Group of nocardia seriolae mycolic acid synthase genes and construction and application method of deletion strain of nocardia seriolae mycolic acid synthase genes

The whole genome of *Nocardia amberjack* was extracted using a lysozyme-ultrasonic disruption method. Homologous arm primers were designed for PCR amplification, and the gene fragment was spliced ​​using overlap PCR. The fragment was then electrotransformed into *E. coli* S17-1 competent cells, and the cell disruption process was optimized to construct a genetically stable deletion strain. This method solved the problem of insufficient analysis of the synergistic function of key genes for mycolic acid synthesis in *Nocardia amberjack*, and achieved efficient transformation and construction of a low-virulence deletion strain. This provides a safe and immunogenic attenuated vaccine candidate strain for the prevention and control of nocardiosis in fish.

CN121825842APending Publication Date: 2026-04-10GUANGDONG OCEAN UNIVERSITY +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GUANGDONG OCEAN UNIVERSITY
Filing Date
2026-01-13
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

In the existing technology, the synergistic function analysis of key genes for mycolic acid synthesis in Nocardia amberjack is not in-depth, the conversion efficiency of deletion strains is low and the purity is insufficient, there is a lack of strategies for constructing multi-gene combined deletion strains, and there is a lack of attenuated vaccine candidate strains that have both safety and immunogenicity, making it difficult to effectively control Nocardiasis in fish.

Method used

The whole genome was extracted using a lysozyme-ultrasonic disruption method. PCR amplification was performed using primers with homologous arms containing Mlu I/Xba I restriction sites. Overlap PCR was used to splice the gene fragment, which was then ligated into the pMD18T vector. The fragment was transformed into DH5α competent cells and electrotransformed into E. coli S17-1 competent cells. The cell disruption and electrotransformation parameters were optimized to construct a genetically stable deletion strain, which was then verified through multidimensional identification.

Benefits of technology

We have successfully constructed a high-purity, genetically stable deletion strain with low toxicity and no granuloma induction ability. As a candidate strain for attenuated vaccines and a screening model for inhibitors, this breakthrough overcomes the antibiotic dependence of existing prevention and control technologies and provides a theoretical basis and practical support for targeted prevention and control technologies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121825842A_ABST
    Figure CN121825842A_ABST
Patent Text Reader

Abstract

The invention discloses a group of nocardia seriolae mycolic acid synthase genes and a construction and application method of a deletion strain of the nocardia seriolae mycolic acid synthase genes, and belongs to the technical field of disease prevention and control. Comprising the following steps: strain culture and whole genome extraction, specific primer design and gene fragment cloning, deletion plasmid construction, competent cell preparation, electrotransformation and deletion strain screening, and deletion strain characteristic verification. By analyzing the synergistic function of nocardia seriola seriola mycolic acid synthesis key genes, the core effect of the nocardia seriola seriola mycolic acid synthesis key genes in a synthesis pathway is clear to fill the blank of multi-gene association research, and a core theoretical basis is provided for revealing the pathogenic mechanism of nocardia seriola seriola mycolic acid.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of disease prevention and control, in particular to a group of mycobactin synthase genes of Nocardia seriolae and a construction and application method of a deletion strain of the genes. BACKGROUND

[0002] Fish nocardiosis is a chronic granulomatous disease caused by infection of Nocardia bacteria, which is often called "sarcoidosis" in aquaculture as a zoonosis, and Nocardia seriolae is the most important pathogenic bacterium causing the disease. Mycobactin, as the core component of the cell wall of Nocardia seriolae, is an important virulence factor of the bacterium. Mycobactin not only forms a hydrophobic barrier to protect the bacterium from the host immune system and antibiotic attack, but also realizes immune escape by inhibiting the fusion of macrophage phagosome and lysosome, and is a key factor for the host to form granulomatous lesions. Therefore, it is necessary to further explore the key genes related to mycobactin synthesis of Nocardia seriolae and the functions of the genes.

[0003] A patent document with the authorized publication number CN117645947B discloses "a strain of Nocardia seriolae and its application". The Nocardia seriolae is Nocardia seriolae B20200724 strain, and the preservation number is CCTCCM20231950. A nano-soaking vaccine prepared by using the strain can prevent the sarcoidosis of large-mouth bass caused by Nocardia seriolae. The vaccine itself is non-toxic, and the relative immune protection rate is 73.3%, which can be applied to the prevention of Nocardia seriolae disease of large-mouth bass in the breeding process, reduces the incidence of the disease, and reduces the economic loss in the production process.

[0004] A patent document with the authorized publication number CN112831548A discloses "a prevention and control method for Nocardia seriolae disease of California bass". The method uses a magnetic bead method virus DNA / RNA nucleic acid extraction kit (LBTVDEK), uses a 16-hole fluorescence quantitative PCR instrument (LBT16QPCR) and its matching equipment, and uses PCR fluorescence probe technology to quantitatively detect the specific DNA nucleic acid fragments of Nocardia seriolae. The method is simple and rapid, has good specificity, and has high sensitivity.

[0005] Although the prior art has realized rapid detection or vaccine prevention of partial farmed fish nocardiosis, the prior art does not deeply analyze the synergistic function of key genes (HadAB, InhA, MabA and KasA) of mycolic acid synthesis of cobia Nocardia, the construction of deletion strains mostly adopts a single wall breaking method and fixed electroporation parameters, there are problems of low transformation efficiency and insufficient purity, and there is a lack of construction strategies of multi-gene combined deletion strains, and the prevention and control technology relies on antibiotics and improvement of the breeding environment, and there is no development of targeted prevention and control means based on the mycolic acid synthesis pathway, and there is a lack of attenuated vaccine candidate strains with safety and immunogenicity, which is difficult to effectively respond to the breeding risk and economic loss caused by fish nocardiosis. SUMMARY

[0006] The present application mainly provides a set of construction and application methods of cobia Nocardia mycolic acid synthetase genes and deletion strains thereof, which can solve the problems raised in the above background art.

[0007] To achieve the above-mentioned purpose, the present application provides the following technical scheme: a set of construction and application methods of cobia Nocardia mycolic acid synthetase genes and deletion strains thereof, comprising: S1, after recovering and culturing the wild strain ZJ0503 of cobia Nocardia, the whole genome is extracted by using the lysozyme-ultrasonic wave breaking combined method; S2, based on the nucleotide sequence of the cobia Nocardia mycolic acid synthetase gene, the Primer-BLAST tool of NCBI is used to design the upstream and downstream homologous arm primers containing Mlu I / Xba I enzyme cutting sites, the upstream and downstream homologous arm fragments of each gene are amplified by PCR, and the PCR products are recovered and purified after 1% agarose gel electrophoresis detection; S3, the upstream and downstream homologous arms of each gene are spliced by using Overlap PCR, and then subjected to Mlu I / Xba I double enzyme cutting and ligation with pMD18T vector, and the positive clones are screened by transforming DH5α competent cells, and then subjected to double enzyme cutting and ligation with pRE112 plasmid, and the recombinant deletion plasmid is obtained by verifying with CM-F / R primers by transforming E.coli S17-1 competent cells; S4, the ZJ0503 is cultured to the logarithmic phase, and then subjected to grinding and dispersion, Tween-80 dispersion, ethionamide, glycine and lysozyme synergistic wall breaking treatment, and then resuspended after being washed 4-6 times with pre-cooled 10% glycerol, and then the competent cells are prepared; S5, the recombinant deletion plasmid and the competent cells are incubated in an ice bath for 30 min, and then subjected to electroporation under the conditions of voltage 400V, pulse 5000-10000 ms, frequency 30 times, and interval 1000 ms, and then coated on BHI medium containing 20 µg / mL chloramphenicol resistance after recovery, and then subjected to plasmid elimination by 10% sucrose, and then subjected to double PCR identification by using cobia Nocardia specific primers 659-F / R and target gene overlapping primers, and then the deletion strain is obtained. S6, genetic stability verification, mycolic acid synthesis ability detection, bacterial morphology observation, LD 50 Determination and histopathological analysis to confirm the characteristics of the deletion strain.

[0008] Furthermore, in S1, the wild strain of Nocardia seriolae ZJ0503 is thawed in a constant temperature water bath at 28°C, inoculated into BHI solid culture medium, and cultured at 28°C for 3-5 days. When extracting the whole genome, the logarithmic phase bacteria are collected and lysozyme is added, and then the bacteria are broken by ultrasonic wave breaker.

[0009] Furthermore, in S2, 2x Taq PCR Master Mix reagent is used for PCR amplification, the length of the upstream and downstream homologous arm fragments is 500bp, the annealing temperature of PCR amplification is 60±0.5°C, and GeneJET gel recovery kit is used for recovery and purification.

[0010] Furthermore, in S3, the forward primer of the upstream fragment and the reverse primer of the downstream fragment are used as the primer pair for overlap PCR, and the LB plate containing ampicillin is used for coating after transforming the DH5a competent cells. M13-F / M13-R primers are used for colony PCR verification.

[0011] Furthermore, in S4, the final concentration of Tween-80 is 0.05%, and the synergistic wall breaking treatment is to add ethionamide, glycine and lysozyme in sequence for 1-2h, and then to culture at 28°C for 12h with 150rpm shaking. 10% glycerol is used to maintain the whole process at 4°C low temperature. The competent cells are divided into 100µL per portion and stored at -80°C.

[0012] Furthermore, in S5, 100µL pre-warmed BHI medium is added after electroporation, and the cells are recovered at 28°C with 150rpm shaking for 2-4h. The negative control includes electroporation of competent cells without plasmid and competent cells without electroporation. All samples are cultured at 28°C for 7-14 days.

[0013] Furthermore, in S6, the genetic stability verification is continuous passage for 30 generations, PCR verification is performed using overlap primers and Nocardia seriolae specific primers, mycolic acid synthesis ability detection is performed using thin layer chromatography, developing agent is n-hexane / ether, 0.5% iodine-methanol coloration, bacterial morphology observation includes gram staining, scanning electron microscope and transmission electron microscope observation, and LD 50 The hybrid snake is used as the experimental object, and the LD

[0014] Further, the mycolic acid synthetase genes of the Nocardia seriolae include HadAB gene, InhA gene, MabA gene, KasA gene.

[0015] The beneficial effects of the method for constructing and applying the group of mycolic acid synthetase genes of Nocardia seriolae and the deletion strain thereof are as follows: by analyzing the synergistic function of the key genes of mycolic acid synthesis of Nocardia seriolae, the core role of the genes in the synthesis pathway is determined, the blank of multi-gene correlation research is filled, and a core theoretical basis for revealing the pathogenic mechanism of the bacteria is provided; in the construction of the deletion strain, the optimized "grinding, Tween-80 dispersion, three reagents synergistic wall breaking" competent preparation process combined with customized electrotransformation parameters covers multi-dimensional identification and verification links, and high-purity genetically stable deletion strains can be accurately obtained, the links are closely connected, and the operation is standardized, the transformation efficiency and the quality of the deletion strain are significantly improved, it is convenient for other researchers to reproduce, and the deletion strain has the characteristics of low virulence and no granuloma induction ability, can be used as an attenuated vaccine candidate strain and an inhibitor screening model, and helps to break through the limitation of existing prevention and control of fish Nocardia disease which relies on antibiotics, and provides a strong theoretical basis and practical technical support for the development of targeted prevention and control technology. BRIEF DESCRIPTION OF DRAWINGS

[0016] The application will be further described in detail below with reference to the drawings and specific implementation methods.

[0017] Figure 1 The method flowchart of the method for constructing and applying the group of mycolic acid synthetase genes of Nocardia seriolae and the deletion strain thereof; Figure 2 The characteristic analysis schematic diagram of the method for constructing and applying the group of mycolic acid synthetase genes of Nocardia seriolae and the deletion strain thereof; Figure 3 The mycolic acid synthesis situation schematic diagram of the method for constructing and applying the group of mycolic acid synthetase genes of Nocardia seriolae and the deletion strain thereof; Figure 4 The survival rate record schematic diagram of the method for constructing and applying the group of mycolic acid synthetase genes of Nocardia seriolae and the deletion strain thereof 15 days after challenge hybrid snakeheads; Figure 5 The histopathological change schematic diagram of the method for constructing and applying the group of mycolic acid synthetase genes of Nocardia seriolae and the deletion strain thereof.

[0018] Figure 6 The key gene synergistic function schematic diagram of the method for constructing and applying the group of mycolic acid synthetase genes of Nocardia seriolae and the deletion strain thereof. DETAILED DESCRIPTION

[0019] To make the technical solutions of the present application clearer, the present application is further described in detail below in combination with the drawings and specific embodiments.

[0020] Embodiments As shown in Figures 1-6 , a technical solution is provided: a set of Nocardia seriolae mycolic acid synthetase genes and a method for constructing and applying a deletion strain thereof, comprising the following steps: Strain culture and whole genome extraction: The Nocardia seriolae wild strain ZJ0503 glycerol strain was taken out from the -80℃ refrigerator, wrapped with gloves, and slowly melted in a 28℃ constant temperature water bath. In a sterile clean bench, the bacterial liquid was inoculated into BHI solid culture medium using plate streaking method, sealed with a sealing film, and cultured at 28℃ for 3-5 days for recovery. The growth of light yellow colonies in the plate was observed regularly. After recovery, a single colony was picked up with a toothpick into an EP tube containing 1.5mL BHI liquid medium under sterile conditions in a clean bench, and transferred to a 28℃, 150rpm / min constant temperature shaker for expansion culture for 3-5 days until a uniform bacterial suspension was formed. After the bacterial liquid reached the logarithmic growth phase, the bacteria were collected by centrifugation at 12000rpm / min for 10min, and the bacterial liquid was removed to reserve the precipitate for use. The whole genome was extracted according to the steps of the bacterial genome DNA extraction kit (DP302) instruction manual. After adding lysozyme, the bacteria were broken with an ultrasonic cell crusher (power 200W, working cycle 3s crushing / 5s pause) to improve the DNA extraction rate. The extracted whole genome was stored at -20℃ for later use as a template for PCR amplification.

[0021] Specific primer design and gene fragment cloning: Based on the nucleotide sequence of Nocardia seriolae mycolic acid synthetase genes (HadAB, InhA, MabA, KasA), the Primer-BLAST tool on the NCBI website was used to design upstream and downstream homologous arm primers containing Mlu I / Xba I restriction sites. The primer sequences are shown in Table 1 below: Table 1 Primer name Primer name 5' - 3' sequence Sequence (5′ −3′) Action Function HadAB-U F TCTTCCGGAGACTGTCATACGCGTCGGCGGACCAGTTCAACGGC amplified 500 bp upstream of HadAB HadAB-UR GCTCTTCGGTTTCGGGGTCGGTGTTCAGCTCCCTGCA HadAB-D F TGCAGGGAGCTGAACACCGACCCCGAAACCGAAGAGC amplified 500 bp downstream of HadAB HadAB-DR GCCCGATCCCAAGCTTCTTCTAGAGTCACCGCCACACCGGTTGTG InhA-U F TCTTCCGGAGACTGTCATACGCGTACGCCAACCTGACCGGTGC amplified 500 bp upstream of InhA InhA-UR CAGAACTCGAAAACTACCCGGATCCAGCCATGGGGTGGTC InhA-D F GACCACCCCATGGCTGGATCCGGGTAGTTTTCGAGTTCTG amplified 500 bp downstream of InhA InhA-DR GCCCGATCCCAAGCTTCTTCTAGAGCGGATGGTCGAAATACT GMabA-U F TCTTCCGGAGACTGTCATACGCGTGGTCAGGGCTTCAAGATCGC amplified 500 bp upstream of MabA MabA-UR CTCCCGAGAGTTGGGCCTGGGAGGTGAATCTCCCTGTC MabA-D F GACAGGGAGATTCACCTCCCAGGCCCAACTCTCGGGAG amplified 500 bp downstream of MabA MabA-DR GCCCGATCCCAAGCTTCTTCTAGAAGCTTTGCGGTGGTGCGCA KasA-U F TCTTCCGGAGACTGTCATACGCGTCGCACTGCTACGCCGAAC amplified 500 bp upstream of KasA KasA-UR CGGTCATGGTGTCTCCGTGGCCGGGAGTCCTGTCGGTC KasA-D F GACCGACAGGACTCCCGGCCACGGAGACACCATGACCG amplified 500 bp downstream of KasA KasA-DR GCCCGATCCCAAGCTTCTTCTAGACAGGTACATCGGGACCAGCA PCR amplification was performed with 2 x Taq PCR Master Mix (with dye) reagent, the annealing temperature was set at 60±0.5℃, the length of the upstream and downstream homologous arm fragments was 500 bp, the amplification products were detected by 1% agarose gel electrophoresis, the target band was purified by GeneJET Gel Recovery Kit, and then stored at -20℃ for standby, and all primer synthesis and PCR product sequencing were completed by Guangzhou Bioengineering Co., Ltd. The complete nucleotide sequences of the HadAB, InhA, MabA and KasA genes of Nocardia seriolae verified by sequencing are shown as follows: >HadAB >InhA ATGAAAACTACCCGGATCAGTTGGCGCCGAAGCCGTCCGCGGGGAACCAGGTGTTGTGCGAGGCGCCGCCGTCGACGTAGATGATCGAACCGGTGGTGCCCGGCAGCCAATCCGAGAGCAGCGTCACCACGGACTTGGCGACCACGGTCGGGTCGTCGACGTCCCAGCCGATCGGGGACGCGCCGTCCCAGTAGGTGTTGAGCATGTTCAGCTGCTTGGCGTCATCGGTGGCGGTGCCCGCGATGGCCTTGGCGGCCAGGGTCTTGATCGGACCCGCCGCGATCAGGTTGGAGCGAATCTTCTTGGCCTCGCCCACCTCCCGCGCCACGTACCGGTTCACCGACTCGAGCGCGGCCTTGGCCACACCCATCCAGTTGTAGTACGGCATGGCGGTGCGCGGGTCGAAGTCCATGCCCACGATGGAGCCGCCCTCGTTCATGACCGGCAGCACCGCGCGGGCCAGCGAGGCGTAGGACCACGCCGAGATCTCGAAGGCCTTGGCGGCGTCGGGACCCGGGCCGTCCAGGAACGGCATGGCCTCCGGGCCCATCAGGGTGCGCGGCGCGAACGCGATGGAGTGCAGCACGCCGTCGACGCCCTCGGGCGCCAGCTCGCGGACCTTGTCGGCCAGCTCGGCCAGGTTCTCCTCATTGGTCACGTCCAGGCCGATGGCCGGGGGGACCTCCTGCGGCAGGCGCTTGGCGATGCGGTCGATGAGCCGCAGGCGCTCCGGGATACCGGTGATGATGACCTTCGCGCCCTGCTCCTGCGCGACCGCGGCCGCGTGGAAGGCGATGGACGAGTCGGTGATGATGCCGGTGATGAGGACGGTTTTGCCGTCGAGCAATCCAGCCATGA; >MabA ATGTCGAAAGTCGCAGTCGTGACCGGCGCCGCCCGCGGCATCGGCGCGGGCACCGCCGCCCGCCTGGCCGCCGACGGATTCGCCGTCGCCATCGTCGATCTCGACGAGGCGGCCTGCAAGGACGCGGTGGACGCCATTGTCGCCAAGGGCGGCAAGGCCATCGCGGTGGGCTGCAATGTCACCGACGAGACGCAGGTCGCGGCCGCGTTCGAACGCGTTGCGGCGGAACTGGGTTCGGTCGACGTACTGGTCAACAATGCCGGCGTGCTGCGCGACAACCTGCTGTTCAAGATGTCGGTGGACGACTGGGACATCGTGATGTCGGTGCACCTCAAGGGCGCGTTCCTGTGCTCGCGCGAGGCGCAGAAGTACATGGTGAAGCAGAAGTCCGGCAAGATCGTGAACACCTCCAGCGTGTCGGCGCTGGGTGCGCGCGGGCAGGCCAACTACTCGGCCGCCAAGATGGGTATCCAGGGGCTGACCCGTACGCTGGCAATGGAATTGGGGCCGTTCGGCATCAATGTCAATGCCGTCGCGCCCGGGTTCATCGTCACCGAGATGACCGATGCCACCGCCGCCCGGGTGGGAGTCTCGCCCGAGGAATTCCGCGCCGAGGCCGCCAAGATCACCCCGCTGCGTCGCGTCGGCGAACCGGCCGACATCGCGAACGTCGTTTCCTTCCTGGTCTCCGACGATGCCTCCTTCGTCACCGGCCAGACCATTTACGTCGACGGCGGACGCCGTCTCTGA; KasA ATGACTGGCGCGGTGGACGGCGATCGCCCCGCTGTGGAGGCCATCCTGGCCGATCGTGCGCTGACAGTGGTGCGCGCAGCGGAGATTCCGGATCCGGTCGCCTTGGCCGGGGCGCTGGCCGGGGCCGGAATCCGGGCGTTGGAACTGACATTCACCACGCCCGGGGTGCTGGACGGCATTCGCAAGATCGCCGACTCCGGCGTCGGGGTGATCGGGGCGGGCACCGTGCTCACCCGGGGCCAGGCCGAATCGGCCATCGAGGTCGGGGCGCGGTTCCTGGTGACGCCGGGACTCACTGAGCAGGTCGCCGAGGTGGCCGCGAAACACGAGATCCCGGTCGTGATGGGCGCTTTCACGCCGTCGGAGGTGATGCGCGCCATGGAGCTGGGTGCGGCCGCGGTCAAGATCTTCCCCGCCCGGGCGCTCGGGCCGGGCTATCTGAAGGACCTGCGCGGTCCCTTCCCGAACGTCCGCCTGATCCCCTCCGGCGGGGTCAACGCGGGCAATGCCGCCGACTTCCTCGCCCACGGGGCGGTGGCGGTCACCGCCGGAACCGATGTCGTGCCGCCGGCCGCCGTGGCGGCGGGCGAATGGGCCGAAATTGCCTCGCGCGCGGCCGCATTCGTTCGAGCTCTGAACTGA.

[0022] Deletion plasmid construction: The purified upstream and downstream homologous arm fragments of each gene were spliced by Overlap PCR technology. The forward primer (UF) and reverse primer (DR) of the upstream and downstream fragments were used as the primer pair for amplification. The amplified products were analyzed by 1% agarose gel electrophoresis, and the bands with the expected size (about 1000 bp) were selected and purified using a GeneJET gel recovery kit. The purified recombinant fragments were treated with Mlu I / Xba I double enzyme digestion, and the enzyme digestion products were subjected to a ligation reaction at 4°C for 16 hours. Then, the ligation products were transformed into DH5α competent cells, and the transformation liquid was uniformly coated on the surface of LB selective medium containing ampicillin. After 4-7 hours of inverted culture at 37°C, single colonies were picked and inoculated into LB liquid medium for expansion culture to the logarithmic growth phase. Colony PCR was performed using universal primers M13-F / M13-R, and the positive clones were obtained after sequencing to confirm the accuracy of the target sequence. Then, the E. coli S17-1 strain containing the pRE112 plasmid stored at -80°C was inoculated into LB liquid medium containing 20 μg / mL chloramphenicol for activation and expansion culture. The pRE112 plasmid was extracted using an endotoxin-free plasmid extraction kit, and the pRE112 plasmid and the above-mentioned recombinant fragments were subjected to Mlu I / Xba I double enzyme digestion, respectively. The purified enzyme digestion products were subjected to a directional ligation reaction at 4°C for 16 hours. The ligation products were introduced into E. coli S17-1 competent cells by heat shock transformation, and the recovered culture was coated on a chloramphenicol-resistant LB plate after 2 hours of recovery culture. Single colonies were picked for short-term pre-culture, and PCR verification was performed using CM-F / R primers. Finally, a series of recombinant deletion plasmids pRE-ΔHadAB, pRE-ΔInhA, pRE-ΔMabA, and pRE-ΔKasA were successfully constructed.

[0023] Preparation of competent cells: The ZJ0503 strain of Nocardia seriolae frozen at -80°C was inoculated into BHI agar medium, and incubated at 28°C for 4-5 days to complete recovery. A typical single colony was selected and inoculated into a 1.5 mL EP tube containing 800 μL of BHI liquid medium. The tube was incubated at 28°C with shaking at 150 rpm / min for 3-5 days to the logarithmic growth phase. Meanwhile, the bacterial suspension was mechanically broken (intensity level 7) in a sterile grinding bead in a clean bench to eliminate bacterial aggregation. Pre-sterilized Tween-80 was added to the BHI medium to a final concentration of 0.05% to promote bacterial dispersion. The uniformly dispersed bacterial solution was incubated at 28°C and 150 rpm / min to the logarithmic phase (about 3 days). Ethionamide, glycine, and lysozyme were added sequentially for 1-2 h of synergistic wall breaking treatment. Then the solution was further incubated for 12 h, and the supernatant was removed by centrifugation at 8000 rpm / min for 10 min. The bacterial cells were collected and washed repeatedly 4-6 times with pre-cooled 10% glycerol, maintaining a 4°C low-temperature environment throughout. Finally, the bacterial cells were resuspended in 10% glycerol at 100 μL / portion, and stored at -80°C for future use.

[0024] Electroporation and deletion strain screening: The successfully constructed recombinant deletion plasmids were inoculated into chloramphenicol-resistant LB liquid medium and amplified to the logarithmic phase. The plasmids were purified using a large plasmid purification kit, and the final concentration was adjusted to 1-5 μg / μL by spectrophotometry. Then 1-2 μL of purified plasmid (total mass 2-5 μg) was mixed with 80 μL of Nocardia seriolae competent cells in an ice bath for 30 min, and then transferred to a pre-cooled flat-bottom 96-well plate (100 μL / well). The cells were subjected to electroporation with the following parameters: voltage 400 V, pulse 5000-10000 ms, frequency 30 times, and interval 1000 ms. Immediately after electroporation, 100 μL of pre-warmed BHI medium at 28°C was added, and the solution was transferred to an EP tube and incubated at 28°C with shaking at 150 rpm / min for 2-4 h. At the same time, competent cells without plasmid addition and competent cells without electroporation were set as negative controls. Then take the recovery of bacteria evenly coated with 20 μg / mL chloramphenicol BHI selective solid medium, all samples at 28°C, inverted culture 7-14 days, pick single colony to chloramphenicol BHI liquid culture medium expansion, by CM-F / R and cobalt specific primers 659-F / R PCR amplification, confirm whether the recombinant deletion plasmid is successfully integrated into the cobalt, the positive clones were transferred to 10% sucrose BHI medium, using pRE112 plasmid SacB gene negative selection characteristics to remove free plasmid, by CM-F / R and 659-F / R primer two verification plasmid elimination effect, finally, using cobalt specific primers 659-F / R and target gene overlap primer (UF / DR) double PCR identification, eventually obtain mycolic acid synthesis related gene deletion strain ΔHadAB, ΔInhA, ΔMabA, ΔKasA.

[0025] Deletion strain property verification: Genetic stability analysis: the constructed deletion strain in no chloramphenicol and sucrose BHI agar plate continuous streak subculture, 28°C constant temperature box inverted culture 3-5 days, each generation of single colony was picked for liquid expansion, synchronous set wild type strain as control, observe the colony morphology and growth characteristics of each generation of deletion strain and wild strain, to the 30th generation of deletion strain, using overlap primer (UF / DR) and cobalt specific primers (659-F / R) PCR amplification, by electrophoresis detection target gene deletion fragment stability.

[0026] Bacterial morphology observation: using gram staining method, respectively pick the deletion strain and wild type strain logarithmic growth period single colony, placed in the center of the slide, add 50 μL PBS buffer to prepare uniform bacterial suspension smear, through alcohol lamp drying and fixing, according to the conventional process, in turn, crystal violet initial dyeing (1 min), iodine medium dyeing (1 min), 95% ethanol decolorization (15-30 s) and safranin re staining (30 s), each step with sterile water washing, using optical microscope (100x oil lens) observation of bacterial morphology, staining characteristics and hypha structure difference, at the same time, through scanning electron microscope (SEM) observation of hypha extension, branch and adhesion, through transmission electron microscope (TEM) analysis of cell wall structure integrity and thickness difference, samples were pre fixed with 2.5% glutaraldehyde (4℃, 12h), 1% osmium acid post fixed (2h), then through ethanol-acetone gradient dehydration, and through epoxy resin embedding polymerization after ultrathin section (60-80nm), finally, phosphotungstic acid-acetic acid uranium negative staining observation (such as Figure 2

[0027] ​Mycolic acid synthesis capacity assay: Deletion strains and wild-type strains were activated using BHI liquid medium and cultured at 28℃ with constant shaking at 150 rpm for 7 days until the stationary phase. The cells were then collected, vacuum filtered through a 0.22 μm filter membrane, and transferred to borosilicate pressure-resistant tubes. Pre-cooled KOH-methanol saponification solution was added, and the mixture was vortexed. The mixture was then heat-treated at 121℃ for 60 min to promote the hydrolysis of fatty acid ester bonds. After the reaction system cooled to room temperature, 3.75 mL of HCl solution was added dropwise for protonation treatment, followed by the introduction of 5 mL of n-hexane (density 0.659 g / cm³). 3 Liquid-liquid extraction was performed twice, and the upper organic phase was collected. The extract was concentrated by rotary evaporation to obtain mycolic acid extract, which was then analyzed by thin-layer chromatography (TLC). The extract was spotted onto a silica gel G60 pre-prepared plate, and two-dimensional chromatography was performed in a pre-saturated chromatography tank using n-hexane / diethyl ether (4:1, v / v) as the developing solvent. The chromatography was terminated when the solvent front migrated to 0.5 cm from the top. Finally, the plate was immersed in 0.5% iodine-methanol chromogenic solution for positioning, and the mycolic acid synthesis was analyzed (e.g., ...). Figure 3 (As shown).

[0028] Growth kinetics analysis: Wild-type and deletion strains were inoculated onto BHI agar medium using the streak plate method and cultured at 28°C for 3 days. Single colonies were then picked and inoculated into EP tubes containing 1 mL of BHI liquid medium and cultured with shaking at 28°C for 3 days. The bacterial cells were then dispersed by mechanical grinding (intensity level 3) and the bacterial suspension concentration was adjusted to 1.0 × 10⁻⁶. 7 CFU / mL, and a blank control group (BHI medium containing 5% Tween-80) was set up. Each group had 3 biological replicates. The bacterial culture was then inoculated in a constant temperature shaker at 28℃ and 150 rpm / min for 7 days. Three tubes were sampled every 12 hours, and bacterial aggregates were eliminated using an ultrasonic disruptor (200W power, 3s disruption / 5s pause cycle). 100 μL of the treated bacterial culture was added to a 96-well plate, and the OD600 value was measured. The corrected absorbance was calculated using the formula shown below: OD 600实际 =OD 600检测 - OD 600对照 Growth curves were plotted with culture time on the horizontal axis and OD value on the vertical axis to analyze the differences in growth kinetics among strains.

[0029] Poisoning LD 50 Determination: single clone colonies of wild type and each deletion strain were selected and inoculated in BHI medium conical flask, cultured at 25℃, 150rpm / min dynamic culture to logarithmic growth phase (OD600=0.6-0.8), the bacterial liquid was centrifuged at 8000xg for 3min to collect bacterial cells, washed with sterile PBS (pH7.4, 0.22μm filter membrane) for three times, and the bacterial suspension concentration gradient was adjusted to 1.0x10 4 1.0x10 9 CFU / mL, 3 biological replicates were set for each concentration, 10 hybrid snakefish were injected intraperitoneally for challenge (100μL / fish), and the same amount of sterile PBS was injected as negative control, the fish were observed at regular time intervals during the experiment, and the records were continued for 15 days (as shown in Figure 4 ), the cumulative mortality of each group was counted, the body surface ulcer, internal organ granuloma and necrotic lesions were observed, and finally SPSS19.0 software was used for Probit regression analysis to calculate LD 50 value, and the significant difference determination standard was p<0.05.

[0030] Histopathological analysis: on the 7th day after challenge, 3 fish were taken from each group, and spleen and liver tissue samples were collected, fixed in 2mL paraformaldehyde neutral buffer solution (containing 0.1M PBS, pH7.4), dehydrated, paraffin-embedded to make 5μm thick tissue sections, and observed by optical microscope after HE staining to evaluate the pathological characteristics such as granuloma formation and tissue necrosis, and to assess the pathogenicity difference of mycolic acid deficient strains (as shown in Figure 5 ).

[0031] The above-described embodiments only express several embodiments of the present application, which are described in detail and specifically, but should not be understood as limiting the scope of the present application. It should be noted that for ordinary skilled in the art, without departing from the concept of the present application, several modifications and improvements can be made, which all belong to the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the appended claims.

Claims

1. A set of Nocardia amberjack mycoides mycolic acid synthase genes and their deletion strains, characterized in that: S1. After reviving and culturing the wild-type strain of Nocardia amberjack ZJ0503, the whole genome was extracted using a lysozyme-ultrasonic disruption method. S2. Based on the nucleotide sequence of the mycolic acid synthase gene of Nocardia amberjack, primers containing Mlu I / Xba I restriction sites were designed using the Primer-BLAST tool of NCBI. The upstream and downstream homologous arm fragments of each gene were amplified by PCR. The PCR products were recovered and purified after detection by 1% agarose gel electrophoresis. S3. Overlap PCR was used to splice the upstream and downstream homologous arms of each gene, and the pMD18T vector was ligated by double digestion with Mlu I / Xba I. The resulting cells were transformed into DH5α competent cells to screen for positive clones. The cells were then ligated by double digestion with pRE112 plasmid and transformed into E. coli S17-1 competent cells. The recombinant deletion plasmid was obtained by verification with CM-F / R primers. S4. Cultivate ZJ0503 cells to the logarithmic growth phase, then disperse them by grinding, Tween-80, and synergistic cell disruption treatment with ethionamide, glycine, and lysozyme. Wash the cells 4-6 times with pre-cooled 10% glycerol and resuspend them to prepare competent cells. S5. The recombinant deletion plasmid was incubated with competent cells on ice for 30 min. Electroporation was performed at 400 V, pulse duration of 5000-10000 ms, frequency of 30 times, and interval of 1000 ms. After recovery, the cells were plated on BHI medium containing 20 µg / mL chloramphenicol resistance. The plasmid was eliminated by 10% sucrose. Double PCR was performed using Nocardia amberjack-specific primers 659-F / R and overlapping primers of the target gene to identify the deletion strain. S6. Through genetic stability passage, mycolic acid synthesis ability detection, cell morphology observation, and challenge LD50 test... 50 Measurements and histopathological analysis were performed to confirm the characteristics of the deletion strain.

2. The method for constructing and applying a set of Nocardia amberjack mycoides mycolic acid synthase genes and their deletion strains according to claim 1, characterized in that: In S1, the wild-type strain of Nocardia amberjack ZJ0503 was thawed in a constant temperature water bath at 28°C, then inoculated onto BHI solid medium and cultured upside down at 28°C for 3-5 days. During whole genome extraction, the logarithmic phase cells were collected, lysozyme was added, and the cells were then broken up with the assistance of an ultrasonic disruptor.

3. The method for constructing and applying a set of Nocardia amberjack mycoides mycolic acid synthase genes and their deletion strains according to claim 1, characterized in that: In S2, PCR amplification was performed using 2×Taq PCR Master Mix reagent, with upstream and downstream homologous arm fragments both being 500bp in length. The PCR amplification annealing temperature was 60±0.5℃, and the recovery and purification were performed using the GeneJET gel recovery kit.

4. The method for constructing and applying a set of Nocardia amberjack mycoides mycolic acid synthase genes and their deletion strains according to claim 1, characterized in that: In S3, Overlap PCR uses forward primers for the upstream fragments and reverse primers for the downstream fragments of each gene as primer pairs. After transforming DH5α competent cells, the cells are plated on LB plates containing ampicillin and colony PCR is performed using M13-F / M13-R primers for verification.

5. The method for constructing and applying a set of Nocardia amberjack mycoides mycolic acid synthase genes and their deletion strains according to claim 1, characterized in that: In S4, the final concentration of Tween-80 was 0.05%. The synergistic cell disruption treatment involved sequentially adding ethionamide, glycine, and lysozyme for 1-2 hours, followed by culturing at 28°C with shaking at 150 rpm for 12 hours. The cells were maintained at 4°C throughout the process with 10% glycerol. The competent cells were aliquoted into 100 µL portions and frozen at -80°C.

6. The method for constructing and applying a set of Nocardia amberjack mycoides mycolic acid synthase genes and their deletion strains according to claim 1, characterized in that: In S5, after electroporation, 100µL of pre-warmed BHI medium was added, and the cells were thawed at 28℃ and 150rpm for 2-4 hours. The negative control included electroporated competent cells without plasmid and non-electroplated competent cells. All samples were incubated upside down at 28℃ for 7-14 days.

7. The method for constructing and applying a set of Nocardia amberjack mycoides mycolic acid synthase genes and their deletion strains according to claim 1, characterized in that: In S6, genetic stability was verified by 30 consecutive passages using PCR with overlapping primers and Nocardia amberjack-specific primers. Mycolic acid synthesis ability was detected using thin-layer chromatography with hexane / ether as the developing solvent and 0.5% iodine-methanol for color development. Cell morphology observation included Gram staining, scanning electron microscopy, and transmission electron microscopy. The challenge LD50 was determined. 50 The study used hybrid snakehead as the experimental subject. After challenge with the virus, the snakehead was observed for 15 days. Histopathological analysis was performed by HE staining to observe the formation of granulomas in the spleen and liver tissues.

8. The method for constructing and applying a set of Nocardia amberjack mycoides mycolic acid synthase genes and their deletion strains according to claim 1, characterized in that: The mycolic acid synthase genes of Nocardia amberjack include the HadAB gene, InhA gene, MabA gene, and KasA gene.

Citation Information

Patent Citations

  • Prevention and control method for Nocardia disease of Micropterus salmoides

    CN112831548A

  • A Nocardia aurea strain and its application

    CN117645947B