Rabbit source D-type pasteurella multocida and application thereof
By providing capsular D-type Pasteurella multocida for growth in serum-free culture medium, whole-cell inactivated antigens and immunization vaccines were prepared, solving the problems of the lack of D-type vaccines and high costs in the prevention and control of rabbit pasteurellosis, and realizing low-cost and high-efficiency vaccine development and animal model construction.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-26
- Publication Date
- 2026-04-10
AI Technical Summary
The current prevention and control of rabbit pasteurellosis faces problems such as the lack of type D vaccines, unstable protective effects of existing vaccines, and high costs, resulting in serious economic losses to the rabbit industry and threats to public health and safety. The high cost of existing culture technologies also limits the large-scale application of vaccines.
We provide a capsular D-type Pasteurella multocida strain (CCTCC NO: M 2024856) for growth in serum-free medium to prepare whole-cell inactivated antigens and immunization vaccines, construct a horizontal transfer model of drug resistance genes, and develop high-efficiency vaccines through low-cost culture technology.
It achieves low-cost breeding, provides highly efficient D-type vaccines to stimulate immune responses, has value in constructing animal models, reduces vaccine production costs, and enhances the disease prevention and control capabilities of the rabbit industry.
Smart Images

Figure CN121825824A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial technology, specifically relating to a rabbit-derived type D Pasteurella multocida strain and its applications. Background Technology
[0002] my country has long been the world's largest producer of rabbit meat, and its rabbit industry plays a crucial leading role in shaping the rabbit industry landscape in Asia and globally. However, the widespread prevalence of infectious rabbit diseases has become a core bottleneck restricting the high-quality development of my country's rabbit industry. Among these, rabbit pasteurellosis is a significant bacterial infectious disease affecting rabbit farming. Caused by Pasteurella multocida, it can lead to various clinical types in domestic rabbits, including rhinitis, pneumonia, otitis media, and septicemia. Rhinitis-related rabbits often suffocate due to nasal discharge blocking their nostrils; pneumonia-related rabbits frequently experience pulmonary consolidation and die from septicemia; otitis media-related rabbits can spread to the brain, causing neurological symptoms; and septicemia-related rabbits have a rapid onset and rapid death, often without obvious prodromal symptoms. This disease can occur year-round, with rabbits aged 2-6 months being particularly susceptible. It is most prevalent during the alternating hot and cold seasons of spring and autumn and can be transmitted through aerosols, respiratory tract, and digestive tract mucosa, exhibiting sporadic or endemic characteristics, causing severe economic losses to rabbit farming enterprises.
[0003] Pasteurella multocida is a Gram-negative cocci, a zoonotic pathogen that can infect various livestock, poultry, and wild animals. Based on differences in capsular antigens, it can be classified into five serotypes: A, B, D, E, and F. Recent epidemiological studies show a significant upward trend in the prevalence of rabbit pasteurellosis caused by capsular type D Pasteurella multocida. However, the prevention and control of rabbit pasteurellosis in China currently faces severe challenges: existing commercial vaccines are all combination vaccines against type A Pasteurella multocida, which, while providing protection against multiple diseases with a single vaccination, generally suffer from unstable protective efficacy and low protection rates. Furthermore, type A vaccines offer no cross-protection against type D Pasteurella multocida infection. A dedicated vaccine against type D Pasteurella multocida is currently lacking, leading to frequent outbreaks of the disease in rabbit farms. Rabbit farming enterprises have an urgent need for a highly effective type D Pasteurella multocida vaccine. In addition, current Pasteurella multocida culture techniques generally rely on serum-added culture media to maintain bacterial concentration, significantly increasing the cost of vaccine research and production and limiting the large-scale application of vaccines.
[0004] The frequent occurrence of rabbit pasteurellosis not only directly impacts the economic benefits of rabbit farming but also poses a potential threat to public health due to the zoonotic nature of Pasteurella multocida. With the continued rise in the prevalence of type D strains, the lag of existing control measures is becoming increasingly apparent: the lack of dedicated vaccines results in rabbit farms lacking targeted control tools, and the high cost of culture technology further restricts the development of new vaccines. Therefore, developing highly effective vaccines and low-cost culture technologies adapted to Pasteurella multocida type D has become a core issue urgently needing to be addressed for the healthy development of the rabbit industry. Summary of the Invention
[0005] Based on this, the purpose of this invention is to provide a capsular D-type Pasteurella multocida strain and its application. This strain is a capsular D-type Pasteurella multocida strain isolated from the lungs of a diseased rabbit. It is currently deposited in the China Center for Type Culture Collection, accession number: CCTCC NO: M 2024856.
[0006] To achieve the above objectives, the present invention can adopt the following technical solutions: In a first aspect, embodiments of the present invention provide a rabbit-derived type D Pasteurella multocida strain ( Pasteurella multocida (), its accession number is CCTCC NO: M 2024856.
[0007] Secondly, embodiments of the present invention provide a rabbit-derived Pasteurella multocida liquid or powder, wherein the rabbit-derived Pasteurella multocida liquid or powder includes the aforementioned rabbit-derived Pasteurella multocida.
[0008] Thirdly, embodiments of the present invention provide a whole-cell inactivated antigen, which is obtained by inactivation of the above-mentioned rabbit-derived Pasteurella multocida type D or the above-mentioned rabbit-derived Pasteurella multocida type D bacterial solution.
[0009] Fourthly, embodiments of the present invention provide a Pasteurella multocida immunization vaccine, which includes the above-mentioned whole-cell inactivated antigen, wherein the whole-cell inactivated antigen serves as an immunogenic antigen.
[0010] Preferably, the above-mentioned Pasteurella multocida immunization vaccine further includes an immune adjuvant.
[0011] Fifthly, embodiments of the present invention provide the application of the above-mentioned rabbit-derived Pasteurella multocida D or the above-mentioned rabbit-derived Pasteurella multocida D bacterial solution or powder as a recipient bacterium in constructing a horizontal transfer model of drug resistance genes.
[0012] Preferably, in the above applications, the drug resistance gene is mcr-1 Drug resistance genes.
[0013] Sixthly, embodiments of the present invention provide the application of the above-mentioned rabbit-derived Pasteurella multocida type D or the above-mentioned rabbit-derived Pasteurella multocida type D bacterial solution or powder in constructing an animal model of fibrinous pneumonia.
[0014] Seventhly, embodiments of the present invention provide the application of the above-mentioned whole-bacterial inactivated antigen as an immunogenic antigen in the preparation of Pasteurella multocida immunization vaccine.
[0015] The preservation information of rabbit-derived Pasteurella multocida type D in this invention is as follows: Preservation Center: China Center for Type Cultures; Accession number: CCTCC NO: M 2024856; Location of collection: Wuhan University, Wuhan, China; Deposit date: April 30, 2024; Classification and nomenclature: Pasteurella multocida 2024RDPm-hzz Pasteurella multocida 2024RDPm-hzz.
[0016] The beneficial effects of this invention include at least the following: (1) The rabbit-derived D-type Pasteurella multocida provided by this invention can grow normally in serum-free Martin medium, and the bacterial concentration can reach 1.16 × 10⁻⁶ under serum-free culture conditions in the laboratory. 10 With a CFU / mL concentration, its culture cost is lower compared to other rabbit-derived Pasteurella bacteria.
[0017] (2) The LD50 of rabbit-derived Pasteurella multocida D in ICR mice after 7 days is 8.22 × 10⁻⁶. 5 CFU; this strain can also cause death in New Zealand white rabbits and induce fibrinous pneumonia, thus possessing application value in constructing animal models of rabbit pasteurellosis.
[0018] (3) The rabbit-derived D-type Pasteurella multocida provided by the present invention has good immunogenicity. The whole-cell inactivated antigen can effectively stimulate the immune response of mice and induce the production of high-level antibodies, and has the potential to be developed into a vaccine.
[0019] (4) The rabbit-derived Pasteurella multocida genome provided by the invention has no mobile drug resistance genes and can be used as a recipient bacterium to construct a drug resistance gene horizontal transfer model. Attached Figure Description
[0020] Figure 1 An autopsy diagram of a rabbit that died from disease; Figure 2 PCR gel image for bacterial isolation and identification; Figure 3 The bacterial culture was prepared by shaking Martin broth for 11 hours without serum; Figure 4 The isolated strain induced fibrinous pneumonia in the lungs of New Zealand white rabbits; Figure 5 The study investigated the increase in IgG antibody levels in mice immunized with inactivated whole bacteria. Detailed Implementation
[0021] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.
[0022] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. Singular expressions include plural expressions unless they have a distinct meaning in the context. As used herein, it should be understood that terms such as “comprising,” “having,” “including,” are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials, or combinations thereof. The terminology of the invention is disclosed in the specification and is not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials, or combinations thereof may be present or added. As used herein, “ / ” may be interpreted as “and” or “or,” depending on the context.
[0023] To better understand the present invention, specific examples are provided below to further illustrate the content of the present invention, but the content of the present invention is not limited to the examples below.
[0024] Example 1 This invention provides a process for isolating and identifying rabbit-derived type D Pasteurella multocida.
[0025] (1) Dissection of dead rabbits Six dead rabbits exhibiting respiratory distress, rhinitis, depression, and loss of appetite were collected from a rabbit farm affected by pasteurellosis. These rabbits were transported to the laboratory for pathological dissection. Under aseptic conditions, diseased tissues, including the lungs and liver, were harvested. The pathological results are as follows: Figure 1 As shown, the results of the autopsy revealed that the lungs of the dead rabbits showed hemorrhage, congestion, and abscesses (see...). Figure 1 (A and B); fibrinous pericarditis (see A and B); Figure 1 (C) Liver hemorrhage, congestion and necrosis (see...) Figure 1 (D); some of the dead rabbits suffered from systemic organ hemorrhage (see D); Figure 1 (E).
[0026] (2) Isolation and culture of Pasteurella multocida (2-1) Prepare 5% sheep blood tryptone soy agar medium plates in advance: Weigh 20 g of tryptone soy agar medium powder, add distilled water to 500 mL, stir evenly, and put it into an autoclave at 121℃ for 15 min; after sterilization, take it out and wait for the temperature to drop to 50℃-55℃, add 26.3 mL of defibrinated sheep blood to the medium, mix slowly, and pour into plates.
[0027] (2-2) Heat the scalpel blade until red-hot and cauterize the surface of the lesion. Then, use a sterile inoculation loop to puncture the cauterized lesion and streak four zones on a 5% sheep blood TSA plate. Invert the streaked plate and place it in a 37°C constant temperature incubator for 48 hours. After a single colony grows, use a sterile inoculation loop to pick a single colony for purification. Then, pick a pure culture from the purified plate for Gram staining. Add 1 drop of physiological saline to the slide, pick a single colony, smear it, fix it, stain with oxalic acid crystal violet for 1 min, rinse with distilled water, add iodine solution to the crystal violet stained area for mordant staining for 1 min, rinse again with distilled water, spin dry the slide, add 95% alcohol for decolorization for 30 s, rinse with distilled water, counterstain with safranin for 1 min, rinse with distilled water, dry and examine under a microscope.
[0028] (3) Molecular biological identification (3-1) Using a sterile pipette tip, a single colony suspected to be Pasteurella multocida was picked and inoculated into a 5 mL tryptone soy broth shaker tube, which was then placed in a constant temperature shaking incubator at 37°C and 180 rpm for 24 h. The cultured bacterial solution was used as a template for PCR amplification of Pasteurella multocida. KMT1 Specific gene; the specific primer sequence is KMT1F (SEQ ID NO.2) upstream: ATCCGCTATTTACCCAGTGG, and KMT1R (SEQ ID NO.3): GCTGTAAACGAACTCGCCAC downstream, and the amplified target fragment size is 460 bp (BasePair).
[0029]
[0030] (3-3) After identification as Pasteurella multocida, further PCR amplification of Pasteurella multocida capsule type D was performed. dcbF The gene-specific primer sequence is capDF (SEQ ID NO.6): TTACAAAAGAAAGACTAGGAGCCC upstream and capDR (SEQ ID NO.7): CATCTACCCACTCAACCATATCAG downstream, amplifying the target fragment size of 657 bp, thereby screening for capsular D Pasteurella multocida.
[0031] In the above steps (3-1), (3-2) and (3-3), the total PCR amplification system is 30 μL, including 1.5 μL DNA template, 1.5 μL upstream specific primer, 1.5 μL downstream specific primer, 15 μL 2×TaqSuperMix enzyme, and 10.5 μL ddH2O. The PCR reaction program is set as follows: 95℃ pre-denaturation for 5 min → (95℃ denaturation for 15 s → annealing for 15 s → 72℃ extension for 40 s) × 34 cycles → 72℃ extension for 5 min → 4℃.
[0032] In addition, the amplification results were detected using an agarose gel electrophoresis imaging system, and the results are as follows: Figure 2 As shown. Figure 2 Lanes 1-40 in the middle A section represent Pasteurella multocida. KMT1 Genetic testing results showed that of the 40 selected single clones, 41 were positive controls and 42 were blank controls. Figure 2 The numbers 1-29 in B represent Pasteurella multocida type D. dcbF Gene amplification results: 30 is a positive control for Pasteurella D, and 31-32 are negative controls; M represents DNA Maker DL2000bp, manufactured by Takara.
[0033] Example 2 In the following examples, the serum-free culture method for rabbit-derived Pasteurella multocida type D is as follows: First, take one tube of glycerol bacteria stored at -80℃ and thaw it in a 37℃ water bath for no more than 1 minute. Then, use a sterile inoculation loop to pick up the bacterial solution and streak it onto a tryptone soy agar plate (four-zone streak method). After inoculation, invert the plate and place it in a 37℃ constant temperature biochemical incubator. After 24 hours, remove the plate; grayish-white and moist white colonies will be visible. Pick a single colony and streak it again (to ensure pure culture). Take a single colony and inoculate it into 5 mL of Martin broth (Solarbio), and incubate at 37℃ and 180 rpm for 16 hours with shaking. Transfer the culture to 1 L of Martin broth at a 1:1000 ratio and incubate in a constant temperature shaking incubator at 37℃ and 180 rpm for 11 hours (approximately 1.16 × 10⁻⁶).10 CFU / mL) (see CFU / mL) Figure 3 All inoculation procedures were performed in a BSC-II biosafety cabinet.
[0034] (1) Median lethal dose in ICR mice (1-1) First, resuscitate Pasteurella multocida type D, ensuring no more than 3 passages; pick a single colony and inoculate it into 10 mL of Martin broth medium, incubate at 37°C and 200 rpm for 12 h with shaking to obtain a bacterial suspension; take the above bacterial suspension, centrifuge at 5000 rpm for 5 min, discard the supernatant, and resuspend in an equal volume of PBS; according to the plate count method, the bacterial concentration is 1.3 × 10⁻⁶. 9 CFU / mL. Thirty 6-8 week old, 18-22 g, SPF-grade ICR mice were divided into 5 groups, as shown in Table 1.
[0035] Table 1 Grouping of mice in the challenge test
[0036] (1-2) Mice were fed normally for 7 days after challenge. Based on mortality, the median lethal dose (LD50) was calculated using the cumulative method, and the LD50 was 8.22 × 10⁻⁶. 5 Table 2 shows the mortality information of mice within 7 days after CFU administration. The median lethal dose (LD50) was calculated as follows: for every percentage point increase in mortality, the dose logarithm increased by 0.02; (6.4149 - 5.4149) ÷ (75 - 25) = 0.02; for a mortality rate increasing from 25% to 50%, the dose logarithm increased by 0.5; 0.02 × (50 - 25) = 0.5; Lg (LD50) = 5.41479 + 0.5 = 5.9149, taking the antilogarithm yields an LD50 of 8.22 × 10⁻⁶. 5 CFU.
[0037] Table 2. Mortality of mice 7 days after viral challenge.
[0038] (2) New Zealand white rabbit challenge experiment Resuscitate Pasteurella multocida type D, ensuring no more than 3 passages; pick a single colony and inoculate it into 10 mL of Martin broth, incubating at 37°C with shaking at 200 rpm for 12 h; centrifuge the bacterial suspension at 5000 rpm for 5 min, discard the supernatant, and resuspend in an equal volume of PBS; according to the plate count method, the bacterial concentration is 4.2 × 10⁻⁶. 9 CFU / mL; Four 8-week-old New Zealand white rabbits were used, and each rabbit was challenged by intrapleural injection of 1 mL. After observation, two rabbits died within 48 hours, and all rabbits died 80 hours after challenge. Fibrinous lesions appeared in the lungs. Figure 4 As shown.
[0039] Example 3 In the following examples, the serum-free culture method for rabbit-derived Pasteurella multocida type D is the same as in Example 2.
[0040] (1-1) Resuscitate Pasteurella D. Inoculate a single colony into 6 mL of Martin broth and incubate at 37°C with shaking at 200 rpm for 12 hours. Transfer 1% of the above bacterial suspension to 500 mL of Martin broth for further culture and incubate at 37°C with shaking at 200 rpm for 16 hours. The bacterial concentration is 3.6 × 10⁻⁶ according to the plate count method. 9 CFU / mL; the bacterial suspension was tested and found to be contaminated. 0.2% formaldehyde was added, and the suspension was incubated at 37°C with shaking at 100 rpm for 16 hours to inactivate the bacterial antigens (after formaldehyde inactivation). 100 µL of the inactivated bacterial suspension was evenly spread onto a TSA plate and incubated overnight at 37°C. If no colonies grew, the bacterial antigens were completely inactivated. The suspension was then centrifuged at 4°C for 15 minutes, the supernatant was discarded, and the suspension was resuspended in an equal volume of PBS. This process was repeated four times. The resuspended suspension was then diluted to four concentration gradients (1×10⁻⁶). 8 CFU / mL, 1×10 9 CFU / mL, 5×10 9 CFU / mL and 1×10 10 (CFU / mL).
[0041] (1-2) Twenty-five 6-8 week old, 18-22 g, SPF grade ICR mice were divided into 5 groups. The specific grouping is shown in Table 3.
[0042] Table 3 Immunization Groups
[0043] (1-3) After 3 days of pre-feeding, mice were subcutaneously inoculated on their backs with the corresponding concentration of inactivated antigen (0.2 mL / mouse) or PBS (control group). A second inoculation was performed 14 days after the first inoculation. Blood samples were collected 7 and 14 days after the second inoculation, and the serum content of Pasteurella multocida-specific antibodies was detected by indirect ELISA, as follows: 1) Pasteurella multocida whole-cell protein was added to the ELISA plate, coated with antigen overnight at 4°C, and washed; 2) The plate was blocked with skim milk, incubated at room temperature for 1 hour, and washed; 3) Diluted serum was added, incubated at room temperature for 1 hour, and washed; 4) Enzyme-labeled secondary antibody, HRP-labeled goat anti-mouse IgG antibody (Abcam), was added, incubated at room temperature for 1 hour, and washed; 5) TMB substrate solution was added, and the reaction was developed for 7 minutes; 6) The reaction was terminated by adding stop solution, and the plate was read at OD450 nm using a spectrophotometer, and the results were recorded. The results are as follows. Figure 5 As shown.
[0044] Example 4 First, total DNA was extracted from the isolated strains using a bacterial genome extraction kit. The purity and integrity of the DNA were then assessed using agarose gel electrophoresis, and quantification was performed using Qubit. DNA samples that passed electrophoresis were randomly fragmented into approximately 350 bp fragments using a Covaris ultrasonic disruptor. After processing, the DNA fragments were used in the NEBNext® Ultra™ DNA Library Prep Kit for Illumina (NEB, USA) for end repair, A-tailing, sequencing adapter addition, purification, and PCR amplification to prepare the entire library. After library construction, preliminary quantification was performed using Qubit 2.0, diluting the library to 2 ng / µL. Subsequently, the insert fragments in the library were detected using an Agilent 2100. If the results met expectations, the effective concentration of the library was accurately quantified using Q-PCR to ensure library quality. After passing the library detection, different libraries were sequenced using Illumina NovaSeq PE150 according to their effective concentration and target data volume.
[0045] The raw sequencing data contained a certain proportion of low-quality data, which was filtered using FASTP software. Using Kraken2 software and the PlusPF database (https: / / benlangmead.github.io / aws-indexes / k2), the effective whole-genome sequencing data of the samples were used for bacterial species identification, which yielded *Pasteurella multocida* (99.74%). Unicycler software was used for genome assembly, followed by alignment, annotation, and other analyses. Phigaro software was used to predict prophages on the sample genome; ICE finder software was used to detect inserted sequences in the genome; and Island Path-DIOMB software was used to predict gene islands. The CARD database was used to predict potential antibiotic resistance genes in the genome.
[0046] A draft genome of *Pasteurella multocida* was finally obtained and uploaded to the GenBank database (accession number: JBHMQW000000000), with a genome size of approximately 2.2 Mbp. Whole-genome analysis revealed that the strain's genome contains a prophage and a gene island, belonging to the ST11 genotype, and no mobile resistance genes were detected. This indicates that the rabbit-derived *Pasteurella multocida* D strain in this invention is the ST11 type and does not contain mobile resistance genes.
[0047] Example 5 To carry mcr-1The gene-producing *E. coli* was used as the donor bacterium, and *Pasteurella multocida* was used as the recipient bacterium. A nitrocellulose membrane (0.22 µm pore size) was used as the carrier for construction. mcr-1 Drug resistance gene conjugation transfer model. First, donor and recipient bacteria were cultured to the logarithmic growth phase. Then, nitrocellulose membranes were cut to a size of 1-2 cm. 2 After autoclaving, four nitrocellulose agar plates were placed flat on tryptone soybean agar plates using sterile forceps. Donor and recipient bacteria from several growth stages were mixed at a 1:1 volume ratio and allowed to stand for 10 minutes. 80 µL of the bacterial culture was then dropped onto a nitrocellulose membrane. Simultaneously, 40 µL of donor bacteria and 40 µL of recipient bacteria were dropped onto two separate nitrocellulose membranes. 80 µL of culture medium was dropped onto one nitrocellulose membrane as a blank control. The plates were incubated at 37°C for 12 hours. Using sterile forceps, the four nitrocellulose membranes were transferred to sterile centrifuge tubes, 1 mL of PBS was added, and the mixture was vortexed and repeatedly rinsed with a pipette. 100 µL of the bacterial culture was serially diluted 10-fold with 900 µL of PBS and spread onto plates containing polymyxin E (4 µg / mL). The plates were incubated at 37°C for 12 hours. PCR screening was then performed to identify carriers. mcr-1 The single Pasteurella multocida gene is the conjugate. This indicates that the rabbit-derived type D Pasteurella multocida in this invention can serve as a recipient bacterium for conjugation. mcr-1 A conjugation transfer model was established using Escherichia coli.
[0048] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. A rabbit-derived type D Pasteurella multocida strain ( Pasteurella multocida ), characterized in that, The preservation number is CCTCC NO: M 2024856.
2. A rabbit-derived D-form Pasteurella multocida bacterial broth or powder, characterized in that, The rabbit-derived Pasteurella multocida strain D or the bacterial powder comprises the rabbit-derived Pasteurella multocida strain D of claim 1.
3. A whole-bacterium inactivated antigen, characterized in that, The whole-bacterium inactivated antigen is obtained by inactivating the rabbit-derived Pasteurella multocida strain D of claim 1 or the rabbit-derived Pasteurella multocida strain D bacterial liquid of claim 2.
4. A Pasteurella multocida immunization vaccine, characterized by, The whole-bacterium inactivated antigen comprises the whole-bacterium inactivated antigen of claim 3, and the whole-bacterium inactivated antigen is used as an immune antigen.
5. The Pasteurella multocida immunizing vaccine according to claim 4, characterized in that, The Pasteurella multocida immune vaccine further comprises an immune adjuvant.
6. The rabbit-derived Pasteurella multocida strain of claim 1 or the rabbit-derived Pasteurella multocida strain D bacterial liquid of claim 2 is used as a receptor bacterium in constructing a drug resistance gene horizontal transfer model.
7. Use according to claim 6, characterized in that, Drug resistance genes mcr-1 Drug resistance genes.
8. The rabbit-derived Pasteurella multocida strain of claim 1 or the rabbit-derived Pasteurella multocida strain D bacterial liquid of claim 2 is used in constructing a cellulose pneumonia animal model.
9. The whole-bacterium inactivated antigen of claim 3 is used as an immune antigen in preparing a Pasteurella multocida immune vaccine.