °C for subsequent experiments.
[0043] 3. Detection of exosomal miRNAs by RT-qPCR
[0044] RNA was extracted using the TRIzol method, and primers for the target RNA were artificially synthesized. The primer sequences of SEQ ID No. 1 to SEQ ID No. 7 in this embodiment are shown in the table below.
[0045] Primer Sequence (5'-3') hsa_miR-196a-5p RT-prime (SEQ ID No.1) GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCCAAC hsa_miR-196a-5p forward primer (SEQ ID No.2) CGCGCGTAGGTAGTTTCATGTT hsa_miR-130b-3p RT-prime (SEQ ID No.3) GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATGCCC hsa_miR-130b-3p forward primer (SEQ ID No.4) GCGCAGTGCAATGATGAAA hsa_miR-124-3p RT primer (SEQ ID No.5) GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTGGCA hsa_miR-124-3p forward primer (SEQ ID No.6) CGTAAGGCACGCGGTGAA Universal reverse primer (SEQ ID No.7) AGTGCAGGGTCCGAGGTATT
[0046] After determining RNA concentration using Nanodrop, cDNA was synthesized using the Hifair® III 1st Strand cDNA Synthesis Kit (gDNA digester plus) reverse transcription kit (Yisheng Company), and then PCR was performed using Hieff® qPCRSYBR® Green Master Mix (Yisheng Company) on a LineGene 9600 Plus real-time quantitative PCR analyzer (Bori Company).
[0047] The qPCR reaction system is configured as follows:
[0048] Component Dosage Hieff® qPCRSYBR®Green Master Mix 10 μL Forward Primerr (10μM) 0.5 μL Reverse Primer (10μM) 0.5 μL Template cDNA x RNase-free H2O to 20 μL
[0049] The reaction conditions were: 95℃ for 30 seconds → 1 cycle; (95℃ for 10 seconds, 60℃ for 30 seconds) → 40 cycles; add a dissolution curve.
[0050] 4. Results processing: Each sample was measured three times, and the Ct (cycle threshold) value was recorded. The relative expression level of miRNA was calculated using 2^(﹣△△Ct).
[0051] The results showed that, compared with the normal control group, the expression levels of hsa_miR-196a-5p and hsa_miR-130b-3p were significantly upregulated in the urinary exosomes of bladder cancer patients, while the expression level of hsa_miR-124-3p was significantly downregulated. Figure 1 As shown, line segments represent the minimum and maximum values, and the top, bottom, and inner bands of the boxes represent the first quartile, third quartile, and median, respectively. The differences were statistically significant (P < 0.005). These results preliminarily confirm the association between the three miRNAs and bladder cancer.
[0052] Example 2: Consistency analysis between miRNA and Panel detection and clinicopathological results
[0053] Based on the detection data of urinary exosomal miRNAs collected from bladder cancer patients and healthy controls in Example 1, and using pathological diagnosis results as the gold standard, ROC curves were plotted for hsa_miR-196a-5p, hsa_miR-130b-3p, and hsa_miR-124-3p, respectively. Figure 2 ).
[0054] Simultaneously, after standardizing and normalizing the expression levels of the three miRNAs, a binary logistic regression analysis was performed to form an integration panel for the three miRNAs. ROC curves were then plotted based on this panel. Figure 3 The ROC curve area under the curve (AUC), sensitivity, specificity and other indicators were calculated.
[0055] The diagnostic performance indicators of single miRNAs as diagnostic markers for bladder cancer are shown in the table below:
[0056]
[0057] The diagnostic performance indicators of the three miRNA combinations as diagnostic markers for bladder cancer are shown in the table below:
[0058]
[0059] The results showed that the area under the ROC curve of the panel composed of hsa_miR-196a-5p, hsa_miR-130b-3p, and hsa_miR-124-3p was as high as 0.9156±0.0498 (95% CI: 0.8811-0.9945), which was significantly higher than the AUC value of any single miRNA. This indicates that the panel has a very strong ability to distinguish between bladder cancer and healthy controls, and has excellent overall diagnostic performance. At the same time, the specificity was 80.00%, the sensitivity was as high as 93.33%, and the positive predictive value and negative predictive value reached 92.31% and 82.35%, respectively, further confirming the high reliability of the panel.
[0060] This fully demonstrates that the panel constructed in this patent based on exosomes hsa_miR-196a-5p, hsa_miR-130b-3p, and hsa_miR-124-3p is not a simple superposition, but rather integrates complementary information from different key biological pathways, effectively overcoming the limitations of a single biomarker and achieving stable, reproducible, and high-precision diagnosis.
[0061] Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents. In conclusion, if those skilled in the art, inspired by this description, design similar structural methods and embodiments without departing from the inventive spirit of the invention, such designs should fall within the protection scope of the present invention.
Claims
1. A combination of urinary exosomal miRNA markers for bladder cancer diagnosis, characterized in that, The combination consists of hsa_miR-210-3p, hsa_miR-25-3p, and hsa_miR-200b-3p.
2. The miRNA biomarker combination according to claim 1, characterized in that, The expression of hsa_miR-196a-5p and hsa_miR-130b-3p was upregulated, while the expression of hsa_miR-124-3p was downregulated.
3. The miRNA biomarker combination according to claim 1, characterized in that, The miRNA was derived from urinary exosomes.
4. A primer set for detecting the miRNA biomarker combination of claims 1-3, characterized in that, include: (1) A reverse transcription primer for hsa_miR-196a-5p, the sequence of which is shown in SEQ ID No. 1; and / or a detection primer for hsa_miR-196a-5p, comprising a forward primer, the sequence of which is shown in SEQ ID No. 2; (2) A reverse transcription primer for hsa_miR-130b-3p, the sequence of which is shown in SEQ ID No. 3; and / or a detection primer for hsa_miR-130b-3p, comprising a forward primer, the sequence of which is shown in SEQ ID No. 4; (3) A reverse transcription primer for hsa_miR-124-3p, the sequence of which is shown in SEQ ID No. 5; and / or a detection primer for hsa_miR-124-3p, comprising a forward primer, the sequence of which is shown in SEQ ID No.
6.
5. The primer set according to claim 3, characterized in that, It also includes a universal reverse detection primer, the sequence of which is shown in SEQ ID No.
7.
6. A reagent kit for bladder cancer diagnosis, characterized in that, It includes the primer set as described in claim 4 or 5.
7. The reagent kit according to claim 6, characterized in that, The kit is used for the diagnosis and monitoring of bladder cancer.
8. The use of the miRNA biomarker combination according to claims 1-3 in the preparation of products for diagnosing bladder cancer.
9. The use of the primer set according to claims 4-5 in the preparation of products for diagnosing bladder cancer.