Hybridoma cell strain and monoclonal antibody and application thereof
By preparing hybridoma cell lines IFN-γ9D and IFN-γ9A, IgG2a type monoclonal antibodies were generated, and a double-antibody sandwich ELISA method was established, which solved the problem of the lack of highly specific porcine IFN-γ monoclonal antibodies in the market and realized efficient quantitative detection and diagnosis of porcine IFN-γ.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HEBEI AGRICULTURAL UNIV.
- Filing Date
- 2026-01-19
- Publication Date
- 2026-04-10
AI Technical Summary
The lack of highly specific porcine IFN-γ monoclonal antibodies in the market makes it difficult to meet the demand for porcine IFN-γ detection, and existing commercial detection reagents rely on imports and are expensive.
Hybridoma cell lines IFN-γ9D and IFN-γ9A were prepared, IgG2a type monoclonal antibodies were generated, and a double-antibody sandwich ELISA method was established to realize the quantitative detection of porcine IFN-γ.
This study achieved highly specific quantitative detection of IFN-γ, providing important biomaterials and detection methods, and supporting research on porcine cellular immune mechanisms, diagnosis of related diseases, and evaluation of vaccine efficacy.
Smart Images

Figure CN121825901A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of antibody preparation technology, and particularly relates to hybridoma cell lines, their monoclonal antibodies, and their applications. Background Technology
[0002] Interferons are a type of cytokine, first discovered in the late 20th century and named for their antiviral capabilities. When an animal's body is invaded by pathogenic microorganisms, the secretion and expression of interferons change. Therefore, timely understanding of these changes in interferon levels is crucial for understanding the occurrence, development, and outcome of diseases. There are three types of interferons. Interferon-γ (IFN-γ) is a type II interferon. As one of the most important cytokines mediating the body's immune response, it possesses different immune mechanisms and is one of the main regulatory proteins of the entire immune system, playing a vital role in immune signal transduction. IFN-γ levels can reflect the body's cellular immune status. Qualitative and quantitative detection of IFN-γ has significant applications in the study of the immune mechanisms and functions of swine diseases, the evaluation of vaccine efficacy, and the diagnosis of pathogen infections.
[0003] Monoclonal antibodies (mAbs) are highly homogeneous antibodies produced by a single B cell that target only a specific antigenic epitope, offering advantages such as high specificity and sensitivity. Currently, commercially available IFN-γ detection reagents based on monoclonal antibodies exist, but their quantity and variety are limited, and they are all imported, making them expensive and insufficient to meet the detection needs of swine IFN-γ. Summary of the Invention
[0004] The present invention aims to prepare highly specific porcine IFN-γ monoclonal antibodies, establish a porcine IFN-γ ELISA detection method, and evaluate its application effect, in order to provide biomaterials and detection methods for the study of porcine cellular immune mechanisms, diagnosis of related diseases, and evaluation of vaccine immunization efficacy.
[0005] This invention provides hybridoma cell lines, namely hybridoma cell line IFN-γ9D with biological preservation number CCTCC NO: C2025237 and hybridoma cell line IFN-γ9A with CCTCC NO: C2025238.
[0006] This invention provides monoclonal antibodies produced by hybridoma cell line IFN-γ9D and monoclonal antibodies produced by hybridoma cell line IFN-γ9A.
[0007] Furthermore, all of the monoclonal antibodies are of type IgG2a.
[0008] Furthermore, the monoclonal antibodies produced by the hybridoma cell lines IFN-γ9D and IFN-γ9A, as detected by indirect ELISA, yielded titers of 1:6400 and 1:1600, respectively.
[0009] This invention provides the application of a monoclonal antibody in the preparation of a reagent for detecting porcine IFN-γ.
[0010] This invention provides the application of a monoclonal antibody in the preparation of a kit for detecting porcine IFN-γ.
[0011] This invention provides a kit for detecting porcine IFN-γ, comprising a monoclonal antibody.
[0012] Compared with existing technologies, this invention has the following advantages: Four hybridoma cell lines secreting IFN-γ monoclonal antibodies were obtained, of which three hybridoma cell lines secreted IgG2a and one hybridoma cell line secreted IgM; monoclonal antibodies 9A and 9D were selected as capture antibody and enzyme-labeled antibody, respectively, to establish a double-antibody sandwich ELISA method for quantitative detection of IFN-γ, achieving quantitative detection of IFN-γ. These research results can provide important materials and technical support for the in vitro quantitative detection of IFN-γ, in vivo tissue localization analysis, and related infection and immune mechanisms research.
[0013] Biological Preservation Instructions:
[0014] Preservation institution: China Center for Type Culture Collection;
[0015] Accession number: CCTCC NO: C2025237;
[0016] Deposit date: December 15, 2025;
[0017] Location of collection: Wuhan University, Wuhan, China;
[0018] Taxonomic nomenclature: Hybridoma cell line IFN-γ9D.
[0019] Biological Preservation Instructions:
[0020] Preservation institution: China Center for Type Culture Collection;
[0021] Accession number: CCTCC NO: C2025238;
[0022] Deposit date: December 15, 2025;
[0023] Location of collection: Wuhan University, Wuhan, China;
[0024] Taxonomic nomenclature: Hybridoma cell line IFN-γ9A. Attached Figure Description
[0025] Figure 1 The image shows the identification of the recombinant plasmid pET32a-PoIFN-γ in Example 1, where M: protein molecular weight standard; 1: pET32a-PoIFN-γ enzyme digestion product.
[0026] Figure 2 The image shows the SDS-PAGE identification of pET32a-PoIFN-γ protein expression in Example 2. In the image, M represents the protein molecular weight standard; 1-2 represent Escherichia coli Rosetta (DE3) expression bacteria before and after induction, respectively; 3-4 represent pET-32a(+) expression bacteria before and after induction, respectively; and 5-6 represent recombinant IFN-γ expression bacteria before and after induction, respectively.
[0027] Figure 3 This is an optimization of the induction time in Example 2, where A and B represent SDS-PAGE and grayscale analysis of IFN-γ, respectively. M represents the protein molecular weight standard; 1 represents the pre-induction product of E. coli; and 2-6 represent the expression products of recombinant bacteria after induction for 3h, 4h, 5h, 6h, and 7h, respectively.
[0028] Figure 4 For the optimization of the induction temperature in Example 2, A and B: SDS-PAGE and grayscale analysis of IFN-γ, respectively. M: protein molecular weight standard; 6: E. coli pre-induction product; 1-5: expression products induced by recombinant bacteria at 16℃, 24℃, 28℃, 32℃, and 34℃, respectively.
[0029] Figure 5 For the optimization of the inducer concentration in Example 2, A and B: SDS-PAGE and grayscale analysis of IFN-γ, respectively. M: protein molecular weight standard; 1: E. coli pre-induction product; 2-6: recombinant bacterial expression products with final IPTG concentrations of 0.1, 0.25, 0.5 and 1 mmol / L, respectively.
[0030] Figure 6 This section describes the identification and purification of the IFN-γ expression form in Example 2, where M represents the protein molecular weight standard; 1-4 represent the supernatant and precipitate samples after induction, lysis, and induction of recombinant plasmid-positive bacteria.
[0031] Figure 7 The image shows the identification and purification of the IFN-γ expression form in Example 2, where M represents the protein molecular weight standard; 1-4 represent the purified protein from recombinant plasmid-positive bacteria.
[0032] Figure 8 The image shows the Western blot identification of IFN-γ in Example 3, where M: protein molecular weight standard; 1: purified IFN-γ protein.
[0033] Figure 9 The image shows the antibody titer detection of immunized mouse serum in Example 4, where 1#: mouse No. 1; 2#: mouse No. 2; 3#: mouse No. 3; negative control: serum from negative mice.
[0034] Figure 10 The hybridoma cells in Example 4 are: A: hybridoma cells; B: hybridoma cell supernatant titer; 9D: hybridoma cells 9D; 9A: hybridoma cells 9A; 1E: hybridoma cells 1E; 12D: hybridoma cells 12D; negative control: negative mouse serum.
[0035] Figure 11 This is for the identification of mouse monoclonal antibody Ig class and subclass in Example 4.
[0036] Figure 12 The purification and titer of the ascites antibody in Example 4 are shown below, where A.: M.: protein molecular weight standard; 1-2: 9D before and after purification; 3-4: 9A before and after purification; 5-6: 12D before and after purification; B. ascites titer.
[0037] Figure 13 For the Western blot identification of the monoclonal antibody in Example 5, M: protein molecular weight standard; 1-3: monoclonal antibody (9D, 9A, 12D); 4: anti-IFN-γ mouse serum; 5: anti-IFN-γ negative serum.
[0038] Figure 14 This is for the specific detection of monoclonal antibodies in Example 5.
[0039] Figure 15 This is an affinity assay diagram for the IFN-γ monoclonal antibody in Example 5.
[0040] Figure 16 The coating concentration of the capture antibody 9A in Example 6.
[0041] Figure 17 The sealing liquid in Example 6 was determined.
[0042] Figure 18 This is for determining the dilution of enzyme-labeled antibody 9D in Example 6.
[0043] Figure 19 This is a graph showing the linear range of the standard curve and the sensitivity of the sandwich ELISA in Example 6.
[0044] Figure 20This is a specificity detection diagram of the sandwich ELISA in Example 6. Detailed Implementation
[0045] Example 1
[0046] Construction of prokaryotic expression vectors
[0047] Synthesis of pET32a-PoIFN-γ recombinant plasmid
[0048] The PoIFN-γ gene sequence (GenBank accession number: AY188090.1) was located in NCBI. Signal peptide analysis and transmembrane region prediction software were used to analyze IFN-γ related information. After removing the signal peptide, the sequence was synthesized by Shanghai Bioengineering Co., Ltd. The PoIFN-γ gene sequence is shown below: (ggatccatgagctacaccacttacttcctggccttccagctgtgcgtgaccctgtgcttcagcggcagctactgccaggcccccttcttcaaggagatcaccatcctgaaggactacttcaacgcctccacctctgatgtgcctaatggcggacctctgtttctggagatcctgaagaattggaaggaggagagcgataagaagatcatccaga) gccagatcgtgagcttctacttcaagttctttgagatcttcaaagataatcaggccatccagagaagcatggatgtgatcaagcaggatatgttccagagattcctgaacggcagcagcggcaagctgaacgatttcgagaagctgatcaagatccctgtggataacctgcagatccagagaaaggccatcagcgagctgatcaaggtcatgaatgacctgagccctagaagcaacctgagaaagagaaagagaagccagaccatgttccagggccagagagccagcaagtgactcgag) was inserted into the pET32a plasmid, with BamH1 and Xho1 selected as restriction sites, and named pET32a-PoIFN-γ. Figure 1 ).
[0049] The primer sequences are shown in Table 1:
[0050] Table 1 PoIFN-γ primer sequence information
[0051]
[0052] Example 2
[0053] Expression and purification of pET32a-PoIFN-γ recombinant protein
[0054] 1. The recombinant plasmid pET32a-PoIFN-γ was transformed into Rosetta (DE3) competent cells and plated on LB agar plates resistant to Amp+ (100 μg / mL) and incubated overnight at 37 °C. Multiple single colonies were picked and inoculated into 3 mL of Amp+ / LB liquid medium and incubated overnight at 37 °C. Then, each colony was inoculated into 4 mL of Amp+ / LB liquid medium at a 1:100 (40 μl) volume ratio and cultured at 37 °C with shaking at 200 r / min until the logarithmic growth phase (OD50) was reached. 600nm =0.6~0.8), add IPTG to a final concentration of 0.5 mmol / L. Induction temperature was 32℃, induction at 200 r / min for 5 h. Collect bacterial cultures before and after induction, centrifuge at 12000 r / min for 1 min to collect the bacterial pellet, and perform SDS-PAGE electrophoresis (…). Figure 2 The recombinant strain with the highest protein expression level was selected as the material for subsequent experiments.
[0055] 2. Inoculate the recombinant strain with the highest expression level from step 1 into 3 mL of Amp+ / LB liquid medium and incubate overnight at 37 ℃. Then, inoculate it into 8 mL of Amp+ / LB liquid medium at a volume ratio of 1:100 (80 μl) and incubate at 37 ℃ with shaking at 200 r / min until the logarithmic growth phase (OD500). 600nm =0.6~0.8), add IPTG to a final concentration of 0.5 mmol / L. Induction temperature was 32℃, and incubation was performed with shaking at 200 r / min for 7 h. Samples were collected before and after induction (3 h, 4 h, 5 h, 6 h, 7 h), and the cells were collected by centrifugation at 12000 r / min for 1 min for SDS-PAGE electrophoresis. Figure 3 To determine the optimal induction time for the recombinant protein.
[0056] 3. Inoculate the bacterial strain at a volume ratio of 1:100 (80 μl) into 8 mL of Amp+ / LB liquid medium and incubate at 37 ℃ with shaking at 200 r / min until the logarithmic growth phase (OD50). 600nm =0.6~0.8), add IPTG to a final concentration of 0.5 mmol / L; induction temperatures were set at 16℃, 24℃, 28℃, 32℃, 34℃, etc., and induction was performed at 200 r / min for 5 h. Samples at different time points were collected, and bacterial cells were collected by centrifugation at 12000 r / min for 1 min and then subjected to SDS-PAGE electrophoresis ( Figure 4To determine the optimal temperature for protein-induced expression.
[0057] 4. Inoculate the bacterial strain at a volume ratio of 1:100 (60 μl) into 6 mL of Amp+ / LB liquid medium and incubate at 37 ℃ with shaking at 200 r / min until the logarithmic growth phase (OD50). 600nm =0.6~0.8), IPTG was added to final concentrations of 0.1 mmol / L, 0.25 mmol / L, 0.5 mmol / L, and 1 mmol / L, respectively, to determine the optimal induction temperature and time for induction. Samples with different IPTG concentrations were centrifuged at 12000 r / min for 1 min, and the bacterial pellet was collected for SDS-PAGE electrophoresis (…). Figure 5 To determine the optimal concentration of the inducer for protein expression.
[0058] 5. Collect the induced bacterial cells and perform ultrasonic lysis. Lysis conditions: frequency 21 kHz, power 4 ℃ ice bath, sonication for 5 s, interval 5 s, 40% amplitude, for 30 min. After sonication, centrifuge at 12000 r / min for 15 min at 4 ℃, and collect the supernatant and precipitate separately. Perform SDS-PAGE electrophoresis (…). Figure 6 This is to determine the expression mode of the protein.
[0059] 6. Purification of pET32a-PoIFN-γ recombinant protein
[0060] The recombinant pET32a-PoIFN-γ protein was expressed in inclusion body form. The precipitate from bacterial cell lysis was prepared according to step 5. Ten volumes of Lysis Buffer containing 8 M urea were added based on the precipitate weight, and the mixture was pipetted to dissolve it completely. The mixture was centrifuged at 10000 r / min for 10 min, and the supernatant was collected and filtered through a 0.45 µm filter membrane for later use. Protein purification was performed using Solarbio's Ni-Agarose Gel 6FF, following these steps: ① Ni column equilibration: After mounting the protein purification column, wash the column with 10 column volumes of deionized water, then equilibrate the nickel column with 10 column volumes of Lysis Buffer, controlling the flow rate at 1 mL / min; ② Sample loading: Load the protein solution onto the column, repeating the loading 2-3 times; ③ Washing: Wash with 20 column volumes of Wash Buffer, at a flow rate of 2 mL / min; ④ Elution: Elute with 10 column volumes of Elution Buffer, at a flow rate of 1 mL / min, collecting 10 mL, dividing into 1 mL / tubes. After elution, wash the nickel column with 10 column volumes of deionized water, then equilibrate with 3 column volumes of 20% ethanol, and store at 4℃; ⑤ SDS-PAGE electrophoresis: Collect the eluent, adding 50 µL of each sample to 50 µL of 2xSDS Buffer, denaturing at 105℃ for 10 min, and then performing SDS-PAGE electrophoresis on the samples. Figure 7 The purified IFN-γ protein band was single.
[0061] The purified protein was dialyzed using a urea concentration gradient method. The specific steps were as follows: First, different concentrations of urea dialysate were prepared (4.5 mol / L, 3.5 mol / L, 2.5 mol / L, 1.5 mol / L, 0.5 mol / L, 0.25 mol / L, and 0 mol / L). The dialysis bag was immersed in the 4.5 mol / L urea dialysate for 6–8 h, followed by dialysis in the 3.5 mol / L urea dialysate, and this gradient dialysis was repeated. Finally, the protein concentration was measured using a NanoDrop 2000, and the protein was aliquoted and stored at -80°C for later use.
[0062] Example 3
[0063] Identification of recombinant proteins
[0064] The recombinant bacterial induction experiment was conducted according to the optimal parameters determined in Example 2. Bacteria were collected and identified by Western blot. The main experimental steps were as follows: After SDS-PAGE, the collected bacterial cells were transferred to a polyvinylidene fluoride (PVDF) membrane using a semi-dry rapid transfer system; after washing the membrane, it was transferred to a blocking solution containing 5% skim milk powder (Yili) and blocked overnight at 4 ℃; the membrane was placed in a solution of anti-His-tagged mouse monoclonal antibody-HRP (1:5000 dilution) and incubated at room temperature for 1.5 h-2 h; after washing the membrane, it was transferred to a 1:5000 dilution of goat anti-mouse IgG-HRP solution and reacted at room temperature for 1.5 h; after washing the membrane, solution A and solution B from the ECL chemiluminescence ultrasensitive colorimetric kit were mixed in equal proportions and evenly added to the target band for exposure. Figure 8 When the expressed protein reacts with the anti-His tag antibody, a target band of the expected size appears in the corresponding lane.
[0065] Example 4
[0066] Preparation and identification of monoclonal antibodies
[0067] 1. Establishment of an ELISA method for detecting Po-IFN-γ antibody titer: Serum from immunized mice was collected one week after triple immunization. An indirect ELISA method for detecting pET32a-PoIFN-γ serum titer was established using the checkerboard titer method. This method was subsequently used for the preparation of polyclonal antibody serum titers, screening of monoclonal positive cell lines, and titer determination (Table 2). The specific steps are as follows: The purified pET32a-PoIFN-γ protein was serially diluted with carbonate buffer (pH 9.6) to 2, 1, 0.5, and 0.25 µg. / mL, 100µL / well, incubated overnight at 4℃; washed three times with PBST; added 100µL of blocking buffer (PBST containing 5% skim milk powder) to each well, blocked at 37℃ for 1h, and discarded the blocking buffer; used serum diluted from 1:2000 to 1:64000 as primary antibody (as shown in Table 3), 100µL / well, incubated at 37℃ for 1h; washed; added 100µL of HRP-labeled goat anti-mouse IgG diluted 1:10000 to each well, incubated at 37℃ for 45min, washed; added 100µL of TMB chromogenic solution to each well, reacted in the dark for 15min; added 50µL of 2 moI / L H2SO4 to each well to stop the reaction, and immediately measured the OD450nm value with a microplate reader. The results showed that the optimal coating concentration of antibody and the optimal dilution concentration of the test serum were 1ug / ml and 1:4000, respectively.
[0068] 2. Animal Immunization and Immune Serum Detection: Three 6-week-old BALB / c mice were immunized using purified IFN-γ protein as the immunogen. Blood was collected from the tail vein 14 days after the third immunization, and serum antibody levels were detected by indirect ELISA. Figure 9 The specific steps of ELISA are as follows: IFN-γ protein is coated onto an enzyme-linked immunosorbent assay (ELISA) plate at 1 μg / well, incubated at 37 ℃ for 1 h, and then incubated overnight at 4 ℃; 100 µL of 5% skim milk powder is added to each well and the plate is blocked at 37 ℃ for 1 h; diluted mouse serum is added and the plate is incubated at 37 ℃ for 1 h; HRP-labeled goat anti-mouse IgG diluted 1:10000 is added and the plate is incubated at 37 ℃ for 45 min; 100 µL of chromogenic solution is added to each well and the plate is incubated at room temperature in the dark for 15 min; the reaction is terminated, 50 µL of 2 mol / L sulfuric acid is added to each well, the mixture is shaken and the OD is measured using an ELISA reader. 450nm Value. Mice with the highest antibody positive titers were selected and boosted with immunization three days before fusion.
[0069] Table 2. Mouse Immunization Schedule
[0070]
[0071] Table 3 Optimal coating concentration and optimal dilution concentration of IFN-γ-ELISA serum
[0072]
[0073] 3. Cell fusion
[0074] (1) Resuscitating SP2 / 0 cells: After removing SP2 / 0 cells from the liquid nitrogen tank, immediately place them in 37℃ warm water until thawed. Mix the DMEM medium containing 10% Sigma FBS and preheat it in a 37℃ water bath for 30 min. Centrifuge the cells at 1000 r / min for 10 minutes, discard the cell supernatant, and use a pipette to lift the cells and repeatedly pipette them into the cell culture flask to mix them. Label the cells. Place the flask in a 37℃, 5% CO2 incubator and replace half of the medium after 12 h.
[0075] (2) Preparation of feeder cells: Feeder cells (peritoneal macrophages) were prepared 1 day before fusion. The specific operation was as follows: The mice were euthanized by cervical dislocation and immersed in a 75% alcohol beaker for 5 min for disinfection. The abdomen of the mice was cut open with surgical scissors, the skin was peeled off, and the peritoneum was exposed. 3 mL of serum-free DMEM culture medium was injected into the peritoneal cavity through the peritoneum using a 5 mL sterile syringe. The injection was gently rubbed with an alcohol swab for 1 min, without withdrawing the needle. The peritoneal fluid was aspirated and placed into a 15 mL centrifuge tube. This was repeated 3-4 times. The cells were centrifuged at 1000 r / min for 10 min, and the supernatant was discarded. The cell pellet was resuspended in 5 mL of DMEM culture medium containing 15% FBS and 1% HAT. Viable cell counts were performed using 0.5% trypan blue solution. 2 × 10 5 Cell suspension of 100 µL / well was added to a 96-well plate and incubated at 37 °C in a 5% CO2 incubator.
[0076] (3) Cell fusion: Pre-warm the serum-free DMEM medium and other culture media in a 37°C water bath; expand the SP2 / 0 bone marrow cells 48-36 hours before fusion. At fusion, photograph the cells and collect them in a 50 ml centrifuge tube, centrifuge at 1000 r / min for 10 min, and discard the supernatant. Add 5 mL of DMEM medium containing 10% FBS to resuspend the cells. Perform viable cell counting with 0.5% trypan blue solution and incubate at 37°C in a 5% CO2 incubator for later use. Take mice 3 days after the booster immunization in step 1, remove the eyeballs until death, collect blood and serum, and disinfect by soaking in 75% alcohol for 5 min. Under aseptic conditions, remove the mouse spleen, place it in serum-free DMEM medium, wash 2-3 times, and remove the surrounding connective tissue. Mouse spleens were minced and ground using a 70 μm sterile cell filter. While grinding, 10 mL of 2.5% FBS DMEM culture medium was added. The spleen cell suspension was harvested, centrifuged at 1000 r / min for 10 min, the supernatant was discarded, and the cells were resuspended in 5 mL of 2.5% FBS DMEM culture medium and mixed well. The cell suspension was then used to perform viable cell counting with 0.5% trypan blue solution. The spleen cells were mixed with the SP2 / 0 myeloma cells obtained in step (1) at a ratio of 10:1, mixed well, and centrifuged at 1000 r / min for 10 min. The supernatant was discarded, and the bottom of the centrifuge tube was gently tapped to disperse the cells into a paste. The tube was then placed in a 37 ℃ water bath for later use. 1 mL of preheated serum-free DMEM culture medium was added to 1 g of sterile PEG4000 and mixed by pipetting to make a 50% PEG4000 solution. Over 1 minute, slowly add 1 mL of 50% PEG 4000 solution to the mixed suspension of SP2 / 0 myeloma cells and spleen cells. After addition, aspirate all the liquid into a pipette within 30 seconds, let stand for 30 seconds, and then slowly blow it into a centrifuge tube within 30 seconds. Add 25 mL of preheated 10% FBS DMEM culture medium to the centrifuge tube to terminate the effect of PEG. Slowly add 1 mL of 10% FBS DMEM culture medium over the first minute, 1 mL over the second minute, and 3 mL over the third minute. Then add the remaining 20 mL of DMEM culture medium over 3 minutes, rotating the centrifuge tube while adding to allow the terminating solution to slide down the side wall. Then place the centrifuge tube in a 37°C water bath for 5 minutes to allow the culture medium to fully terminate confluence. Centrifuge at 1000 r / min for 10 minutes and discard the supernatant. The cell pellet was slowly suspended in approximately 35 mL of DMEM culture medium containing 15% FBS and 1% HAT. 100 µL / well was added to the 96-well plate containing feeder cells obtained in step (2) and cultured in a 37°C, 5% CO2 incubator.Every 3 days, half of the cells in the wells were replaced with DMEM culture medium containing 1% HAT. Starting from day 15, half of the cells were replaced with DMEM culture medium containing 1% HT. Cell growth was observed and recorded during this period.
[0077] 4. Screening and cloning of positive hybridoma cells
[0078] Positive hybridoma cells were screened using an indirect ELISA method on days 9, 12, and 15 post-fusion. Figure 10 The hybridoma cell supernatant was diluted 1:2. Simultaneously, the lysate of the empty plasmid of *E. coli* pET-32a was coated onto an ELISA plate for detection. Subcloning was performed using limiting dilution in wells that were positive for IFN-γ antibody and negative for *E. coli* pET-32a empty plasmid lysate. Cells in positive wells were dispersed using a 200 μL pipette tip, transferred to 1.5 mL centrifuge tubes, and 800 μL of nutrient solution was added to a final volume of 1 mL. Cells were counted and diluted to 20 cells / mL, 10 cells / mL, and 5 cells / mL. The diluted cells were added at 100 μL / well to 96-well plates containing feeder cells, with each gradient replicated in 4 columns (32 wells). Remaining hybridoma cells were transferred to 24-well plates for expansion culture and cryopreservation. Observe and record the cell status in the cloning wells 3-5 days after subcloning. Change half the medium every 3 days. For cell wells with monoclonal cell growth, coat the ELISA plate with IFN-γ protein and pET-32a empty plasmid lysis product. Perform indirect ELISA on the cell culture supernatant. Select cloning wells with high IFN-γ protein positivity and negative pET-32a empty plasmid transformation lysis product for the next subcloning. After 3-4 consecutive subclonings, indirect ELISA should show that all cell culture supernatant in the cloning wells is positive and has an OD value of 100%. 450nm When the values are basically consistent, the positive hybridoma cells are transferred to 24-well cell culture plates, expanded culture after they reach full confluence, and cryopreserved as soon as possible.
[0079] 5. Stability detection of antibodies secreted by hybridoma cells
[0080] The positive hybridoma cell lines obtained after cloning in step 3 above were continuously passaged. During passage, the cell culture supernatant of F5, F10, F15, and F20 generations was collected. Simultaneously, the positive hybridoma cells in the flasks were cryopreserved. The specific procedure was as follows: the cells were gently tapped and collected in a centrifuge tube, centrifuged at 1000 r / min for 10 min, the supernatant was discarded, and the cell pellet was resuspended in IMDM cryopreservation solution. 1 mL of the resuspended pellet was placed in a 2 mL cryopreservation tube, sealed, and incubated at 4 ℃ for 1 h, -20 ℃ for 1 h, and -80 ℃ overnight. The cells were then stored long-term in liquid nitrogen. The F10 generation hybridoma cells were thawed by removing them from the liquid nitrogen and quickly transferring them to 37 ℃ warm water with stirring to thaw them. They were centrifuged at 1000 r / min for 10 min, and the supernatant was discarded. The cell pellet was resuspended in IMDM medium containing 10% FBS, transferred to cell culture flasks, and cultured at 37 ℃ under 5% CO2 conditions. The supernatant from F2 and F5 passages was collected after resuscitation. The titers of the cell supernatants collected after passage and resuscitation were determined using the p30 indirect ELISA method to analyze the stability of antibodies secreted by hybridoma cells. The results are shown in Table 4, indicating that the hybridoma cell lines showed good antibody secretion stability.
[0081] Table 4. Stability of antibodies secreted by hybridoma cells
[0082]
[0083] 6. Subclass identification of monoclonal antibodies
[0084] Following the instructions of the Mouse Monoclonal Antibody Ig / Subclass Identification Kit (ELISA), the types of antibodies secreted by hybridoma cells were identified. The kit, brought to room temperature, was used to dilute the hybridoma cell supernatant 1:1 (50 µL + 50 µL) with the sample diluent provided in the kit. 100 µL was added to each well, with 8 replicates per sample. The positive and negative controls were undiluted, with 100 µL added to each well. The mixture was incubated at 37 °C for 30 min. After washing 5 times, 100 µL of each of the eight enzyme-labeled antibodies was added to each sample well, and the mixture was incubated at 37 °C for 30 min. The liquid in the wells was aspirated, and the cells were washed 5 times. 50 µL each of chromogenic solutions A and B were added, and the mixture was incubated at 37 °C for 20 min. Finally, 50 µL of stop solution was added to each well, and the OD was measured. 450nm Values. Results are shown in Table 5 and... Figure 11 As shown: Positive control OD 450nm Value > 0.8, negative control OD 450nm The experimental results are valid when the value is <0.15. Sample OD 450nm > Negative OD 450nm A value of +0.15 is considered positive.
[0085] Table 5. Identification of Monoclonal Antibody Types
[0086]
[0087] 7. Preparation of mouse ascites fluid and detection of monoclonal antibody titer
[0088] Monoclonal antibodies were prepared in large quantities using an in vivo ascites induction method. 1 mL of liquid paraffin oil was injected intraperitoneally into BALB / c mice; 10 days later, each mouse was injected intraperitoneally with 3 × 10⁻⁶ mol / L of the liquid paraffin oil. 6 Hybridoma cells were collected. When the mouse abdomen swelled, ascites fluid was aspirated using a sterile syringe, centrifuged at 8000 r / min for 10 min, and the supernatant was collected and stored at -80 ℃.
[0089] Ascites fluid was purified using the octanoic acid-ammonium sulfate method, with the following steps: After thawing, the ascites fluid was filtered through double-layered filter paper to remove impurities and fats. It was then centrifuged at 12000 r / min for 15 min at 4°C, and the supernatant was collected. The ascites fluid and acetate buffer were mixed at a 1:4 ratio using a magnetic stirrer. The pH was adjusted to 4.5–4.8 with 2 mol / L HCl solution. Octanoic acid (33 μL / mL ascites fluid) was slowly added under magnetic stirring. The mixture was magnetically stirred at room temperature for 30 min, then allowed to stand at 4°C for at least 2 h. The mixture was then centrifuged at 12000 r / min for 15 min at 4°C, and the supernatant was collected and placed on ice for 5 min. After filtration, 1 / 10 volume of 0.1 M PBS (pH 7.4) was added to the filtrate. The pH was adjusted to 7.4 with 2 mol / L NaOH solution. Ammonium sulfate solid was added to a final volume of 0.277 g / mL while stirring continuously, and the addition was completed within 30 min. Incubate overnight at ℃, collect the liquid, centrifuge at 12000 r / min for 15 min, discard the supernatant, dissolve the precipitate with PBS, dialyze against 0.01 mol / L PBS for two days, collect the dialysate, centrifuge at 12000 r / min for 15 min, and collect the supernatant. SDS-PAGE test for purification results: Take 20 µL of ascites fluid before and after purification, add 20 mL of 2×SDS loading buffer, denature at 105 ℃ for 10 min, and perform SDS-PAGE. Dilute the purified monoclonal antibody at a 1:10 ratio... 4 Serial dilutions of ~1:10⁹ were performed, and the titers of ascites monoclonal antibodies were detected using an indirect ELISA method. The antibody titers of hybridoma cell lines 9A, 9D, and 12D ascites were 1:64000, 1:64000, and 1:128000, respectively (results are shown in the figure). Figure 12 As shown in the figure, the 12D hybridoma cell line ascites has the highest antibody titer.
[0090] Example 5
[0091] Identification of IFN-γ monoclonal antibodies
[0092] 1. Western blot identification of monoclonal antibodies
[0093] After SDS-PAGE electrophoresis of recombinant pET32a-PoIFN-γ, the monoclonal antibody was identified by Western blot. The specific steps of Western blot were as follows: After electrophoresis, the gel was placed in a petri dish containing transfer buffer, and filter paper was placed in transfer buffer for 20 min. The size of the gel was measured and a PVDF membrane was cut. The PVDF membrane was immersed in 100% methanol for 5 min, and then in 20% methanol for 2 min. A sandwich structure was prepared by stacking filter paper, PVDF membrane, gel, and filter paper in that order. The power was turned on at 23 V, and the membrane was transferred for 23 min on a semi-dry transfer apparatus. After transfer, the PVDF membrane was blocked in PBST containing 5% skim milk powder and incubated on a shaker at room temperature for 1.5 h. His-tagged monoclonal antibody diluted 1:5000 was added, and the membrane was incubated at room temperature for 2 h. The membrane was washed three times with TBST for 10 min each time. Goat anti-mouse IgG-HRP diluted 1:5000 was added, and the membrane was incubated at room temperature for 1.5 h. The membrane was washed three times with TBST for 10 min each time. ECL chemiluminescence ultrasensitive colorimetric solution A and B were mixed in equal proportions and evenly added to the target band. The membrane was exposed for 30 s, and the reaction between the antibody and the expressed protein was observed. Simultaneously, the product of transformation of empty plasmid pET32a into E. coli was used as a negative serum control. For Western blot identification, the monoclonal antibody to be tested was diluted 1:500, and goat anti-mouse IgG-HRP was diluted 1:5000. (Results are as follows...) Figure 13 As shown in the figure, Western blot analysis showed that after the monoclonal antibody reacted with IFN-γ, a clear specific reaction band appeared in the corresponding lane, while no reaction band was observed after reacting with the product induced by the empty plasmid-transformed bacteria.
[0094] 2. Specificity identification of monoclonal antibodies
[0095] Six cytokines—1L-2, 1L-4, 1L-15, Gzms-B, IFN-γ, and TNF-α—were coated onto an ELISA plate. The cross-reactivity of the obtained IFN-γ monoclonal antibody with these cytokines was detected by indirect ELISA. The specificity of the monoclonal antibody binding to the antigen was analyzed. (Results are shown in the figure.) Figure 14 The monoclonal antibody obtained (as shown) specifically binds only to IFN-γ and shows no cross-reactivity with five different protein antigens, including IL-2. Figure 6 (The results show the specificity detection results of antibodies 9D, 9A, and 12D), indicating that the obtained monoclonal antibodies have good specificity.
[0096] 3. Affinity identification of monoclonal antibodies
[0097] The affinity of monoclonal antibodies was determined using an indirect ELISA method. ELISA plates were coated with 0.5 and 0.25 μg / mL IFN-γ, respectively. Monoclonal antibodies 2C10, 2D10, 2F3, and 3D5 were diluted to concentrations of 10, 5, 2.5, 1.25, 0.625, 0.313, 0.156, and 0.078 μg / mL, respectively. After reaction with HRP-goat anti-mouse IgG, the OD was measured. 450nm Value. According to OD 450nm Plot the antibody-antigen binding reaction curve, calculate the dissociation constant Kd, and analyze the affinity of each monoclonal antibody. (Results are shown in the figure.) Figure 15 As shown in the figure, the dissociation constants of monoclonal antibodies 9A, 9D, and 12D are 3.32, 3.33, and 3.33 nmol·L⁻¹, respectively, indicating that the monoclonal antibodies have a high affinity for IFN-γ.
[0098] Example 6
[0099] Establishment and application of a double-antibody sandwich ELISA method
[0100] 1. Monoclonal antibody pairing experiment
[0101] Following the instructions of the LinKine™ Horseradish Peroxidase Conjugate Kit, four monoclonal antibodies (2C10, 2D10, 2F3, and 3D5) were labeled. The four antibodies were then paired, with unlabeled 2C10, 2D10, 2F3, or 3D5 used as capture antibodies to coat the ELISA plate (0.5 μg / well). The plate was incubated at 37 °C for 1 h, then transferred to 4 °C overnight. The plate was washed three times, 5 min each time. Blocking buffer was added, and the plate was blocked at 37 °C for 1 h. 1 μg / mL of recombinant IFN-γ was added, and the plate was reacted at 37 °C for 1 h. After washing, different HRP-labeled monoclonal antibodies were added, and the plate was incubated at 37 °C for 1 h (pairing combinations are shown in Table 6). TMB substrate chromogenic solution was added, and the plate was incubated at room temperature in the dark for 15 min. The reaction was terminated by adding 2 mol / L concentrated sulfuric acid, and the OD was measured. 450nm Values. OD values were selected from positive (P) and negative controls (N). 450nm The combination with the highest P / N ratio is the optimal antibody pairing.
[0102] Table 6 IFN-γ monoclonal antibody pairing
[0103]
[0104] 2. Determination of antibody coating concentration
[0105] ELISA was performed using PBST (0.01 mol / L PBS containing 0.05% Tween-20, pH 7.4) containing 5% skim milk powder, 5% BSA, 2% BSA, 5% calf serum, and 1% gelatin, respectively. The PN value was calculated to determine the optimal blocking solution. Figure 16 ).
[0106] HRP-labeled monoclonal antibodies were diluted 1:1000, 1:2000, 1:4000, and 1:8000, and sandwich ELISA was performed to calculate the P / N value and determine the optimal dilution factor for the blocking buffer. Figure 17 ).
[0107] 3. Determination of the dilution factor for enzyme-labeled monoclonal antibodies
[0108] HRP-labeled monoclonal antibodies were diluted 1:1000, 1:2000, 1:4000, and 1:8000 times, and sandwich ELISA was performed. The P / N ratio was calculated to determine the optimal dilution factor. Figure 18 ).
[0109] 4. Establishment of standard curve and sensitivity analysis of sandwich ELISA
[0110] Absolute quantification was employed using a sandwich ELISA method to detect IFN-γ standards at different concentrations (1000, 500, 250, 125, 62.5, 31.2, 15.6, and 0 ng / mL). The standard concentration was plotted on the x-axis, and OD... 450nm A standard curve was plotted with the values on the ordinate to obtain the regression equation and calculate the correlation coefficient (R) to determine the linear range of the standard curve. IFN-γ was serially diluted 2-fold (2ug / mL - 15 ng / mL) for sandwich ELISA, with IL-2 used as a negative control. Results are as follows: Figure 19 As shown, the lowest detection limit of this method is 31.25 ng / mL, which is the concentration of IFN-γ when the P / N value is >2.1.
[0111] 5. Specificity test
[0112] Following the established ELISA procedure, the sandwich ELISA method was used to simultaneously detect IFN-γ and other cytokines or proteins (IL-2, IL-4, IL-15, Gzms-B, TNF-α). The specificity of the method was evaluated (results are shown in the figure). Figure 20 (As shown) Except for the IFN-γ sample, the detection results for the other proteins were all negative, indicating that the method does not cross-react with other cytokines or proteins.
[0113] 6. Repeatability experiment
[0114] ELISA was performed using the same batch (3 replicates within a group) and 3 batches (3 replicates between groups) of 9D capture antibody. Six porcine serum samples and two PEDV S1 protein samples were used as negative controls. The coefficient of variation (CV) of the results within and between groups was calculated to evaluate the reproducibility of the method. The results are shown in Tables 7-8. The average CV of the intra-batch reproducibility test was 4.41%, and the average CV of the inter-batch reproducibility test was 3.49%, indicating that the established sandwich ELISA has good reproducibility.
[0115] Table 7 Intra-batch repeatability tests (OD) 450nm value)
[0116]
[0117] Table 8. Intra-interval repeatability test (O D450nm value)
[0118]
[0119] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A hybridoma cell line, characterized in that, Hybridoma cell line IFN-γ9D with biological preservation number CCTCC NO: C2025237 and hybridoma cell line IFN-γ9A with CCTCC NO: C2025238.
2. The monoclonal antibody produced by the hybridoma cell line IFN-γ9D and the monoclonal antibody produced by the hybridoma cell line IFN-γ9A as described in claim 1.
3. The hybridoma cell line according to claim 2, characterized in that, The monoclonal antibodies mentioned are all of type IgG2a.
4. The monoclonal antibody produced by the hybridoma cell line according to claim 2, characterized in that, The monoclonal antibodies produced by the hybridoma cell lines IFN-γ9D and IFN-γ9A had titers of 1:6400 and 1:1600, respectively, as determined by indirect ELISA.
5. The use of the monoclonal antibody as described in claim 4 in the preparation of a reagent for detecting porcine IFN-γ.
6. The use of the monoclonal antibody as described in claim 4 in the preparation of a kit for detecting porcine IFN-γ.
7. A kit for detecting porcine IFN-γ, characterized in that, It contains the monoclonal antibody as described in claim 4.