Preparation method of irisflorentin

Abstract

The invention relates to a method for preparing irisflorentin by utilizing belamcandin, and belongs to the technical field of biology. The method comprises the following steps: carrying out C-5 site and C-3'site methylation reaction by taking white belamcandin as a substrate, taking belamcanda methyl transferase gene BcOMT03 gene encoding protein and belamcanda methyl transferase BcOMT33 gene encoding protein as catalysts and taking S-adenosine-methionine as a methyl donor to generate a corresponding glycosylation product. According to the invention, the functions of the two methyltransferase genes BcOMT03 and BcOMT33 in the blackberry lily are identified and verified for the first time, the effect of the two methyltransferase genes BcOMT03 and BcOMT33 in catalyzing the ibullamcandin to produce the irisflorentin is defined, and the blank of research on the biosynthetic pathway of the characteristic component irisflorentin of the blackberry lily is filled up; important information is provided for research on a biosynthesis mechanism of active ingredients of medicinal plants.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for preparing iris flavonoids. Background Technology

[0002] Belamcanda chinensis, also known as black fan, scissor grass, butterfly flower, etc., is a plant belonging to the genus Belamcanda in the family Iridaceae. Belamcanda chinensis The dried rhizome of *Belamcanda chinensis* (L.) DC. has a long history of medicinal use, dating back to the *Shennong Bencao Jing* (Shennong's Classic of Materia Medica). It is bitter, cold in nature, and slightly toxic, entering the lung and liver meridians. It is a traditional Chinese medicine used for clearing heat and detoxifying, relieving sore throat and phlegm, and reducing swelling and lumps, and is considered a "key medicine for treating sore throat and pharyngitis." Modern pharmacological studies have shown that *Belamcanda chinensis* possesses antibacterial, anti-inflammatory, free radical scavenging, antiviral, antitumor, estrogen-like, and hepatoprotective effects. It is rich in chemical components, including phenols, quinones, triterpenoids, and organic acids, with isoflavones being its main active ingredients.

[0003] Iris flavonoids are a natural oxymethylated isoflavone and the only quality control indicator component specified in the Chinese Pharmacopoeia (Part I) for the medicinal herb *Belamcanda chinensis*, used to characterize the quality of this herb. It possesses pharmacological effects such as clearing heat and detoxifying, anti-inflammatory and antibacterial properties, and reducing oxidative stress damage. Furthermore, iris flavonoids can inhibit the proliferation and invasion of tumor cells, induce tumor cell apoptosis, and have a certain inhibitory effect on various tumors. Iris flavonoids are mainly extracted from the underground parts of *Belamcanda chinensis*, which requires 2-3 years to cultivate, a relatively long cycle. Currently, the metabolic pathway of iris flavonoids has not been elucidated. Identifying the genes involved in the biosynthetic pathway of iris flavonoids, understanding the formation processes of its precursors, intermediates, and final products, and constructing a complete metabolic pathway map will help advance the application of this compound. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a method for preparing iris flavin. This method utilizes oxymethyltransferase from *Iris tectorum*. BcOMT03 The gene-encoded protein can directly catalyze the production of irisin from leucorrhizin; or utilize... BcOMT33 The gene-encoded protein can catalyze the oxygen methylation modification of irisin at the C5 position to generate 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxyisoflavones, which are further modified by oxygen methylation at the C3' position to finally generate irisin.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of this invention provides a method for preparing iris flavin, comprising the following steps: Using belamcanda chinensis as a substrate and S-adenosylmethionine as a methyl donor, the oxygen methyltransferase in belamcanda chinensis was used. BcOMT03 Gene-encoded proteins or oxymethyltransferases in Belamcanda chinensis BcOMT33 The gene-encoded protein acts as a catalyst to carry out the reaction and generate iris flavin; The oxygen methyltransferase in the aforementioned Belamcanda chinensis BcOMT03 The gene nucleotide sequence is shown in SEQ ID NO.1; The oxygen methyltransferase in the aforementioned Belamcanda chinensis BcOMT33 The gene nucleotide sequence is shown in SEQ ID NO.3.

[0006] Furthermore, using belamcanda chinensis as a substrate and S-adenosylmethionine as a methyl donor, the oxygen methyltransferase in belamcanda chinensis was used... BcOMT33 When the gene-encoded protein acts as a catalyst, the oxymethyltransferase in Belamcanda chinensis BcOMT33 The gene-encoded protein first catalyzes the formation of 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxyisoflavones from irisin, and then further catalyzes the formation of iris flavonoids.

[0007] The second aspect of the present invention provides the oxygen methyltransferase in the aforementioned Belamcanda chinensis. BcOMT03 Gene, the oxygen methyltransferase in the aforementioned Belamcanda chinensis BcOMT03 The gene nucleotide sequence is shown in SEQ ID NO.1.

[0008] The third aspect of the present invention provides the oxygen methyltransferase in the aforementioned Belamcanda chinensis. BcOMT03 A gene-encoded protein, characterized in that the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0009] The fourth aspect of the present invention provides the oxygen methyltransferase in the aforementioned Belamcanda chinensis. BcOMT33 The gene, characterized by the presence of oxymethyltransferase in the *Iris tectorum*. BcOMT33 The gene nucleotide sequence is shown in SEQ ID NO.3.

[0010] The fifth aspect of the present invention provides the oxygen methyltransferase in the aforementioned Belamcanda chinensis. BcOMT33 A gene-encoded protein, characterized in that the amino acid sequence of the encoded protein is shown in SEQ ID NO.4.

[0011] The sixth aspect of the present invention provides an oxymethyltransferase containing the aforementioned Belamcanda chinensis. BcOMT03 Genes or those containing the oxymethyltransferase from the aforementioned Belamcanda chinensis BcOMT33 Recombinant plasmids of genes.

[0012] Furthermore, the oxygen methyltransferase in Belamcanda chinensis... BcOMT03 Oxymethyltransferase in genes or Belamcanda chinensis BcOMT03The gene was homologously recombined with the pET28a vector to obtain the pET28a-BcOMT03 recombinant plasmid and the pET28a-BcOMT33 recombinant plasmid, respectively.

[0013] A seventh aspect of the present invention provides a transgenic engineered bacterium containing the recombinant plasmid described above, or, wherein the genome of the transgenic engineered bacterium is integrated with exogenous O-methyltransferase from *Iris tectorum* described above. BcOMT03 The gene, or the genome of the genetically engineered bacterium, integrates an exogenous O-methyltransferase from *Iris tectorum*. BcOMT33 Gene.

[0014] Furthermore, the genetically engineered bacteria is Escherichia coli BL21(DE3) strain.

[0015] The eighth aspect of the present invention provides the oxygen methyltransferase in the aforementioned Belamcanda chinensis. BcOMT03 Genes or the oxymethyltransferase in Belamcanda chinensis as described in claim 5 BcOMT33 Application of genes in the preparation of iris flavonoids.

[0016] The ninth aspect of the present invention provides the oxygen methyltransferase in the aforementioned Belamcanda chinensis. BcOMT33 Application of the gene in the preparation of 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxyisoflavones.

[0017] Estrogen-like effects refer to the ability of certain substances (natural or synthetic) to mimic or interfere with the function of endogenous estrogen in the human body, producing estrogen-like physiological effects or antagonistic effects by binding to estrogen receptors or affecting related metabolic pathways.

[0018] Belamcanda chinensis oxymethyltransferase gene BcOMT03 The nucleotide sequence of the gene, with a full length of 1107 bp, is shown in SEQ ID NO.1. The protein encoded by BcOMT03 encodes 368 amino acid residues, as shown in SEQ ID NO.2.

[0019] BcOMT33 The nucleotide sequence of the gene, with a full length of 1098 bp, is shown in SEQ ID NO.3. BcOMT33 The encoded protein contains 365 amino acid residues, as shown in SEQ ID NO.4.

[0020] Preferably, the recombinant plasmid is prepared by transfecting the above-mentioned iris oxymethyltransferase gene. BcOMT03 and BcOMT33 They were obtained from the pET28a vector through homologous recombination technology and named pET28a-BcOMT03 and pET28a-BcOMT33.

[0021] This invention also provides two transgenic engineered bacteria, containing the recombinant plasmids described above or having an exogenous *Iris tectorum* bifunctional O-methyltransferase gene integrated into the genome of the engineered bacteria. BcOMT03 and BcOMT33 .

[0022] Preferably, the genetically engineered bacteria is Escherichia coli BL21(DE3) strain.

[0023] This invention also provides the above-mentioned O-methyltransferase gene derived from Belamcanda chinensis. BcOMT03 and BcOMT33 Applications in the preparation of 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxyisoflavones and iris flavonoids.

[0024] Using dichotomitin as a substrate and S-adenosyl methionine (SAM) as a methyl donor, and then from the aforementioned dichotomitin oxygen methyltransferase gene... BcOMT03 and BcOMT33 Under the catalysis of the encoded iris oxymethyltransferase, BcOMT03 can directly catalyze the formation of irisin from irisin; BcOMT33 first catalyzes the formation of 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxyisoflavone from irisin, and then further catalyzes the formation of irisin.

[0025] This invention obtains a purified target protein by expressing it in vitro using a recombinant plasmid. After further catalysis of the substrate leucorrhizin, BcOMT03 can directly catalyze the formation of iris flavin from leucorrhizin; BcOMT33 mainly generates 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxyisoflavones, with a small portion further catalyzing the formation of iris flavin.

[0026] The Belamcanda chinensis oxymethyltransferase gene described in this invention BcOMT03 and BcOMT33 It possesses excellent catalytic activity against irisin and was identified from the roots of *Iris tectorum* through genome sequencing and bioinformatics analysis, followed by experimental screening. RNA was extracted from *Iris tectorum* roots, reverse transcribed into cDNA, amplified by PCR, and the protein expression plasmid was constructed and then identified through experimental screening.

[0027] When homologous recombination occurs with vector pET28a, BcOMT33 Genes require amplification and recovery using primers with homologous arms. The primers with homologous arms are as follows: pBcOMT03 - 5'F: atgggtcgcggatccatgggatctacagagcagaagg pBcOMT03-3'R: acggagctcgaattcggatccctacttgtagaactcgagcacccpBcOMT33 - 5'F: atgggtcgcggatccatgcatacaagtcggagcatttc pBcOMT33 - 3'R:acggagctcgaattctcaaggataaacttcaatgatcgaacg Isolation and identification of the oxomethyltransferase gene from Belamcanda chinensis. BcOMT03 and BcOMT33 It can serve as an important candidate gene for the synthesis of 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxyisoflavones and iris flavonoids in the construction of yeast chassis cells.

[0028] This invention utilizes genomics screening, heterologous expression, and in vitro enzyme activity detection techniques to target the O-methyltransferase gene of *Iris tectorum*. BcOMT03 and BcOMT33 Functional assessment was conducted. BcOMT03 It can directly catalyze the formation of iris flavonoids from white iris extract; BcOMT33 The gene catalyzes the formation of most of the 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxy isoflavones from irisin, with a small portion further catalyzing the formation of irisin. The discovery of this gene elucidates the biosynthetic pathway of irisin, facilitating the heterologous synthesis of 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxy isoflavones and irisin using synthetic biology techniques. This provides a sustainable alternative to traditional methods, meeting market demands.

[0029] Compared with the prior art, the beneficial effects of this invention are as follows: (1) For the first time, it was found that the proteins encoded by the BcOMT03 and BcOMT33 genes from Belamcanda chinensis can catalyze the methylation of Belamcanda chinensis at the C-5 and C-3' positions to generate Iris flavin, which has clear medicinal value, filling the gap in the biosynthesis technology of this compound in Belamcanda chinensis. (2) The technology system is mature and scalable. It relies on the clear gene sequence (SEQ ID NO.1-4), standardized recombinant plasmid construction method and Escherichia coli BL21 (DE3) engineered bacteria expression system. The reaction conditions are mild (37℃, 50mM Tris-HCl, pH 8.0). It does not require harsh high temperature and high pressure or toxic chemical reagents. The operation is simple and the production cost is reduced, making it more suitable for industrial production. (3) It is green and environmentally friendly with outstanding product advantages. The biocatalytic process has few by-products and low pollution, which is in line with the concept of green production. The generated iris flavonoids have significantly improved water solubility, stability and bioavailability compared with the substrate, providing high-quality raw materials and technical support for subsequent pharmaceutical development and industrialization of related products. Attached Figure Description

[0030] Figure 1 A schematic diagram illustrating the deduced synthetic pathway for the formation of irisflorentin catalyzed by dichotomitin; Figure 2 This is a schematic diagram of the construction of the recombinant expression plasmid Pet28a-BcOMT03 (used to express the methyltransferase gene). BcOMT03 ); Figure 3 This is a schematic diagram of the construction of the recombinant expression plasmid Pet28a-BcOMT33 (used to express the methyltransferase gene). BcOMT33 ); Figure 4 The electrophoresis results are for the recombinant BcOMT33 and BcOMT03; where M: DNA Marker band, 1-4 are BcOMT33 agarose gel electrophoresis DNA bands, and 5-8 are BcOMT03 agarose gel electrophoresis DNA bands. Figure 5 SDS-PAGE protein electrophoresis results for BcOMT03 and BcOMT33; where M: protein molecular weight standard; 1 is the SDS-PAGE protein electrophoresis result of purified BcOMT03 protein, and 2 is the SDS-PAGE protein electrophoresis result of purified BcOMT33 protein. Figure 6 To detect the methylation of the C-5 and C-3' hydroxyl groups of irisin by the iris methyltransferase genes BcOMT03 and BcOMT33 by HPLC, both of which eventually produced iris xanthophyll; Figure 7To further identify the enzyme activity reaction products of BcOMT03 and BcOMT33 by LC-MS, characteristic ion peaks of 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxy isoflavone and irisin in the sample were analyzed in positive ion mode. A shows the mass spectrum ion peaks of 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxy isoflavone, i.e., compound (2); B shows the mass spectrum ion peaks of the standard of 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxy isoflavone, i.e., compound (2); C shows the mass spectrum ion peaks of irisin, i.e., compound (3); and D shows the mass spectrum ion peaks of the standard irisin, i.e., compound (3). By comparing characteristic ions (such as [M+H]... + [M+Na] + [2M+Na] + (etc.) confirmed the consistency between the reaction product and the standard. Detailed Implementation

[0031] The present invention will now be described in further detail with reference to the embodiments.

[0032] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase. Example 1

[0033] LB liquid medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.0, autoclave at 121℃ for 20 min, store at room temperature; LB solid medium: Add 15 g / L agar to LB liquid medium, autoclave at 121℃ for 20 min, cool to 55℃ and add kanamycin (final concentration 100 mg / L), invert the plate and store at 4℃; The genome of *Iris tectorum* was sequenced, assembled, and annotated. Subsequently, oxygen methyltransferases (BcOMTs) in *Iris tectorum* were identified, and candidate genes were screened based on the tissue specificity of high expression of dichotomitin in the underground parts of *Iris tectorum*. Following this, a series of procedures were performed, including cDNA preparation, amplification and recovery of candidate genes, homologous recombination, protein expression, in vitro enzyme activity reactions, and detection by HPLC, LC-MS, and NMR. Finally, an oxygen methyltransferase gene was detected and identified that can catalyze the methylation of the C-5 hydroxyl group of dichotomitin to generate 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxyisoflavones, and further methylation of the hydroxyl group at the C3' position to generate dichotomitin. BcOMT03 and BcOMT33 Among them, 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxyisoflavones are the main product catalyzed by BcOMT33 protein ( Figure 1 The steps for synthesizing 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxyisoflavones and irisin are as follows: (1) Preparation of cDNA template Fresh Belamcanda chinensis root and rhizome samples were collected, sectioned, and flash-frozen in liquid nitrogen for RNA extraction. Total RNA was extracted using the Magen (Guangzhou Meiji Biotechnology Co., Ltd.) HiPure Plant RNA Mini Kit. RNA was extracted according to the kit's operating procedures. After passing the tests, the RNA was reverse transcribed into cDNA using the TAKARA reverse transcription kit and stored at -20°C for later use.

[0034] (2) Amplification and recovery of the target gene Primers with homologous arms (E. coli pET28a) were designed using primer design software (SnapGene, v6.22), and then gene amplification was performed using Phanta Max Super-Fidelity DNA polymerase.

[0035] Table 1 Primers for candidate BcOMTs

[0036] The reaction system and procedure are as follows: PCR reaction volume 50 μL, including 25 μL of 2×Phanta Max Master Mix, 1 μL each of upstream and downstream primers (10 μmol / L), 1 μL of cDNA, and 22 μL of ddH2O; PCR reaction procedure: 95℃ pre-denaturation for 3 min; 95℃ for 15 s denaturation, 58℃ for 15 s annealing, 72℃ for 2 min extension, for a total of 35 cycles; final extension at 72℃ for 5 min, and incubation at 10℃. Primers corresponding to genes BcOMT03 and BcOMT33 were used to obtain PCR products of genes BcOMT03 and BcOMT33 with the pEAT28a homologous arm, respectively, which were used as the target gene fragments, thus yielding two target gene fragments.

[0037] After PCR, a gel electrophoresis was performed to confirm successful gene amplification. Successful fragments were then selected for gel recovery of the target band. Gene digestion and recovery were performed using an agarose gel DNA recovery kit from Beijing Tiangen Biotech Co., Ltd. The recovered gene concentration was measured using a NanoReady ultra-micro UV-Vis spectrophotometer and stored at -20℃ for later use.

[0038] (3) Homologous recombination and transformation of linearized vector and target gene For a detailed diagram of homologous recombination, please refer to [link / reference]. Figure 2 and Figure 3 First, the linearized pET28a vector was obtained by single digestion with BamHI enzyme; The 50 μL BamHI digestion system for the pET28a vector consists of: 5 μL pET28a plasmid (concentration approximately 1 μg / μL, containing approximately 5 μg of vector, which can be adjusted according to the actual concentration), 5 μL of 10×CutSmart Buffer adapted to BamHI, 1-2 μL BamHI (10 U / μL, total enzyme amount 10-20 U to ensure sufficient digestion), and the remaining volume is made up to 50 μL with sterile nuclease-free water.

[0039] The enzyme digestion procedure was as follows: the enzyme digestion reaction was incubated in a 37°C water bath for 30 min. After the reaction was completed, the reaction was terminated by adding 1 μL of 0.5 M EDTA (final concentration 10 mM). Then, 5 μL of the enzyme digestion product was taken for agarose gel electrophoresis to observe whether the vector was completely linearized (showing a single band that was inconsistent with the original plasmid band).

[0040] Homologous recombination was then performed, and assembly was carried out according to the instructions for homologous recombinase. The amount of each component was calculated based on the concentration of the inserted fragment (i.e., the target gene fragment) and the linearized pET28a vector, and according to the recombination instructions. Finally, each component was added to a PCR reaction tube (as shown in Table 2), and the linearized pET28a vector was ligated to the target gene fragment by incubating at 50°C for 50 min on a PCR instrument. After the reaction was completed, the tube was quickly placed on ice to obtain circular plasmids of genes BcOMT03 and BcOMT33 ligated to pET28a.

[0041] The results were tested after assembly, and the electrophoretic detection results after assembly are shown in [the table below]. Figure 4 This indicates successful assembly, and the sample is then sent to the company for sequencing.

[0042] Table 2

[0043] Note: The target genes are the PCR products of the genes BcOMT03 and BcOMT33 with pET28a homologous arms obtained above.

[0044] In a clean bench, add the two bonding products separately. E coli Gently mix the DH5α competent cells, place them on ice for 30 min, heat shock them in a 42°C metal bath for 45 s, immediately place them on ice for 2 min, add 400 µL of LB liquid medium to the above reaction product in a clean bench, place it in a constant temperature shaker, and incubate at 37°C and 220 rpm / min for 1 h. Take 100 µL of the liquid and spread it evenly on a LB solid medium containing 100 mg / L Kana, obtaining a total of 2 LB solid plates, and incubate them overnight in a 37°C incubator.

[0045] The following day, four single-clone colonies were picked from each of the two plates in a clean bench and cultured for 1-2 hours in LB broth containing 100 mg / L Kan at 37°C. Using the cultured bacterial suspension as a template, the bacterial suspension was amplified using 2×Taq Master Mix rapid DNA amplification enzyme. The reaction system consisted of 10 μL of 2×Taq Master Mix, 0.8 μL each of the upstream primer pET28a-F and the downstream primer pET28a-R (10 μmol / L), 1 μL of bacterial suspension, and 7.4 μL of ddH2O. The reaction program was: 95°C for 3 min; 95°C for 15 s, 58°C for 15 s, 72°C for 45 s, 35 cycles; and a final extension at 72°C for 5 min. After the PCR reaction, using a Normal Run™ prestained 250bp-II DNA ladder as a control, 1% agarose gel electrophoresis was used to determine whether a colony was positive based on its fragment size. The results are shown below. Figure 4 For each candidate gene, three positive bacterial colonies were selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Sequencing results were compared using SnapGene 3.2.1 software. Correctly matched bacterial colonies were preserved at a volume ratio of 50% (v / v) glycerol:bacterial culture = 1:2. The detection primers were: pET28a-F:ccgtttagaggccccaagg; (SEQ ID NO.9) pET28a-R: ggaattgtgagcggataacaattcc. (SEQ ID NO.10) (4) Recombinant protein expression and purification Take 10 μL of glycerol bacteria stored at -80℃ and inoculate it into 5 mL of LB liquid medium containing 100 μg / mL kanamycin. Incubate at 37℃ and 220 rpm with shaking for 12-16 h to activate the bacteria. The next day, transfer the culture at a 1:100 (V / V) ratio to a 1L Erlenmeyer flask containing 500 mL of LB liquid medium containing 100 μg / mL kanamycin. Incubate at 37℃ and 220 rpm until OD (open-circuit retrieval). 600 =0.6-0.8. Add IPTG to a final concentration of 0.2 mmol / L, and induce at a low temperature of 16℃ and 180 rpm for 13 h.

[0046] After induction, bacterial cells were collected by centrifugation at 5000 rpm for 20 min at 4 °C. The cells were resuspended in 20 mL of 50 mmol / L Tris-HCl (containing 50 mmol / L Tris, 200 mmol / L NaCl, and adjusted to pH 8.0 with hydrochloric acid) pre-cooled to 4 °C and placed on ice. Cell disruption was performed using a high-pressure cryo-lysis apparatus (4 °C, 1000-1200 bar, 2 cycles). The disruption buffer was centrifuged at 12000 rpm for 30 min at 4 °C, and the supernatant was collected.

[0047] Proteins with a His tag undergo Ni-containing processes. 2+The His-tagged protein selectively binds to the chromatography medium. Histidine residues have an imidazole group, allowing His-tagged proteins bound to the medium to competitively detach by high concentrations of imidazole. The pET28a vector contains a His-tagged histidine residue, therefore the His-Tag method was used for protein purification. The collected supernatant was slowly added to a pre-treated nickel column, and the column was allowed to stand to allow the protein to bind to the purification column. The column was then eluted sequentially with Tris-HCl buffer containing 20 mmol / L, 50 mmol / L, 100 mmol / L, and 250 mmol / L imidazole, collecting the 250 mmol / L imidazole eluent. The eluent was concentrated using a 10 kDa ultrafiltration tube at 4°C and 3800 rpm / min until the total volume was reduced to 1–1.5 mL. The concentrated protein solution was then mixed with 5% (v / v) glycerol, rapidly frozen in liquid nitrogen, and stored at -80°C for later use.

[0048] Prepare a 12.5% ​​(w / v) polyacrylamide gel according to the instructions of the Omni-Easy™ One-Step PAGE Gel Rapid Preparation Kit. Mix 30 μL of concentrated protein with 10 μL of 5× protein loading buffer (containing 100 mmol / L DTT), heat at 95°C for 10 min, and centrifuge at 12000 rpm for 10 min to obtain the SDS-PAGE analysis sample. Transfer 10 μL of the supernatant to a 12.5% ​​polyacrylamide gel for SDS-PAGE analysis. Electrophoresis is performed at a constant voltage of 150 V for 90 min in 1× protein electrophoresis buffer, then the electrophoresis is stopped. Remove the polyacrylamide gel under running water, stain with Coomassie Brilliant Blue R-250 solution on a shaker at 60°C for 30 min, and then destain with deionized water at 60°C 3-5 times until the bands are clear. See the results below. Figure 5 .

[0049] (5) Enzyme activity reaction Using benzyl benzoin as a substrate, the catalytic methylation activities of purified protein concentrates BcOMT03 and BcOMT33 at the C-5 and C-3' hydroxyl positions were determined.

[0050] The reactions were carried out in 1.5 mL centrifuge tubes. 100 μL of system: 1 mM substrate, 1 mM SAM, 50 μg purified protein concentrate, and 50 mM Tris-HCl were added to make up the volume. For the blank control, buffer was used instead of the enzyme; for the negative control, inactivated enzyme heated at 95°C for 10 min was used instead of the active enzyme.

[0051] After incubating at 37℃ for 16 hours, add an equal volume of methanol (100 μL) to terminate the process, vortex to mix, centrifuge at 1200 rpm and 4℃ for 2 min, and take the supernatant for HPLC and LC-MS analysis.

[0052] (6) Product testing The HPLC detection conditions are as follows: The instrument used for HPLC analysis was an Agilent 1290 ultra-high performance liquid chromatograph. The chromatographic column was an Agilent Extend-C18 (4.6 × 250 mm, 5 μm), and the mobile phase was 0.01% formic acid aqueous solution (A) (i.e., the volume ratio of formic acid to aqueous solution was 0.01%)-acetonitrile (B). Gradient elution was used: 0–5 min, 30%–42% B; 5–15 min, 42% B; 15–20 min, 42%–80% B; 20–25 min, 80%–30% B; the gradient showed a linear change during elution. The detection wavelength was 290 nm. The detection results are shown in [Figure number missing]. Figure 6 This indicates that BcOMT33 produces a large amount of 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxyisoflavones, accompanied by a small amount of irisin. BcOMT03, on the other hand, directly catalyzes the production of irisin from leucorrhizin.

[0053] The LC-MS detection conditions are as follows: To further confirm the reaction products detected by HPLC, an Agilent 1290 UPLC / 6540 Q-TOF liquid chromatography-mass spectrometry (LC-MS) system was used for detection. Standards were purchased from Yunnan Xili Biotechnology Co., Ltd., with a concentration ≥98%. The detection method was as follows: Mass spectrometry conditions: positive ion mode ion source, voltage: 3500V; fragmentation voltage: 135V; cone voltage: 60V; radio frequency voltage: 750V; scan range: 100-1000 m / z. Chromatographic conditions: The column was an Agilent Extend-C18 (4.6 × 250 mm, 5 μm); the mobile phase elution conditions were pure water (A) - acetonitrile (B); gradient elution: 0-5 min, 30%-42% B; 5-15 min, 42% B; 15-20 min, 42%-80% B; 20-25 min, 80%-30% B; the gradient showed a linear change during elution. The detection wavelength was 290 nm. Detection results are shown below. Figure 7 The results show that 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxyisoflavones ( Figure 7 A) and irisin ( Figure 7 C) and 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxyisoflavones in the standard ( Figure 7 B) and irisin (B) Figure 7 D) The characteristic peaks match.

[0054] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A method for preparing iris flavin, characterized in that, Includes the following steps: Using belamcanda chinensis as a substrate and S-adenosylmethionine as a methyl donor, the oxygen methyltransferase in belamcanda chinensis was used. BcOMT03 Gene-encoded proteins or oxymethyltransferases in Belamcanda chinensis BcOMT33 The gene-encoded protein acts as a catalyst to carry out the reaction and generate iris flavin; The oxygen methyltransferase in the aforementioned Belamcanda chinensis BcOMT03 The gene nucleotide sequence is shown in SEQ ID NO.1; The oxygen methyltransferase in the aforementioned Belamcanda chinensis BcOMT33 The gene nucleotide sequence is shown in SEQ ID NO.

3.

2. The method for preparing iris flavonoids according to claim 1, characterized in that, Using belamcanda chinensis as a substrate and S-adenosylmethionine as a methyl donor, the oxygen methyltransferase in belamcanda chinensis was used. BcOMT33 When the gene-encoded protein acts as a catalyst, the oxymethyltransferase in Belamcanda chinensis BcOMT33 The gene-encoded protein first catalyzes the formation of 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxyisoflavones from irisin, and then further catalyzes the formation of iris flavonoids.

3. The oxymethyltransferase in Belamcanda chinensis according to claim 1 BcOMT03 Genes, characterized by, The oxygen methyltransferase in the aforementioned Belamcanda chinensis BcOMT03 The gene nucleotide sequence is shown in SEQ ID NO.

1.

4. The oxymethyltransferase in Belamcanda chinensis according to claim 1 BcOMT03 Gene-encoded protein, characterized by, The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

5. The oxymethyltransferase in Belamcanda chinensis according to claim 1 BcOMT33 Genes, characterized by, The oxygen methyltransferase in the aforementioned Belamcanda chinensis BcOMT33 The gene nucleotide sequence is shown in SEQ ID NO.

3.

6. The oxymethyltransferase in Belamcanda chinensis according to claim 1 BcOMT33 Gene-encoded protein, characterized by, The amino acid sequence of the encoded protein is shown in SEQ ID NO.

4.

7. Containing the oxymethyltransferase from Belamcanda chinensis as described in claim 3 BcOMT03 Genes or containing the oxymethyltransferase in Belamcanda chinensis as described in claim 5 BcOMT33 Recombinant plasmids of genes.

8. A genetically engineered bacterium containing the recombinant plasmid of claim 8, or wherein the genome of the genetically engineered bacterium is integrated with exogenous O-methyltransferase from *Iris tectorum* as described in claim 3. BcOMT03 The genome of the genetically engineered bacterium contains an exogenous O-methyltransferase from *Iris tectorum* as described in claim 3. BcOMT33 Gene.

9. The oxymethyltransferase in Belamcanda chinensis according to claim 3 BcOMT03 Genes or the oxymethyltransferase in Belamcanda chinensis as described in claim 5 BcOMT33 Application of genes in the preparation of iris flavonoids.

10. The oxymethyltransferase in Belamcanda chinensis according to claim 5 BcOMT33 Application of the gene in the preparation of 3'-hydroxy-5,4',5'-trimethoxy-6,7-methylenedioxyisoflavones.

Images