Application of COX4I2 in preparation of non-small cell lung cancer medicine

Abstract

The invention discloses an application of COX4I2 in preparation of a non-small cell lung cancer medicine. Specifically, the invention also discloses an application of COX4I2 in preparation of a mitochondrial iron overload preparation and an application of a COX4I2 gene inhibitor in preparation of a preparation for promoting malignant progression of tumors. According to the invention, a COX4I2-VDAC1 interaction inhibitor is screened, a COX4I2 degradation agent or cluster-competitive peptide is developed, a brand new combined chemotherapy regimen is provided for solid tumors such as NSCLC and the like, and the polypeptide has the potential of expanding to cluster metabolic disorder diseases such as neurodegenerative diseases and diabetes mellitus.

Description

Technical Field

[0001] This invention relates to the field of biotechnology; specifically, it relates to the application of COX4I2 in the preparation of drugs for non-small cell lung cancer. Background Technology

[0002] 1. Currently, there are four main types of drugs targeting mitochondria: ① Pathway-targeting drugs, mainly inhibitors of RSL3 and erastin, which inhibit GPX4 or System Xc⁻, indirectly depleting cytoplasmic [2Fe-2S] clusters. ② Mitochondrial iron chelation, deferiprone, which reduces mitochondrial free iron and decreases cluster synthesis. ③ Enhanced Fe-S cluster efflux, the DHODH inhibitor brequinar, which enhances mitochondrial cluster efflux through the CoQ10 pathway. ④ Gene editing, CRISPR knockout of miNT or mNT, blocking any step in the chain and promoting ferroptosis.

[0003] 2. Disadvantages of existing technologies (1) Target redundancy: It only acts on downstream nodes such as GPX4 and DHODH, and cannot directly interfere with the "cluster transport chain" itself, resulting in a high rate of adaptive resistance. The non-classical FSP1 pathway can compensate for the loss of GPX4, and single-target inhibitors are prone to causing adaptive resistance.

[0004] (2) Lack of spatiotemporal specificity: Small molecule inhibitors or gene knockouts are global interventions that easily damage normal tissues and have a narrow therapeutic window. The ferroptosis inducer erastin causes DNA damage in bone marrow cells, resulting in a narrow therapeutic window and hindering clinical translation.

[0005] (3) Lack of reversible switch: Existing interventions (chelating agents, gene knockout) are difficult to turn off once started, and cannot regulate cluster flow as needed.

[0006] (4) The direction of action is unclear: There is no means to promote out-of-cluster excretion in a "positive" way, and most existing inhibitors are based on the "blocking" approach. Summary of the Invention

[0007] The technical problem to be solved by this invention is: (1) Overcome the shortcomings of the existing "open-loop" intervention and achieve "on / off" precise intervention of the transfer chain. Existing gene knockout or iron chelating agents are irreversible once activated; this invention utilizes inducible expression systems, RNA aptamers, or small molecules to regulate COX4I2 expression / activity, achieving on-demand release or recovery of the [2Fe-2S] cluster and expanding the therapeutic window.

[0008] (2) Establish a convertible "cluster transport chain" targeted drug platform By screening COX4I2-VDAC1 interaction inhibitors and developing cluster-competitive peptides for the COX4I2-CISD1-VDAC1 channel, this invention provides a novel combination chemotherapy regimen for solid tumors such as NSCLC, and has the potential to be extended to neurodegenerative diseases, diabetes, and other cluster metabolic disorders.

[0009] (3) Solve the problems of high off-target toxicity and narrow therapeutic window of traditional ferroptosis inducers. Existing drawbacks: Classic small molecules such as Erastin and RSL3 cause ROS damage in non-target tissues such as bone marrow and myocardium, and the clinical dosage is limited.

[0010] (4) Establish a real-time, dynamic ferroptosis efficacy monitoring system to address the spatiotemporal heterogeneity of tumors. Existing shortcomings: Static biomarkers (NQO1, RRM1) cannot track the ferroptosis process in real time, leading to a lag in efficacy assessment.

[0011] (5) Addressing treatment failure caused by negative feedback in the immune microenvironment. Existing drawback: DAMPs released by ferroptosis activate Tregs, weakening the synergistic effect of chemotherapy on the immune system.

[0012] (6) Develop a “pH / ROS dual-response nanodelivery system” that releases active drugs only under tumor microacid and high ROS conditions, thereby reducing system toxicity by ≥70% and expanding the maximum tolerated dose (MTD).

[0013] This invention systematically overcomes the key shortcomings of existing ferroptosis-chemotherapy combination regimens, such as drug resistance, toxicity, and insufficient dynamic monitoring, through three-target synergistic inhibition, spatiotemporally controllable nanodelivery, real-time efficacy monitoring, and immune microenvironment reprogramming, thereby significantly improving the clinical benefits for patients with non-small cell lung cancer.

[0014] This invention is achieved through the following technical solutions. Application of COX4I2 in the preparation of drugs for non-small cell lung cancer.

[0015] Preferably, the COX4I2 is one of the COX4I2 gene, COX4I2 protein, or COX4I2 overexpression vector.

[0016] Preferably, the COX4I2 promotes ferroptosis by regulating CISD1.

[0017] Preferably, the COX4I2 interferes with the normal function of the CISD1 protein by binding to the functional site His87 of the CISD1 protein, thereby disrupting intracellular iron homeostasis and ultimately inhibiting tumor progression by inducing ferroptosis.

[0018] This invention also provides the application of COX4I2 in the preparation of mitochondrial iron overload formulations.

[0019] Preferably, the COX4I2 is one of the COX4I2 gene, COX4I2 protein, or COX4I2 overexpression vector.

[0020] Preferably, COX4I2 is used to upregulate the expression of the iron uptake protein TfR1 while downregulating the expression of the iron storage protein Ferritin.

[0021] This invention also provides the application of COX4I2 gene inhibitors in the preparation of agents that promote malignant tumor progression. The agents for promoting malignant tumor progression provided by this invention can be used in the design and preparation of positive control experiments for malignant tumor progression in scientific research.

[0022] Preferably, the promotion of malignant tumor progression is to promote and enhance the proliferation, migration, invasion, and clonogenic ability of tumor cells; the COX4I2 gene inhibitor is a COX4I2 gene knockout plasmid or COX4I2 siRNA.

[0023] Preferably, the COX4I2 siRNA is specifically: si-COX4I2-1: GUCUACGUAUUUCCUCCAATT; or si-COX4I-2: CCGUCGCUCCAAUGAGUGGTT.

[0024] The present invention also provides the application of the EZH2 inhibitor GSK126 in the preparation of ferroptosis-promoting agents; the EZH2 inhibitor GSK126 promotes ferroptosis by inhibiting the binding of EZH2 to the COX4I2 promoter, thereby increasing the gene expression of COX4I2.

[0025] The present invention has, but is not limited to, the following beneficial effects: 1. Ferroptosis has become a "star pathway" for breaking chemotherapy resistance in NSCLC, but currently targeted drugs are concentrated on the GPX4 / SLC7A11 / FSP1 axis, and there is no intervention program targeting the "cluster transport chain" itself.

[0026] 2. This technology develops a switch that regulates the transport of [2Fe-2S] clusters from mitochondria into the cell, revealing a potential pathway for the transmembrane delivery of newly formed [2Fe-2S] clusters to the cytoplasm. Recent research (PNAS 2022) has proposed the MiNT–VDAC1–mNT (mitoNEET / CISD1) transport chain via the MiNT (CISD3, mitochondrial matrix) → VDAC1 (outer membrane pores) → mNT (CISD1, outer membrane cytoplasmic surface) → cytoplasmic CIA system. The transport of [2Fe-2S] clusters from mitochondria to the cytoplasm is directly related to tumor ferroptosis and chemotherapy resistance. However, how the cell regulates this switch remains unclear.

[0027] 3. To explore the regulation of cellular iron death from upstream regulatory factors of the oxidative respiratory chain, in order to provide new ideas for the controllable release of intratumoral iron ions in pH / ROS dual-response nanosystems. Attached Figure Description

[0028] To clearly illustrate the specific embodiments of the present invention and certain detection techniques used in the experiments, the implementation schemes and the techniques used will be described below, mainly through the accompanying drawings.

[0029] Figure 1. Bioinformatics analysis revealed that low COX4I2 expression is associated with poor prognosis in NSCLC; (A) Candidate genes were identified from the intersection of NSCLC DEG (GSE18842, GSE81089, GSE19188) and the FerrDB ferroptosis gene set. (B) Comparison of COX4I2 expression in NSCLC tumors with that in normal adjacent tissues of TCGA. (C) Survival curve analysis.

[0030] Figure 2. Functional analysis of COX4I2 in NSCLC cell lines. (A) QRT-PCR analysis of COX4I2 mRNA expression in normal bronchial epithelial (BEAS-2B) and NSCLC (A549, H460, PC9, H1299) cell lines. PC9 and H460 cell lines were selected for overexpression and knockdown experiments based on endogenous COX4I2 expression levels. (D) COX4I2 overexpression and knockdown for cck8 assay. (E) Colony formation assay after COX4I2 overexpression or knockdown. (F) Wound healing assay to assess cell migration. (G) Transwell invasion assay to assess cell invasiveness. (H) Photographs of representative tumors in each group. (I) Statistical graph of tumor weight in each group. (J) Curves showing changes in tumor volume in each group.

[0031] Figure 3Mechanism of COX4I2 and CISD1 interaction. (A) Screening of COX4I2 interacting proteins using tandem affinity purification mass spectrometry (TAP-MS). (BD) Verification of the interaction between COX4I2 and CISD1 using exogenous and endogenous co-immunoprecipitation (Co-IP) experiments. (E) Subcellular localization of COX4I2 and CISD1 analyzed by immunofluorescence (IF). (F) Schematic diagram of the construction of wild-type and mutant CISD1 (ΔCDGSH, H87C). (G) Detection of the binding ability of COX4I2 to wild-type and mutant CISD1 using Co-IP. (HI) Detection of ferroptosis markers (ROS, GSH, Fe²⁺, MDA) in PC9 cells overexpressing COX4I2 by impregnation of wild-type CISD1, ΔCDGSH mutant, and H87C mutant. (J) Cell viability detected by CCK-8 assay under the same impregnation conditions. (K) Colony formation assay performed under the same impregnation conditions. (L) Transwell migration experiment under the same patching conditions. (M) Scratch healing experiment under the same patching conditions.

[0032] Figure 4. COX4I2 disrupts mitochondrial iron homeostasis by targeting CISD1 function. (A) Mitochondrial membrane potential measured using JC-1 staining in cells treated with the CISD1 inhibitor NL-1 or overexpressing COX4I2. (B) Mitochondrial free Fe²⁺ levels assessed using the Mito-FerroGreen probe under the same conditions. (C) Determination of aconitase activity in the cytoplasm (ACO1) and mitochondria (ACO2). (D) Western blot analysis of TfR1 and ferritin protein expression.

[0033] Figure 5 The functional relationship between COX4I2 and CISD1 was determined by the recovery experiment. (A) Validation of the CISD1 knockout cell line (sg-CISD1) generated by CRISPR-Cas9. (B) Cell viability assay of the four experimental groups by CCK-8 assay. (C) Colony formation assay of the four experimental groups. (D) Transwell migration assay of the four experimental groups. (E) Wound healing assay of the four experimental groups. (F) Measurement of intracellular ROS levels in the four experimental groups. (G) Analysis of ferroptosis markers in the four experimental groups. (H) Photographs of representative tumors in each group. (I) Statistical graph of tumor weight in each group. (J) Curves showing changes in tumor volume in each group.

[0034] Figure 6Effects of inflammatory cytokines on COX4I2 expression and functional rescue. (AB) qRT-PCR and Western blot analysis of COX4I2 expression in PC9 cells treated with key inflammatory cytokines (TNF-α, IFN-γ, IL-1β, TGF-β). (CD) Validation of IL-1β-mediated inhibition of COX4I2 in multiple NSCLC cell lines (A549, H460, PC9, H1299). (EG) Cell proliferation and Transwell migration assays in PC9 and H460 cells treated with IL-1β and / or COX4I2 overexpression. (HI) Wound healing assay under the same experimental conditions. (J) Colony formation assay under the same experimental conditions.

[0035] Figure 7 Mechanism of IL-1β-mediated COX4I2 epigenetic silencing suppressing ferroptosis. (AB) Measurement of ROS fluorescence intensity (A) and ferroptosis markers (GSH, Fe²⁺, MDA) in PC9 cells treated with IL-1β and / or Erastin (B). (CD) Analysis of ROS levels (C) and ferroptosis markers (D) in cells overexpressing COX4I2 and / or treated with IL-1β. (E) Chromatin immunoprecipitation (ChIP) assay of COX4I2 promoters H3K27me3 and H3K27ac enriched after IL-1β treatment. (F) qRT-PCR analysis of EZH2 mRNA expression after IL-1β treatment. (GH) qRT-PCR and Western blot analysis of COX4I2 expression in cells treated with the IL-1β and / or EZH2 inhibitor GSK126. (I) ChIP determination of EZH2 binding to COX4I2 promoter after IL-1β and GSK126 treatment. Specific implementation methods The specific embodiments of the present invention are explained with the aid of examples. Except for the detection technology, which does not limit the present invention in any way, some of the solutions in the described embodiments are part of the embodiments of the invention. All embodiments obtained by ordinary people in the art without creative results are within the protection scope of the present invention. Example 1: Materials and Methods 1.1 Cell lines and cell culture Human non-small cell lung cancer cell lines A549, H460, PC9, H1299, and HEK293T, as well as the normal human lung epithelial cell line BEAS-2B, are deposited in the Key Laboratory of Tumor Metastasis and Precision Treatment at the First Hospital of Nanchang City and stored under standard conditions. All cell lines are free of mycoplasma contamination. The normal human lung cell line and NSCLC cell line were cultured in DMEM medium, 10% fetal bovine serum, 100 U / ml penicillin, and 100 μg / ml streptomycin, and incubated at 37°C in a 5% CO2 incubator. The culture medium was changed every two days, and the cells were passaged when the confluence reached 70-90% for subsequent culture or experiments. 1.2 RNA Extraction and Real-Time Quantitative PCR Total RNA was extracted from cultured cells using TRIzol reagent according to the manufacturer's instructions, followed by reverse transcription to synthesize cDNA using the PrimeScript™ RT kit. Quantitative analysis was performed using RealMaster Mix on a CFX96 real-time quantitative PCR detection system. RNA levels of the target gene were detected by quantitative RT-PCR, and normalization was performed using GAPDH as an internal control. The primer sequences used for qRT-PCR are as follows, with specific sequences shown in SEQ ID NO: 1 to SEQ ID NO: 8: qPCR-COX4I2-FACCGGCTCCAGTTCAATGAG qPCR-COX4I2-R TGTTGCCACTCACCGTAGAC qPCR-CISD1-F CCGCTGGCACCTTTACTCTC qPCR-CISD1-R CTGCGATCCATTCAACTCGTA qpcr-EZH2-F TGCTTCCTACATCGTAAGTGCAA qpcr-EZH2-RCCTTTGCTCCCTCCAAATGC qpcr-GAPDH -F GTCTCCTCTGACTTCAACAGCG qpcr-GAPDH -R ACCACCCTGTTGCTGTAGCCAA 1.3 Cloning Experiment Cell proliferation capacity was assessed using a colony formation assay. In short, 500 cells / well were seeded into 6-well plates and cultured for 1–2 weeks with periodic medium changes. Subsequently, cell colonies were washed with PBS, fixed with formaldehyde, stained with 0.1% crystal violet, and counted. 1.4 CCK8 Experiment Perform the CCK8 assay according to the manufacturer's manual. In short, seed 2000 cell suspensions into 96-well plates and incubate for 24, 48, and 72 hours. At each time point, add 10 μl of sterile CCK-8 solution to each well and incubate at 37°C for another 2 hours. Measure the absorbance at 450 nm using a microplate reader. 1.5 Cell migration and invasion experiments Cell migration ability was assessed using a cell scratch assay. In short, cells in the logarithmic growth phase were seeded into 6-well plates. Once the cells reached 90% confluence, a baseline was drawn at the bottom of the culture plate, and three scratches were created perpendicular to this line using a sterile 100 μl pipette tip. The cells were then gently washed twice with PBS to remove any detached cells. Images of the scratches were captured at 0 and 24 hours post-scratching using an inverted microscope at ×5 magnification.

[0036] For cell invasion assays, 8.0 μm pore size Transwell chambers coated with Matrigel matrix were used. NSCLC cells were digested and resuspended in serum-free DMEM medium. 200 μl of cell suspension was added to the upper chamber, and 800 μl of complete medium containing 10% FBS was added to the lower chamber. After 24 hours of cell incubation, the number of invading cells was counted by randomly selecting five fields of view at ×400 magnification. Three replicates were performed for each experiment, and the average result was taken. For migration assays, 3 × 10⁶ cells were used... 4 NSCLC cells were seeded in uncoated Matrigel-coated Transwell chambers, and cell migration was assessed 24 hours later. 1.6 Plasmid or siRNA transfection COX4I2 siRNA was purchased from Gemma Gene, and a scrambled RNA sequence from Gemma Gene was used as a negative control for the knockdown experiment. The siRNA sequences used are as follows, as shown in SEQ ID NO: 9 to SEQ ID NO: 10: si-COX4I2-1:GUCUACGUAUUUCCUCCAATT; si-COX4I-2:CCGUCGCUCCAAUGAGUGGTT.

[0037] siRNA transfection was performed using Lipofectamine RNAiMAX, strictly following the manufacturer's instructions. Polyethylenimine was used as the transfection reagent for 293T cells, while Lipofectamine 2000 was used for NSCLC cells. Flag-COX4I2, HA-CISD1, and Pssh-COX4I2 plasmids were purchased from Wuhan Miaoling.

[0038] 1.7 Construction of PC9 gene knockdown cell lines using CRISPR / Cas9 technology The CISD1 knockout plasmid LentiCRISPRv2-CMV-ZsGreen-Puro was purchased from QIAGEN Biotech. The lentiviral plasmid was transfected into 293T cells, and the viral supernatant was collected after 48 hours of culture. This viral supernatant was used to infect NSCLC cells. Cells were then selected using puromycin; cells without fluorescence died. Surviving cells were digested into single-cell suspensions, diluted to a concentration sufficient for monoclonal formation, and seeded into 10 cm culture dishes. After 1-2 weeks of culture, single-cell clones were observed and labeled on the bottom of the dish. The culture medium was aspirated, and the cells were washed three times with PBS. 2 µL of trypsin was added to the labeled area, and digestion was performed for 1 minute. Then, 10 µL of culture medium was added, and cells were aspirated by pipetting and transferred to 24-well plates for further culture. Finally, the knockout efficiency was assessed by Western blot analysis. 1.8 Western blotting Cells were lysed on ice for 30 minutes using RIPA lysis buffer containing protease inhibitors, followed by centrifugation at 14,000 rpm for 30 minutes at 4°C. The supernatant was collected, and the mixture was boiled in 10× SDS loading buffer for 10 minutes. Protein concentration was determined using a BCA protein quantification kit. Proteins were separated by SDS-PAGE and transferred to PVDF membranes. The membranes were blocked in PBST containing 5% skim milk for 1 hour, followed by overnight incubation with primary antibody at 4°C. After washing three times with PBST, the membranes were incubated with secondary antibody at room temperature for 1 hour. After washing three more times with PBST, the membranes were developed using an ECL chemiluminescence assay kit. 1.9 Determination of intracellular ROS, malondialdehyde, glutathione, and ferrous ions Intracellular ROS levels were detected using a reactive oxygen species (ROS) fluorescence detection reagent and fluorescence microscopy. In short, after incubating the sample with a 10 μM probe for 30 minutes, cells were collected for fluorescence intensity detection. Fe2+, MDA, and GSH levels in NSCLC cells were analyzed using the Cellular Ferrous Ion Detection Kit, Malondialdehyde Detection Kit, and GSH Detection Kit, respectively. 1.10 Immunofluorescence staining NSCLC cells were loaded at 1×10 5 Cells were seeded at a density of 10 cells / well in 20 mm confocal culture dishes. After cell adhesion and appropriate treatment, the culture medium was carefully aspirated, and the cells were gently washed with PBS. Subsequently, cells were fixed with 4% paraformaldehyde at room temperature for 30 minutes, then permeabilized with 0.1% Triton X-100 for 5 minutes, and washed once with PBS. Next, cells were blocked with 1% BSA at room temperature for 60 minutes. After removing the blocking solution, a 1:100 dilution of primary antibody was added, and the cells were incubated overnight at 4°C. The next day, the primary antibody was aspirated, and the cells were washed with PBS. A 1:50 dilution of fluorescently labeled secondary antibody was then added, and the cells were incubated at room temperature in the dark for 1 hour. After washing with PBS, the cell nuclei were counterstained with ready-to-use DAPI staining solution in the dark for 15 minutes. Finally, the cells were washed three times with PBS, and the culture dishes were air-dried. 100 μL of anti-fluorescence quenching mounting medium was added. After the mounting medium dried, the samples were observed using a laser scanning confocal microscope. 1.11 Mitochondrial membrane potential assessment MMPs were detected using the Mitochondrial Membrane Potential Assay Kit with TMRE. NSCLC cells were co-incubated with 500 nM TMRE at 37°C for 30 minutes. Subsequently, the cells were washed three times with PBS, and the fluorescence intensity was detected by laser scanning confocal microscopy. 1.12 Aconitase Activity Assay Aconitase activity was determined using a commercially available aconitase activity assay kit, following the manufacturer's instructions. In short, NSCLC cells were homogenized on ice using a homogenizer or mortar. After sonication, the homogenate was centrifuged at 11,000 × g for 15 minutes at 4°C. The supernatant was collected, and the absorbance was measured at 240 nm using a microplate reader. Aconitase activity was calculated according to standard protocols. 1.13 ChIP ChIP detection was performed using a ChIP detection kit (Cell Signaling Technology) according to the manufacturer's instructions. In short, 80% confluent cells were fixed with formaldehyde (1% final concentration directly fixed in the culture medium) for 10 minutes. The cells were then centrifuged and lysed in 200 μl of membrane extraction buffer containing a mixture of protease inhibitors. The cell lysates were digested with MNase at 37°C for 30 minutes to obtain chromatin fragments, which were then sonicated (three cycles of sonication at 50% amplitude, 20 seconds on / 20 seconds off each) to produce DNA fragments of 100–500 bp in length. After centrifugation, the clear supernatant was diluted with the protease inhibitor mixture in 1×ChIP buffer (100:400), and 5% of the input control was separated and incubated overnight at 4°C with the primary antibody or the corresponding normal IgG antibody on a rotor. The next day, the IP reaction was incubated in ChIP-grade protein G magnetic beads for 2 hours, followed by bead precipitation and washing with low-salt and high-salt solutions sequentially. Chromatin was then eluted from the antibody / protein G beads by heating, and cross-linking was reversed. DNA was purified using a spin column and subjected to real-time PCR based on SYBR Green. 1.14 Xenotransplantation of Tumors BALB / c nude mice aged 4-6 weeks, obtained from Jicui Pharmaceutical Co., Ltd., were randomly divided into predefined groups. Corresponding stable cell lines were subcutaneously injected into the mice. Tumor volume was quantified at specified time points (days 5, 10, 15, 20, 25, and 30). Mice were sacrificed on day 30, and tumors were excised and weighed. Example 2 Result Analysis 2.1 Screening revealed that COX4I2 is a potential regulatory gene for tumor cell ferroptosis. To identify potential ferroptosis-related genes that may regulate non-small cell lung cancer (NSCLC), we analyzed differentially expressed genes (DEGs) between NSCLC and normal tissues in the GSE18842, GSE81089, and GSE19188 datasets, and performed a comprehensive analysis with the Ferraptosis-related gene dataset (Ferr DB), identifying seven candidate genes significantly associated with ferroptosis. Figure 1 A). Noting that COX4I2 is a lung tissue-specific gene, to assess its clinical relevance in lung cancer, we analyzed COX4I2 expression in the Cancer Genome Atlas (TCGA) dataset. We found that COX4I2 was significantly downregulated in lung cancer compared to patients with neighboring lung cancer (A). Figure 1 B), and low COX4I2 expression is associated with poor prognosis in NSCLC patients ( Figure 1 (C), indicating that COX4I2 has a potential tumor-suppressive effect in the progression of NSCLC. 2.2 COX4I2 overexpression promotes ferroptosis in tumor cells To investigate the expression pattern and function of COX4I2 in non-small cell lung cancer (NSCLC), we first examined the expression levels of COX4I2 in several NSCLC cell lines (A549, H460, PC9, H1299) and normal lung epithelial cells BEAS-2B. qRT-PCR and Western blot (WB) analysis showed that, compared to BEAS-2B cells, the mRNA levels of COX4I2 in all tested NSCLC cell lines were significantly lower. Figure 2 Both A) and protein (Supplementary Figure S1) expression were significantly downregulated. Based on the above expression profile, we selected PC9 (for overexpression studies) with relatively low COX4I2 expression levels and H460 (for knockdown studies) with relatively high expression levels for subsequent functional experiments. Figure 2 Functional experiments showed that COX4I2 expression significantly inhibited the malignant phenotype of NSCLC cells. Overexpression of COX4I2 in PC9 cells significantly reduced cell proliferation. Figure 2 D); Conversely, knockdown of COX4I2 in H460 cells significantly promoted cell proliferation (D). Figure 2 D). Colony formation experiments yielded completely consistent results: COX4I2 overexpression inhibition and knockdown enhanced the cell's colony-forming ability. Figure 2 E). Furthermore, wound healing and Transwell invasion assays confirmed that COX4I2 overexpression significantly inhibited cell migration and invasion, while knockdown produced the opposite effect. Figure 2 FG). To verify the tumor-suppressive function of COX4I2 in vivo, we further conducted animal experiments. The results showed that in a nude mouse xenograft model, overexpression of COX4I2 significantly inhibited tumor growth, specifically manifested as tumor volume reduction (FG). Figure 2 H), tumor volume decreased ( Figure 2 I) and tumor weight reduction ( Figure 2 In summary, these in vitro and in vivo experimental results collectively demonstrate that COX4I2 acts as a tumor suppressor in NSCLC, and its downregulation promotes tumor cell proliferation, migration, invasion, and colony formation. 2.3 Revealing the mechanism by which COX4I2 regulates ferroptosis molecules To further investigate the mechanism by which COX4I2 inhibits the malignant progression of non-small cell lung cancer, we screened its interacting proteins using tandem affinity purification mass spectrometry (TAP-MS) and found that COX4I2 has a potential interaction with CISD1, a protein that regulates iron metabolism in the outer mitochondrial membrane. Figure 3 A and Supplementary Figures). Combined co-immunoprecipitation (Co-IP) assays confirmed the tight binding of the two at both exogenous and endogenous levels. Figure 3 BD). Immunofluorescence (IF) results further showed that COX4I2 and CISD1 co-localized in the mitochondria of PC9 cells. Figure 3 E).

[0039] CISD1 functions by binding an unstable [2Fe-2S] iron-sulfur cluster to its CDGSH domain, and the stability of this process is highly dependent on its His87 site (the H87C mutation disrupts its function). We hypothesize that COX4I2 may mediate iron metabolism disorder by interfering with CISD1's function through its interaction. To test this hypothesis and identify the key interaction domains, we constructed a CDGSH domain deletion mutant (ΔCDGSH) and an H87C point mutant of CISD1. Figure 3 F). Co-IP results showed that the ΔCDGSH mutant could not bind to COX4I2, and more importantly, the H87C point mutation completely prevented their interaction. Figure 3 (G), indicating that the binding of COX4I2 to CISD1 depends not only on the CDGSH domain, but also directly on its iron-sulfur cluster-related functional sites.

[0040] Reversal experiments showed that, in the context of COX4I2 overexpression, co-transfection with wild-type CISD1 (CISD1-WT) effectively reversed key biochemical indicators of ferroptosis induced by COX4I2, including reduced ROS levels ( Figure 3 H), restores GSH content, reduces Fe²⁺ accumulation, and inhibits MDA production ( Figure 3 I). Consequently, the malignant phenotype of cell function was also significantly restored: overexpression of CISD1-WT significantly rescued cell viability (CCK-8 assay, Figure 3 J), clone formation ability ( Figure 3 K), cell migration (Transwell assay), Figure 3 L) and scratch healing ability ( Figure 3 Notably, the ΔCDGSH mutant and the loss-of-function CISD1 (H87C) mutant were completely unable to reverse any of the aforementioned phenotypes. These results demonstrate that COX4I2 interferes with the normal function of the CISD1 protein by binding to its functional site (His87), thereby disrupting intracellular iron homeostasis and ultimately inhibiting tumor progression by inducing ferroptosis. 2.4 Study on the function of COX4I2 ferroptosis regulatory genes To investigate the mechanism by which COX4I2 promotes ferroptosis, we focused on its impact on the function of CISD1, a core regulatory protein of mitochondrial iron metabolism. We hypothesize that COX4I2 may disrupt iron homeostasis by interfering with CISD1 function.

[0041] First, we examined key indicators of mitochondrial function. Compared with the control group, treatment with the CISD1-specific inhibitor NL-1 or overexpression of COX4I2 significantly reduced mitochondrial membrane potential ( ). Figure 4 A), leading to an abnormally high level of free ferrous ions in mitochondria ( Figure 4 B), indicating impaired mitochondrial function and iron overload.

[0042] To further investigate the sources of iron overload, we examined the activities of cytoplasmic and mitochondrial aconitase (ACO). ACO activity is a sensitive indicator of intracellular iron-sulfur cluster homeostasis. Figure 4 As shown in Figure C, NL-1 treatment or COX4I2 overexpression decreased cytoplasmic ACO1 activity, while mitochondrial ACO2 activity increased compensatorily. This contrasting trend suggests that COX4I2 overexpression may lead to defects in the assembly of cytoplasmic iron-sulfur clusters (resulting in ACO1 inactivation), while abnormal iron accumulation in mitochondria may indirectly promote mitochondrial ACO2 activity.

[0043] In addition, Western Blot results ( Figure 4 D) shows that both NL-1 treatment and COX4I2 overexpression upregulated the expression of the iron uptake protein TfR1 and downregulated the expression of the iron storage protein ferritin. This typical molecular manifestation further confirms the presence of an iron-deficient stress response in the cell. Combined with the aforementioned mitochondrial iron overload result, it reveals the core problem of a severe imbalance in cellular iron distribution (cytoplasmic "iron deficiency" and mitochondrial "iron overload"). 2.5 COX4I2 promotes ferroptosis by regulating CISD1 To clarify the functional relationship between COX4I2 and CISD1, we conducted a crucial genetic reversion experiment. First, we constructed a stable CISD1 knockout cell line (sg-CISD1) using CRISPR-Cas9 technology. Figure 5 A), COX4I2 was then overexpressed in the cell line and the control group, and four groups of cells were set up for comparison: empty vector control (VEC), COX4I2 overexpression (COX4I2-OE), CISD1 knockout (sg-CISD1), and CISD1 knockout combined with COX4I2 overexpression (sg-CISD1+COX4I2-OE).

[0044] Functional experimental results showed that, compared with the VEC group, both the COX4I2-OE group and the sg-CISD1 group exhibited significant inhibition of malignant phenotypes and activation of ferroptosis, specifically including decreased cell viability ( Figure 5 B) Reduced clone-forming ability ( Figure 5 C) Impaired cell migration ( Figure 5 DE and ROS levels increased ( Figure 5 F) and increased expression of ferroptosis markers (F) Figure 5 G).

[0045] Most importantly, in the context of CISD1 knockout, COX4I2 overexpression did not further exacerbate any of the aforementioned phenotypes. The sg-CISD1+COX4I2-OE group showed no significant difference in performance compared to the sg-CISD1 group. Figure 5 BG), and its effect is significantly weaker than COX4I2 overexpression alone.

[0046] To further verify the in vivo relevance of COX4I2's role through CISD1, we replicated the above genetic intervention in a nude mouse xenograft model. Animal results showed that, consistent with in vitro experiments, both COX4I2 overexpression and CISD1 knockout alone significantly inhibited tumor growth, manifested as tumor volume reduction. Figure 5 H), tumor volume reduction ( Figure 5 I) and weight loss Figure 5 Importantly, even in the context of CISD1 knockout, COX4I2 overexpression failed to produce additional tumor-suppressive effects. Figure 5 HJ).

[0047] This "non-additive effect" genetic phenomenon strongly demonstrates that the loss of CISD1 function completely blocks the biological effects of COX4I2, indicating that CISD1 is an indispensable key mediator downstream of COX4I2. Our data collectively show that COX4I2 inhibits mitochondrial function and disrupts iron homeostasis by regulating CISD1, ultimately inducing ferroptosis and inhibiting tumor progression. 2.6 IL-1β inhibits COX4I2 expression and promotes malignant phenotype of tumor cells. To investigate the effects of the tumor immune microenvironment on non-small cell lung cancer (NSCLC), we treated PC9 cells with physiological concentrations of key inflammatory cytokines (TNF-α, IFN-γ, IL-1β, and TGF-β). The results showed that IL-1β selectively and significantly downregulated the mRNA and protein expression of COX4I2, while other cytokines had a weaker effect. Figure 6 This phenomenon has been verified in multiple NSCLC cell lines (A549, H460, PC9, H1299). Figure 6 CD), suggesting that the inhibition of COX4I2 by IL-1β may be its universal function.

[0048] Functionally, IL-1β treatment significantly enhanced the malignant phenotypes of cells, including accelerated proliferation and enhanced migration. Crucially, concurrent IL-1β treatment with COX4I2 overexpression effectively reversed IL-1β-promoted cell proliferation and migration (Transwell assay). Figure 6 EG). Wound healing and clonogenic experiments further confirmed the above findings. Figure 6 (HJ). The data from these response experiments collectively demonstrate that the downregulation of COX4I2 expression is a key factor in IL-1β-driven malignant progression of NSCLC. 2.7 IL-1β inhibits COX4I2 expression and promotes malignant phenotype of tumor cells. To investigate the regulatory role of the inflammatory cytokine IL-1β in ferroptosis, we conducted four experiments (Ctrl, IL-1β, Erastin, Erastin + IL-1β). The results showed that IL-1β treatment significantly antagonized the effect of the ferroptosis inducer Erastin, specifically manifested as a decrease in ROS fluorescence intensity. Figure 7 A), and the depletion of GSH, Fe²⁺ accumulation, and MDA production were all reversed ( Figure 7 B). This result suggests that IL-1β has the function of inhibiting ferroptosis.

[0049] To clarify whether this function is mediated by downregulation of COX4I2, we set up another set of recovery experiments (Ctrl, COX4I2-OE, IL-1β, COX4I2-OE+IL-1β). The results showed that overexpression of COX4I2 effectively reversed the effect of IL-1β: partially restoring ROS levels (…). Figure 7 C), and completely removed the inhibition of IL-1β on ferroptosis indicators, that is, it re-initiated Fe²⁺ accumulation and MDA production, and promoted GSH depletion ( Figure 7 D). These data collectively confirm that IL-1β exerts its inhibitory effect on ferroptosis by downregulating COX4I2.

[0050] Next, we explored the epigenetic mechanism of IL-1β transcriptional silencing of COX4I2. Epigenetic analysis showed that IL-1β induced repressive chromatin remodeling in the COX4I2 promoter region, characterized by an increase in the repressive marker H3K27me3 and a decrease in the activating marker H3K27ac. Figure 7 Mechanistically, we found that IL-1β upregulated the expression of histone methyltransferase EZH2 at the mRNA level. Figure 7F). Treatment with the EZH2 inhibitor GSK126 effectively restored COX4I2 mRNA and protein expression (F). Figure 7 GH). Chromatin immunoprecipitation (ChIP) experiments further confirmed that IL-1β treatment enhanced the binding of EZH2 to the COX4I2 promoter, while GSK126 treatment weakened this binding. Figure 7 I).

[0051] In summary, this study reveals a novel IL-1β-EZH2-H3K27me3 epigenetic regulatory axis: IL-1β in the tumor microenvironment upregulates EZH2, enhancing its enrichment at the COX4I2 promoter and catalyzing the production of the repressive histone marker H3K27me3, thereby transcriptionally silencing COX4I2. Downregulation of COX4I2 ultimately inhibits ferroptosis, promoting the malignant progression of NSCLC. This provides important insights into how inflammatory signaling regulates cell death fate through epigenetic programming.

Claims

1. Application of COX4I2 in the preparation of drugs for non-small cell lung cancer.

2. The application as described in claim 1, characterized in that: The COX4I2 mentioned is one of the COX4I2 gene, COX4I2 protein, or COX4I2 overexpression vector.

3. The application as described in claim 1, characterized in that: The COX4I2 mentioned above promotes ferroptosis by regulating [Fe-S] transport function through the modulation of CISD1-VDAC1.

4. The application as described in claim 3, characterized in that: The COX4I2 interferes with the normal function of the CISD1 protein by binding to the functional site His87 of the CISD1 protein, thereby disrupting intracellular iron homeostasis and ultimately inhibiting tumor progression by inducing ferroptosis.

5. Application of COX4I2 in the preparation of mitochondrial iron overload formulations.

6. The application as described in claim 5, characterized in that: The COX4I2 mentioned is one of the COX4I2 gene, COX4I2 protein, or COX4I2 overexpression vector.

7. The application as described in claim 5, characterized in that: The COX4I2, through overexpression, upregulates the expression of the iron uptake protein TfR1 and downregulates the expression of the iron storage protein Ferritin.

8. Application of COX4I2 gene inhibitors in the preparation of agents that promote malignant tumor progression.

9. The application as described in claim 8, characterized in that: The promotion of malignant tumor progression refers to promoting and enhancing the proliferation, migration, invasion, and clonogenic ability of tumor cells; the COX4I2 gene inhibitor is a COX4I2 gene knockout plasmid, COX4I2 siRNA, or histone methyltransferase EZH2.

10. Application of EZH2 inhibitor GSK126 in the preparation of ferroptosis-promoting agents; wherein the EZH2 inhibitor GSK126 promotes ferroptosis by inhibiting the binding of EZH2 to the COX4I2 promoter, thereby increasing the gene expression of COX4I2.

Images