Recombinant adeno-associated virus, construction method thereof and application of composition of recombinant adeno-associated virus in treatment of acute myelogenous leukemia

By combining a gene interference vector targeting GBA and recombinant adeno-associated virus with FeNPs in AML cells, the selectivity problem of targeting the NF-κB signaling pathway in AML treatment was solved, achieving efficient killing of AML cells with safety and significantly prolonging survival.

CN121825906APending Publication Date: 2026-04-10NANJING HOSPITAL OF TCM
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NANJING HOSPITAL OF TCM
Filing Date
2026-01-06
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Current AML treatments are unable to effectively target the NF-κB signaling pathway, resulting in poor selective killing of AML cells and toxic side effects on normal cells. Furthermore, existing NF-κB inhibitors lack selectivity, making them difficult to apply clinically.

Method used

A gene interference vector containing an AML-specific promoter NM gene fragment and a miGBA gene fragment was designed. By targeting GBA and inhibiting its activity, combined with recombinant adeno-associated virus and the intravenous iron supplement Feraheme (FeNPs), ferroptosis was induced in AML cells with high NF-κB activation.

Benefits of technology

It achieved highly efficient killing of AML cells, reduced toxicity to normal cells, significantly prolonged the survival of AML mice, and reduced tumor infiltration, demonstrating good biosafety and clinical translation potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121825906A_ABST
    Figure CN121825906A_ABST
Patent Text Reader

Abstract

The invention discloses a recombinant adeno-associated virus, a construction method thereof and application of a composition of the recombinant adeno-associated virus in treating acute myelogenous leukemia. The composition comprises the recombinant adeno-associated virus and a vein iron supplement agent, and the recombinant adeno-associated virus takes an adeno-associated virus as a vector and comprises an AML specific promoter NM and miR30-shGBA (miGBA). Under the combined action of the recombinant adeno-associated virus and the vein iron supplementing agent, acute myelogenous leukemia cell OH is induced to be remarkably increased, miGBA is continuously expressed, and lysosomal storage disorder and ferroptosis of cells are caused. The composition based on the recombinant adeno-associated virus and the vein iron supplement can be used for preparing a novel acute myelogenous leukemia treatment reagent.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of cancer gene therapy biotechnology, specifically relating to recombinant adeno-associated virus and its construction method, and the application of its composition in the treatment of acute myeloid leukemia. This case is a divisional application with application number 2026100110771, entitled "Gene Interference Vector, Adeno-Associated Virus and its Construction Method, and the Application of its Composition in the Treatment of Acute Myeloid Leukemia". Background Technology

[0002] Acute myeloid leukemia (AML) is a highly heterogeneous malignant tumor originating from hematopoietic stem / progenitor cells in the bone marrow, clinically characterized by rapid onset, high relapse rate, and treatment resistance. Despite advances in targeted therapy and immunotherapy for several subtypes, traditional induction chemotherapy often fails to cure elderly patients and cases containing drug-resistant leukemia stem cells (LSCs). At the molecular level, the NF-κB signaling pathway is abnormally activated in AML cells, participating in the regulation of cell proliferation, anti-apoptosis, antioxidant defense, and stress responses. Sustained NF-κB activity (p-p65 / p50) contributes to LSC survival and chemotherapy tolerance; therefore, inhibiting the NF-κB-related antioxidant network and enhancing intracellular oxidative stress has become one of the important strategies for overcoming drug resistance and eliminating LSCs. However, directly targeting NF-κB signaling still faces significant challenges in drug development. This is because some normal cells require moderate NF-κB activation to maintain normal physiological function, and NF-κB inhibitors, being broad-spectrum, may inadvertently damage normal cells, leading to severe toxic side effects. Therefore, how to leverage the significant differences in NF-κB activity between AML cells and normal cells to achieve highly effective AML treatment while minimizing damage to normal cells is a major challenge that urgently needs to be addressed in NF-κB-based AML therapy.

[0003] Previous studies have shown that abnormal lysosomal function in AML cells is closely related to lipid metabolism reprogramming, and also endows tumor cells with stronger antioxidant capacity and drug resistance. Precisely targeting and regulating lysosomal membrane permeability and function to induce lysosomal-dependent cell death, disrupt redox balance, and inhibit leukemia stem cell survival has become a highly promising therapeutic strategy. When lysosomal membrane permeability increases or its integrity is disrupted, large amounts of toxic contents within the lysosome, such as free iron, can escape into the cytoplasm, triggering multiple lethal pathways, including ferroptosis, autophagy, apoptosis, necrosis, pyroptosis, and lysosomal-dependent cell death. GBA (glucocerebrosidase) is responsible for hydrolyzing glucosylceramide (GlcCer) into ceramide (Cer) and glucose (Glu), and is a key enzyme in maintaining lysosomal lipid metabolism and membrane composition homeostasis. GBA inactivation leads to GlcCer accumulation, inducing lysosomal storage disorders and functional impairment, altering lipid homeostasis and membrane permeability. Therefore, GBA activity can directly affect lysosomal function and induce multiple forms of cell death, making it a potential target for the treatment of malignant tumors.

[0004] The interaction between the NF-κB signaling pathway and lysosomal function may offer new therapeutic insights. On the one hand, sustained activation of NF-κB signaling can regulate the expression of lysosomal-related genes, affecting cell viability. On the other hand, the release of free iron and other contents from lysosomal membrane rupture can further activate stress responses, exacerbating the positive feedback loop of the NF-κB signaling pathway and forming a cyclical regulation. NF-κB is abnormally activated in AML and is associated with leukemia occurrence, progression, and chemotherapy resistance. Although there are significant differences in NF-κB activity between AML and normal cells, current NF-κB inhibitors lack selectivity; direct inhibition of NF-κB can damage normal cells, making them unsuitable for clinical treatment of AML. Abnormal lysosomal function in AML cells endows them with drug resistance and antioxidant properties. Glycoprotein B (GLCB) is a key enzyme in lysosomes that catalyzes the hydrolysis of GlcCer to produce Cere and glucose. Its inhibition leads to the accumulation of GlcCer in lysosomes and impaired lysosomal storage, resulting in cell death. Lysosomes contain a large amount of contents. Damage to the lysosomal membrane or alteration of permeability leads to the release of contents such as free iron and hydrolases into the cytoplasm, causing cellular stress and various forms of cell death, including apoptosis, necrosis, autophagy, ferroptosis, and pyroptosis. GBA inactivation leads to GlcCer accumulation, inducing lysosomal storage disorders and functional impairment, altering lipid homeostasis and membrane permeability. Therefore, GBA activity can directly affect lysosomal function, triggering multi-pathway cell death, and is an important target for the synergistic treatment of tumors and nanomedicines, especially IONPs.

[0005] Since the concept of ferroptosis was introduced in 2012, its potential therapeutic value in cancer has attracted widespread attention. Studies have shown that ferroptosis can kill tumor stem cells and overcome tumor drug resistance, thus considering this form of cell death as a key factor in refractory tumors. Ferroptosis is an iron-dependent form of cell death driven by lipid peroxidation (lipROS), and the immune system may partially prevent tumor development through ferroptosis. Ferroptosis can spread in waves between cells, exhibiting a powerful killing effect on neighboring cells. Therefore, the anti-tumor effects of ferroptosis have been rapidly and extensively explored in various cancers. Iron oxide nanoparticles (IONPs), as ferroptosis inducers that induce cellular iron overload, are widely used in tumor therapy and imaging. Feraheme (ferumoxytol, FeNPs), an FDA-approved intravenous iron supplement, is clinically used to treat iron deficiency anemia in patients with chronic kidney disease. Its core is composed of iron oxide (Fe3O4 / γ-Fe2O3) and is mainly located in lysosomes. Furthermore, FeNPs can kill AML cells with low expression of ferroportin (FPN) via the Fenton reaction, and also have a protective function against hematopoietic stem cells. However, even at high doses (5 mg / kg), FeNPs alone do not have an ideal killing effect on AML cells. Achieving significant killing of AML cells by efficiently utilizing the Fenton reaction catalyzed by FeNPs will be a significant breakthrough in the clinical application of FeNPs.

[0006] Therefore, on the one hand, how to effectively combine NF-κB with AML to achieve precise intervention in AML through specific targeting mechanisms while protecting normal tissues from damage is a crucial challenge that urgently needs to be addressed in the current field of AML treatment. In-depth research and clinical application of this strategy may play a vital role in overcoming treatment bottlenecks, improving efficacy, and enhancing patient prognosis. On the other hand, utilizing the molecular background of abnormal NF-κB activation accompanying AML to regulate the expression of effector genes to promote lysosomal lysis or inhibit GBA to enhance the Fenton reaction catalyzed by FeNPs may become an important strategy for improving the killing of AML (especially LSCs), overcoming drug resistance, and promoting the clinical translation of FeNPs. However, a balance must be struck between selectivity and safety for normal cells. Summary of the Invention

[0007] Objective of the Invention: Addressing the poor prognosis of AML and its associated NF-κB activation and lysosomal dysfunction, this invention aims to provide a gene interference vector for AML treatment. This vector responds to highly activated NF-κB in AML cells, expressing miGBA, specifically silencing GBA and inhibiting its activity, leading to GlcCer accumulation and ultimately impaired lysosomal storage, inducing multiform cell death, primarily ferroptosis, in AML cells. This vector is an AML therapeutic vector with AML selectivity and no significant toxicity to normal cells.

[0008] To address the problem that existing gene therapies and intravenous iron supplements for AML are unable to significantly induce ferroptosis in AML cells, the second objective of this invention is to provide a composition based on recombinant adeno-associated virus (AAV) and intravenous iron supplements for AML and its application. The composition based on recombinant AAV and intravenous iron supplements can significantly induce ferroptosis in AML cells. This composition uses the two materials, recombinant AAV and intravenous iron supplements, to kill AML cells, thereby achieving the treatment of AML.

[0009] Technical Solution: To solve the above-mentioned technical problems, the first aspect of the present invention provides a gene interference vector, the gene interference vector comprising a vector backbone, wherein the vector backbone sequentially comprises an AML-specific promoter NM gene fragment and a miGBA gene fragment, the AML-specific promoter NM gene fragment comprising multiple NF-κB Motif gene fragments, spacer gene fragments and a minimal promoter gene fragment, the miGBA gene fragment sequentially comprising a 20-60 bp fragment from the 5' end of miR30, shGBA and a 20-60 bp fragment from the 3' end of miR30, wherein shGBA is a gene fragment of shRNA based on the miR30 structure and capable of targeting GBAmRNA.

[0010] GBA is a key enzyme in lysosomes that catalyzes the hydrolysis of glucosylceramide (GlcCer) to ceramide (Cer) and glucose; its inhibition directly leads to impaired lysosomal storage. miGBA can target the GBA coding region, form a complex with RISC, effectively interfere with GBA mRNA, and inhibit GBA expression and its enzymatic activity.

[0011] The vector backbone includes a pDMP-miR vector or a pAAV-MCS. Preferably, the plurality of NF-κB motif gene fragments contain 1 to 10 NF-κB motif DNA fragments, the sequence of which is 5'-GGACTTTCC-3', and the motif is highly compatible with NF-κB.

[0012] The spacer fragment is a 10-20 bp segment located between NF-κB motif DNA fragments. Preferably, the sequence of the spacer fragment is 5'-GGGAATTTCCGG-3'. The 10-20 bp spacer fragment between motifs eliminates steric hindrance between proteins, allowing for the efficient binding of multiple NF-κB molecules to multiple motifs. After binding to the vector motif, NF-κB can function as RNA polymerase II, responsible for transcribing downstream microRNAs.

[0013] The sequence containing miR30 at the 5' end is CTGGAGGCTTGCTGAAGGCTGTA, and the sequence containing miR30 at the 3' end is CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCC.

[0014] The minimum promoter sequence is 5'-TAGAGGGTATATAATGGAAGCTCGACTTCCA-3', located downstream of the motif, and is used to initiate the expression of downstream microRNA.

[0015] The sequence of the GBA mRNA is shown in SEQ ID NO.1 to SEQ ID NO.6. Preferably, the sequence of the GBA mRNA is shown in SEQ ID NO.1 or SEQ ID NO.5.

[0016] The sequence of the shGBA is shown in SEQ ID NO.8 to SEQ ID NO.13. Preferably, the sequence of the shGBA is shown in SEQ ID NO.8 or SEQ ID NO.12.

[0017] The vector further includes a reporter gene. Preferably, the reporter gene includes, but is not limited to, the zsGreen gene.

[0018] The present invention also provides a method for constructing the aforementioned gene interference vector, comprising the following steps: obtaining an NF-κBMotif gene fragment, a minimal promoter gene fragment, and a miGBA gene fragment, and inserting them into the vector backbone.

[0019] The present invention also provides a cell obtained by transfecting a host cell with the aforementioned gene interference vector.

[0020] The host cells include AML cells or normal cells. Preferably, the AML cells include one or more of THP-1, U937, KG1a, HL60, WEHI-3, NB4, SKNO01, ML-2, EL9611, or C1498, and the normal cells include one or more of MCF12a, BEAS-2B, HMEC-1, NIH-3T3, L929, GES-1, MRC-5, AML-12, HL-1, or C2C12.

[0021] The present invention also provides the application of the gene interference vector or the cells described herein in the preparation of drugs for treating acute myeloid leukemia. Preferably, the gene interference vector can continuously respond to NF-κB in AML cells and promote miGBA expression through a positive feedback mechanism. Preferably, the gene interference vector can respond to NF-κB activity in acute myeloid leukemia cells, express miGBA, induce lysosomal storage disorders, and trigger multiform cell death, mainly ferroptosis, in acute myeloid leukemia cells.

[0022] The NM fragment of the interference vector constructed in this invention contains different numbers of NF-κB motif sequences. Using zsGreen as a reporter gene, the optimal number of motifs was screened in ten AML cell lines and ten normal cell lines. Six motifs maximized the response to NF-κB activity in AML cells without affecting normal cells. In this invention, three different human or mouse miGBAs were designed, and the effects of different miGBA expression levels on GBAm RNA, protein, and enzyme activity in AML and normal cells were demonstrated. Then, the human or mouse miGBA with the best GBA silencing effect was used in AML and normal cell killing experiments, lysosomal morphology, metabolite and function detection, cell death form rescue experiments, and cell ferroptosis characterization experiments to demonstrate the killing ability and mechanism of pNM6-miGBA against AML cells, as well as its biosafety.

[0023] A second aspect of the present invention provides a recombinant adeno-associated virus (AAV), which is obtained by transfecting cells with the aforementioned gene interference vector, packaging plasmid, and helper plasmid. The gene interference vector includes a vector backbone in which an AML-specific promoter NM gene fragment and a miGBA gene fragment are sequentially included. The AML-specific promoter NM gene fragment contains multiple NF-κB motif gene fragments, spacer gene fragments, and a minimal promoter gene fragment. The miGBA gene fragment sequentially contains a 20-60 bp fragment from the 5' end of miR30, shGBA, and a 20-60 bp fragment from the 3' end of miR30. The shGBA is a gene fragment of shRNA based on the miR30 structure and capable of targeting GBA mRNA. The sequence of the shGBA is shown in SEQ ID NO. 8 to SEQ ID NO. 13.

[0024] The vector backbone includes a pDMP-miR vector or a pAAV-MCS. Preferably, the plurality of NF-κB motif gene fragments contain 1 to 10 NF-κB motif DNA fragments, the sequence of which is 5'-GGACTTTCC-3', and the motif is highly compatible with NF-κB.

[0025] The gene interference vector contains six NF-κB motif sequences (NM6). NM6 can maximize the response to NF-κB activation of downstream effector genes or microRNAs in AML cells without affecting normal cells. The functional sequence of NM6 controlling miGBA expression can specifically express miGBA in response to NF-κB activity in AML cells, but it is not expressed in normal cells.

[0026] The miGBA is formed by linking miR30 at the 5' and 3' ends with shGBA. It can target the GBA coding region. The target sequence for human GBA is 5'-TATGTTCAGCATTGCTGTA-3', and the target sequence for mouse GBA is 5'-TGCGCTCAATCCTTGCTTT-3'. The miGBA can express microRNA and form a RISC complex in the cell. It targets and cleaves the lysosomal enzyme GBA gene, resulting in a decrease in the protein level encoded by the GBA gene, which impairs lysosomal function, induces lysosomal storage disorders, and releases contents such as free iron.

[0027] The sequence containing miR30 at the 5' end is CTGGAGGCTTGCTGAAGGCTGTA, and the sequence containing miR30 at the 3' end is CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCC.

[0028] The spacer fragment is a 10-20 bp base located between NF-κB Motif DNA fragments. Preferably, the sequence of the spacer fragment is 5'-GGGAATTTCCGG-3'.

[0029] The minimum promoter sequence is 5'-TAGAGGGTATATAATGGAAGCTCGACTTCCA-3'.

[0030] The recombinant adeno-associated virus includes any one of the various serotypes of adeno-associated virus AAV1 to AAV12. Preferably, the adeno-associated virus serotype is AAV2.

[0031] The present invention also includes a method for constructing the recombinant adeno-associated virus, the method comprising transfecting cells with the gene interference vector, packaging plasmid and helper plasmid, wherein preferably, the packaging plasmid is pAAV-RC and the helper plasmid is pHelper, and preferably, the cells are HEK-293T cells.

[0032] The present invention also includes a composition containing the recombinant adeno-associated virus and an intravenous iron supplement.

[0033] The intravenous iron supplement is an iron oxide nanomaterial that can enter cells and generate •OH through the Fenton reaction, inducing cellular ferroptosis. Preferably, the iron oxide nanoparticles are iron carboxymaltose injection Feraheme (FeNPs), whose core is composed of iron oxide (Fe3O4 / γ-Fe2O3), which is clinically approved for the treatment of iron deficiency anemia in patients with chronic kidney disease.

[0034] Furthermore, the FeNP concentration is crucial for the expression of miGBA by the vector and virus. First, the FeNP content cannot be too high, as excessively high concentrations of FeNPs will generate a large amount of •OH, which will kill normal cells. Second, the •OH released by FeNPs must not induce NF-κB activation in normal cells; otherwise, activated NF-κB will initiate miGBA expression, which is disastrous for normal cells. Preferably, the FeNP concentration is 10 μg / ml.

[0035] The present invention also includes the recombinant adeno-associated virus and the composition thereof in the preparation of a medicament for treating acute myeloid leukemia.

[0036] The combination of the recombinant adeno-associated virus and intravenous iron supplement can induce a significant increase in •OH in acute myeloid leukemia cells, activate NF-κB through a positive feedback mechanism to promote miGBA expression, resulting in lysosomal storage impairment and exacerbating ferroptosis.

[0037] The applications include using the recombinant adeno-associated virus alone or in combination with intravenous iron supplements. The combined use includes a single-dose mixture administration or administration of the virus followed by intravenous iron supplementation. The recombinant adeno-associated virus can be administered in vivo alone or in combination with intravenous iron supplementation, both of which show significant efficacy against acute myeloid leukemia in mice, substantially prolonging their survival. The recombinant adeno-associated virus and intravenous iron supplementation can be administered as a single, mixed dose, or the virus can be injected first, followed by intravenous iron supplementation, with an interval of 1 to 7 days; both methods demonstrate significant therapeutic effects.

[0038] As a preferred treatment regimen, the adeno-associated virus is first injected internally, followed by an intravenous iron supplement two days later.

[0039] In this invention, the FeNPs combined with the adeno-associated virus (AAV) gene vector can eliminate most AML cells in vitro by inducing ferroptosis and lysosomal storage disorders, but has no effect on normal cells. In vivo, the FeNPs combined with AAV can significantly reduce AML infiltration in the liver, spleen, lungs, and bone marrow; greatly prolong the survival of AML mice, and have no significant toxicity to normal cells and blood biochemistry.

[0040] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0041] (1) This invention constructed a series of pNM promoters containing NF-κB motifs and, after screening, determined that a vector containing 6 motifs was the preferred vector. This vector can maximally express the effector element (zsGreen / miGBA) in AML cells without affecting normal cells. Normal cells can only significantly express miGBA under TNFα (NF-κB activator) stimulation, indicating that pNM6-miGBA can utilize NF-κB activity to achieve selective expression in AML, significantly reducing toxic side effects on normal cells.

[0042] (2) The pNM6-miGBA constructed in this invention can effectively and specifically inhibit GBA in AML cells, leading to significant accumulation of GlcCer and a decrease in Cerebrolysin and Glu, accompanied by upregulation of lysosomal markers LAMP1 / LAMP2, increased lysosomal volume, decreased LysoSensor fluorescence, and decreased lysosomal proton transport activity. This demonstrates that GBA silencing in AML cells can induce lysosomal storage impairment and reduce lysosomal function, while no such effect is observed in normal cells with low NF-κB activation. These results indicate that pNM6-miGBA can selectively induce GBA inactivation, lysosomal storage impairment, and functional impairment in AML, and has good biocompatibility.

[0043] (3) In this invention, pNM6-miGBA significantly enhances its killing effect on AML cells over time, exhibiting a strong anti-AML effect. Cell death rescue experiments showed that AML cells treated with pNM6-miGBA underwent multiple forms of death, including pyroptosis, apoptosis inhibition, necrosis inhibition, autophagy inhibition, and ferroptosis, with ferroptosis being the most significant. After pNM6-miGBA induction, lipROS and Fe in AML cells... 2+ The levels of [specific enzyme name] increased significantly, and the activity of GPX4, a key antioxidant enzyme in ferroptosis, was inhibited. More importantly, miGBA had an impact on the morphology of normal cell mitochondria and lysosomes, as well as lipROS and Fe [specific enzyme name]. 2+ The activity of GPX4 was not affected, but Erastin, a ferroptosis-positive drug, showed a significant ferroptosis effect, lacking AML specificity. These results strongly suggest that pNM6-miGBA is specific for AML and has good therapeutic safety.

[0044] (4) In this invention, pNM6-miGBA causes lysosomal storage impairment in AML cells, releasing a large amount of contents. These contents further activate NF-κB, positively amplifying the mechanism of action of pNM6-miGBA, resulting in significant AML cell death. In summary, the pNM6-miGBA provided by this invention is a novel gene therapy tool for AML, possessing both AML-killing efficacy and safety for normal cells. It overcomes the shortcomings of existing NF-κB inhibitors and ferroptosis drugs, and has potential application value as a targeted therapy strategy for AML.

[0045] (5) The recombinant adeno-associated virus of the present invention has strong targeting and high selectivity. It utilizes the AML-specific promoter NM6, which contains multiple NF-κB response elements, to drive miGBA expression. It induces miGBA transcription only in the context of highly activated NF-κB in AML cells, thereby achieving selective attack on AML cells at the molecular level and minimizing non-specific effects on normal tissue cells. By setting a response threshold, NM6 balances targeting and safety, making miGBA expression AML-specific. The recombinant adeno-associated virus of the present invention has a highly efficient and specific gene silencing tool. It is constructed using miR30-modified shGBA, making the expressed microRNA easier for cells to process and assemble into the RISC complex, which can efficiently target the GBA coding region and reduce protein expression and enzyme activity. This design reduces the off-target risk and toxic side effects that may be caused by traditional microRNA or broad-spectrum GBA inhibitors. At the same time, the delivery of the adeno-associated virus in vivo provides a sustained gene inhibition effect.

[0046] (6) The composition of the present invention possesses an innovative mechanism for synergistically inducing ferroptosis, with gene interference and nanochemical effects mutually amplifying each other. miGBA targets and inhibits lysosomal enzyme GBA, leading to impaired lysosomal storage. This causes FeNPs to accumulate in lysosomes due to slow metabolism, continuously generating large amounts of •OH through the Fenton reaction, inducing further activation of NF-κB, forming a positive feedback loop, amplifying the lethal effect of miGBA and FeNPs, and significantly inducing ferroptosis in AML cells. Compared with single drugs or simple gene interference, the composition of the present invention has complementary and amplifying effects in mechanism. The iron oxide nanomaterials and adeno-associated virus described in the present invention are conducive to clinical translation. The present invention preferably uses Feraheme, an iron oxide nanoparticle formulation already used clinically for the treatment of iron deficiency anemia. Its safety and pharmacokinetic characteristics are supported by clinical data, significantly reducing regulatory and safety barriers in the translation from animal experiments to human trials. AAV vectors, as mature gene delivery systems, also have precedents of approval or entry into clinical trials, which helps in the feasibility assessment of the overall therapy.

[0047] (7) The composition of the present invention exhibits good in vivo safety. By precisely controlling the dosage of FeNPs and calibrating the sensitivity to NM6 response, it ensures that while effectively inducing ferroptosis in AML cells, it does not inadvertently trigger NF-κB expression in normal cells, thus avoiding excessive •OH directly causing oxidative damage to normal cells. Experimental data show that at the recommended dosage, there is no significant toxicity to normal cells and blood biochemical indicators. The administration method of this composition is flexible and can be individually adjusted. The present invention allows for a single-dose combination administration of the adeno-associated virus and intravenous iron supplement, and also supports a timed administration strategy of injecting the virus first, followed by the intravenous iron supplement. The preferred approach is to administer the AAV vector first, followed by an infusion of FeNPs two days later, to obtain optimal efficacy.

[0048] (8) In vitro and in vivo anti-AML experiments of the present invention show that the adeno-associated virus and FeNPs composition can efficiently eliminate the vast majority of AML cells by inducing ferroptosis and lysosomal storage impairment, while having little effect on normal hematopoietic cells. In fact, drug-resistant AML cells are susceptible to ferroptosis, and lysosomal storage impairment is irreversible damage. This composition significantly reduces the risk of drug resistance and relapse. In vivo AML mouse model results show that the combination therapy significantly reduces leukemia infiltration in the liver, spleen, lungs and bone marrow and significantly prolongs the survival of animals. Attached Figure Description

[0049] Figure 1 The image shows the pNM6-miGBA plasmid map and a schematic diagram of the gene structure of the pNM6-miGBA plasmid.

[0050] Figure 2 The study compared the expression levels of p-p65 in different cell types and the fluorescence results of cells transfected with different plasmids. Specifically, a) shows the expression levels of p-p65 in ten different AML cell lines (THP-1, U937, KG1a, HL60, WEHI-3, NB4, SKNO01, ML-2, EL9611, C1498) and normal cells (MCF12a, BEAS-2B, HMEC-1, NIH-3T3, L929, GES-1, MRC-5, AML-12, HL-1, C2C12) (n=3); b) shows the fluorescence images of two AML cell lines (KG1a, C1498) and two normal cell lines (MCF12a, HL-1) transfected with pNM-zsGreen containing different amounts of NF-κB motif for 48 hours; and c) shows the quantitative analysis of fluorescence intensity (n=3).

[0051] Figure 3This study presents the construction principle and expression results of the pNM6-miGBA plasmid; where a represents the construction principle of the pNM6-miGBA plasmid, which is specifically driven by NF-κB (pol II); b represents the expression of various plasmids pNM6-NT, pNM6-mihGBA-1, pNM6-mihGBA-2, pNM6-mihGBA-3, pNM6-mimGBA-1, pNM6-mimGBA-2, and pNM6-mimGBA-3 in KG1a and C1498 at different time points (24~72h) (n=3); c represents the expression of plasmids with and without TNFα (10 Expression of various plasmids pNM6-NT, pNM6-mihGBA-1, pNM6-mihGBA-2, pNM6-mihGBA-3, pNM6-mimGBA-1, pNM6-mimGBA-2, and pNM6-mimGBA-3 in MCF12a and HL-1 cells at different time points (24–72 h) (n=3) after 1 h of induction (ng / mL); d shows the fluorescence staining of AML cells (KG1a, C1498) and normal cells (MCF12a, HL-1) by AO&EB 72 h after pNM6-miGBA transfection; other time periods are shown in the supplement. Figure 7-9 .

[0052] Figure 4 Figure 1 shows the expression results of each plasmid. Figure 2 shows the quantitative detection of GBA mRNA in KG1a and C1498 cells (n=3) 48 h after transfection with various plasmids pNM6-NT, pNM6-mihGBA-1, pNM6-mihGBA-2, pNM6-mihGBA-3, pNM6-mimGBA-1, pNM6-mimGBA-2, and pNM6-mimGBA-3. Figure 3 shows the expression of GBA mRNA in KG1a and C1498 cells (n=3) after transfection with various plasmids pNM6-NT, pNM6-mihGBA-1, pNM6-mihGBA-2, pNM6-mihGBA-3, pNM6-mimGBA-1, pNM6-mimGBA-2, and pNM6-mimGBA-3, with and without TNFα (10 ng / mL) for 1 h. Quantitative analysis of mRNA in MCF12a and HL-1 cells (n=3).

[0053] Figure 5The results show the expression levels of various plasmids. Example a shows the quantitative detection of GBA protein expression levels and enzyme activity in KG1a cells 48 h after transfection with various plasmids (pNM6-NT, pNM6-mihGBA-1, pNM6-mihGBA-2, pNM6-mihGBA-3) (n=3); example b shows the quantitative detection of GBA protein expression levels and enzyme activity in C1498 cells 48 h after transfection with various plasmids (pNM6-NT, pNM6-mihGBA-1, pNM6-mihGBA-2, pNM6-mihGBA-3) (n=3); example c shows the expression levels of GBA protein expression and enzyme activity in C1498 cells 48 h after transfection with various plasmids (pNM6-NT, pNM6-mihGBA-1, pNM6-mihGBA-2, pNM6-mihGBA-3) 48 h after transfection. h after induction with TNFα (10 ng / mL), the protein expression level and enzyme activity of GBA in MCF12a cells were quantitatively detected (n=3); d shows the protein expression level and enzyme activity of GBA in HL-1 cells 48 h after transfection with various plasmids (pNM6-NT, pNM6-mimGBA-1, pNM6-mimGBA-2, pNM6-mimGBA-3) (n=3); e shows the protein expression level and enzyme activity of GBA in MCF12a cells 48 h after transfection with various plasmids (pNM6-NT, pNM6-mimGBA-1, pNM6-mimGBA-2, pNM6-mimGBA-3) (n=3) after induction with TNFα (10 ng / mL) for 1 h; f shows the protein expression level and enzyme activity of GBA in MCF12a cells 48 h after transfection with various plasmids (pNM6-NT, pNM6-mihGBA-1, pNM6-mihGBA-2, pNM6-mihGBA-3) for 1 h after induction with TNFα (10 ng / mL) for 1 h (n=3); f shows the protein expression level and enzyme activity of GBA in MCF12a cells 48 h after transfection with TNFα (10 ng / mL) for 1 h (n=3). After induction for 1 h with various plasmids (pNM6-NT, pNM6-mimGBA-1, pNM6-mimGBA-2, pNM6-mimGBA-3), and transfection for 48 h, the protein expression level and enzyme activity of GBA in HL-1 cells were quantitatively detected (n=3). Data are presented as mean ± standard deviation (SD).

[0054] Figure 6 The diagrams show the principle and results of the optimal plasmid. a) shows the principle of pNM6-miGBA plasmid killing AML cells but having no effect on normal cells; b) shows the expression levels of GBA substrate GlcCer and downstream metabolites Cere and Glu under PBS, pNM6-NT, and pNM6-miGBA intervention (n=3); c) shows the detection of p-p65 content in AML cells (KG1a, C1498) and normal cells (MCF12a, HL-1) under PBS, pNM6-NT, and pNM6-miGBA intervention (n=3).

[0055] Figure 7The images show fluorescence staining patterns and cell viability analysis of each transfected cell type. Specifically, a) shows AO & EB fluorescence staining patterns of KG1a cells treated with PBS, pNM6-NT, and pNM6-miGBA plasmids for 24 h, 48 h, and 72 h; b) shows quantitative data on the number of KG1a cells under various treatments (n=3); c) shows cell viability analysis of KG1a cells under various treatments (n=3); d) shows AO & EB fluorescence staining patterns of C1498 cells treated with PBS, pNM6-NT, and pNM6-miGBA plasmids for 24 h, 48 h, and 72 h; e) shows quantitative data on the number of C1498 cells under various treatments (n=3); and f) shows cell viability analysis of C1498 cells under various treatments (n=3).

[0056] Figure 8 The images show fluorescence staining patterns and cell viability analysis of each transfected cell type. Specifically, a) shows AO & EB fluorescence staining of MCF12a cells treated with PBS, pNM6-NT, and pNM6-miGBA plasmids for 24 h, 48 h, and 72 h; b) shows quantitative data on the number of MCF12a cells under various treatments (n=3); c) shows cell viability analysis of MCF12a cells under various treatments (n=3); d) shows AO & EB fluorescence staining of HL-1 cells treated with PBS, pNM6-NT, and pNM6-miGBA plasmids for 24 h, 48 h, and 72 h; e) shows quantitative data on the number of HL-1 cells under various treatments (n=3); and f) shows cell viability analysis of HL-1 cells under various treatments (n=3).

[0057] Figure 9 The images show fluorescence staining and cell viability analysis of MCF12a cells after TNFα induction. Image a shows AO & EB fluorescence staining of MCF12a cells treated with PBS, pNM6-NT, and pNM6-miGBA plasmids for 24 h, 48 h, and 72 h after TNFα (10 ng / mL) induction for 1 h. Image b shows quantitative data on the number of MCF12a cells under various treatments (n=3). Image c shows cell viability analysis of MCF12a cells under various treatments (n=3). Image d shows AO & EB fluorescence staining of HL-1 cells treated with PBS, pNM6-NT, and pNM6-miGBA plasmids for 24 h, 48 h, and 72 h after TNFα (10 ng / mL) induction for 1 h. Image e shows quantitative data on the number of HL-1 cells under various treatments (n=3). Image f shows cell viability analysis of HL-1 cells under various treatments (n=3).

[0058] Figure 10Figures show the results of mRNA quantification and proton detection analysis for each transfected cell type. Figure a shows the mRNA quantification results of lysosomal markers lamp1 and lamp2 in AML cells (KG1a, C1498) and normal cells (MCF12a, HL-1) after treatment with PBS, pNM6-NT, and pNM6-miGBA plasmids for 72 h (n=3). Figure b shows the quantitative data of the ratio of Lysosensor and Hoechst fluorescence intensity (n=30). Figure c shows the proton transport capacity detection data (n=30). Statistical significance was tested using a two-tailed, unpaired Student's t-test.

[0059] Figure 11 Results of cell death rescue experiments with different cell death inhibitors for each transfected cell, MDA content determination, fluorescence quantification, and Fe... 2+ The images show the content determination of phosphoprotein (PMP) and the enzyme activity determination of GPX4. a) is the rescue experiment (n=3) after overnight transfection of KG1a and C1498 cells with pNM6-miGBA followed by incubation for 48 h with different cell death inhibitors: pyroptosis inhibitor (Ac, 20 μM), apoptosis inhibitor (ZVAD, 50 μM), necrosis inhibitor (Nec1s, 10 μM), autophagy inhibitor (BA-1, 1 nM), and ferroptosis inhibitor (Lipro-1, 50 nM). b) shows the MDA content determination (n=3). c) is the transmission electron microscopy image of AML cells (KG1a, C1498) and normal cells (MCF12a, HL-1) treated with NT, miGBA, and erastin (10 μM), with red arrows pointing to mitochondria and green arrows pointing to lysosomes. d) is the quantitative fluorescence map of Lipid ROS (n=3). e) shows the Fe... 2+ The content determination data (n=3); f is the enzyme activity determination data of GPX4 (n=3).

[0060] Figure 12 Figure 1 shows the changes in cell viability and p-p65 expression levels after treatment with FeNPs and pNM6-miGBA. Figure 2 shows the changes in cell viability of KG1a, C1498, MCF12a, and HL-1 cells after treatment with different FeNPs (Feraheme) concentrations (0-200 μg / mL) for 72 h. Figure 3 shows the p-p65 expression level data (n=3). Figure 4 shows the changes in cell viability of KG1a, C1498, MCF12a, and HL-1 cells after co-treatment with different FeNPs (Feraheme) concentrations (0-200 μg / mL) and pNM6-miGBA for 72 h (n=3).

[0061] Figure 13Figure 1 shows the results of treatment with pNM6-miGBA plasmid combined with FeNPs; a) is a diagram illustrating the principle of pNM6-miGBA plasmid combined with FeNPs killing AML cells but having no effect on normal cells; b) is a transmission electron micrograph of AML cells (KG1a, C1498) and normal cells (MCF12a, HL-1) treated with pNM6-NT + FeNPs, pNM6-miGBA + FeNPs, pNM6-miGBA, and FeNPs (10 μg / mL), with green arrows pointing to enlarged lysosomes and yellow arrows pointing to normal lysosomes; c) is the effect of BODIP581 / 591 C11 on AML cells (KG1a, C1498) and normal cells (MCF12a, HL-1) treated with pNM6-NT + FeNPs, pNM6-miGBA + FeNPs, and pNM6-miGBA for 72 hours. The fluorescence merge image after h is shown in the supplementary image; the reduced (non-oxdized) and oxidized (oxdized) fluorescence images are also shown. Figure 8 a, FeNPs final concentration was 10 μg / mL; d, Lipid ROS fluorescence quantitative chromatogram (n=3); e, •OH fluorescence quantitative chromatogram (n=3); f, Fe 2+ Content determination data (n=3); g represents the enzyme activity determination of GPX4 (n=3).

[0062] Figure 14 Figure 1 shows the results of treating AML cells and normal cells with FeNPs and pNM6-miGBA; a) shows the fluorescence staining of AML cells (KG1a, C1498) and normal cells (MCF12a, HL-1) with BODIP 581 / 591C11 after 72 h of treatment with pNM6-NT+FeNPs, pNM6-miGBA+FeNPs, and miGBA. Non-metabolic reduced fluorescence and oxdized fluorescence represent oxidized fluorescence. The final FeNP concentration was 10. μg / mL; b represents cell viability data (n=3) of AML cells (KG1a, C1498) and normal cells (MCF12a, HL-1) after 72 h of various treatments (PBS, pNM6-NT, FeNPs, pNM6-NT+FeNPs, pNM6-miGBA, pNM6-miGBA+FeNPs); c represents p-p65 expression levels (n=3) of AML cells (KG1a, C1498) and normal cells (MCF12a, HL-1) after 72 h of various treatments.

[0063] Figure 15The figures show the results of KG1a and C1498 after incubation with FeNPs following pNM6-miGBA transfection; where a is a Venn diagram of differentially expressed genes (DEGs) after KG1a and C1498 transfection with miGBA (KG1a-miGBA, C1498-miGBA) and after co-incubation with FeNPs (10 μg / mL) for 48 h; b is a volcano diagram of DEGs; c is the enrichment results of KEGG pathway analysis of DEGs after incubation with FeNPs (10 μg / mL) following KG1a-miGBA; and d is the enrichment results of KEGG pathway analysis of DEGs in the KG1a-miGBA group.

[0064] Figure 16 Enrichment results of KEGG pathway analysis for DEGs with and without C1498-miGBA and FeNPs; a) Enrichment results of KEGG pathway analysis for DEGs after incubation with C1498-miGBA and FeNPs (10 μg / mL); b) Enrichment results of KEGG pathway analysis for DEGs in the C1498-miGBA group.

[0065] Figure 17 Figure 1 shows the KEGG pathway and GO enrichment results of pNM6-miGBA and FeNPs synergistic therapy; where a is the KEGG enrichment analysis circle diagram of the four DEGs: KG1a-miGBA+FeNPs, KG1a-miGBA, C1498-miGBA+FeNPs, and C1498-miGBA; and b is the GO enrichment analysis of the four DEGs: KG1a-miGBA+FeNPs, KG1a-miGBA, C1498-miGBA+FeNPs, and C1498-miGBA.

[0066] Figure 18 Figure 1 shows the results of animal experiments on AML mice; where a is a schematic diagram of the treatment experiment on AML mice; b is the data on changes in body weight (n=10); c is the survival curve (n=10); d is the weight of spleen, liver, and lung (n=10); e is the H&E staining map of the main tissues (heart, liver, spleen, lung, and kidney); f is the fluorescence map of C1498-GFP in bone marrow (BM); g is the proportion of C1498-GFP positive cells in bone marrow (n=6).

[0067] Figure 19Figure 1 shows the results of AML cells co-administered with miGBA and FeNPs; where a) shows the content data of miGBA, GBAAmRNA, GBA protein, and GBA enzyme activity in C1498 (n=6); b) shows the content of GBA substrate GlcCer, downstream metabolites Cerebrolysin Cer and Glu, and the quantitative detection of p-p65 (n=6); c) shows the determination of Lamp1 and Lamp2 mRNA content, lysosensor fluorescence intensity, and lysosomal proton transport rate (n=6); d) shows the MDA content, •OH fluorescence, and FeNPs activity. 2+ Content and GPX4 enzyme activity assay data (n=6); e represents the blood metabolism and distribution of FeNPs in major tissues, and f represents the blood metabolism and distribution of rNM6-miGBA in major tissues (12h, 24h, 48h) (n=6).

[0068] Figure 20 The results of the mouse safety experiment are shown in the figure below. Figure a is a schematic diagram of the mouse safety experiment, which is divided into 6 groups: Health (healthy mouse group), rNM6-NT (blank control group), FeNPs group, rNM6-NT+FeNPs group, rNM6-miGBA group, and rNM6-miGBA+FeNPs group. Figure b is a graph showing the changes in mouse body weight (n=6). Figure c is a graph showing the abundance of rAAV DNA in various tissues (n=6). Figure d is a graph showing the iron content in various tissues (n=6). Figure e is a graph showing the H&E staining of the main tissues (heart, liver, spleen, lung, and kidney).

[0069] Figure 21 Complete blood count and biochemical parameters of mice (n=3); WBC: white blood cells, RBC: red blood cells, PLT: platelets, HGB: hemoglobin, ALT: alanine aminotransferase, AST: aspartate aminotransferase, ALP: alkaline phosphatase, BUN: blood urea nitrogen, Cr: creatinine; UA: uric acid. Data are presented as mean ± standard deviation (SD). Detailed Implementation

[0070] 1. Construction of each carrier in this invention

[0071] Targeting the two major characteristics of NF-κB transcriptional activity and high activation in AML cells, this invention designs a series of NF-κB-responsive pNM vectors. The DMP sequence in the pDMP-miR vector was modified. The pDMP-miR vector is derived from the inventor's previous article (Gao J, Luo T, Wang J. Gene interfered-ferroptosis therapy for cancers. Nat Commun. 2021 Sep 7; 12(1):5311). The DMP sequence was modified into a series of vectors containing 1 to 10 NF-κB motifs through seamless cloning. The NF-κB motif nucleotide sequence is 5'-GGACTTTCC-3', the spacer fragment nucleotide sequence is 5'-GGGAATTTCCGG-3', and the two NF-κB motifs are connected by a spacer fragment. Specifically, Sangon synthesized nucleotide sequences containing 1 to 10 NF-κB motifs and their spacer fragments (e.g., NF-κB motif + spacer fragment, NF-κB motif + spacer fragment + NF-κB motif, NF-κB motif + spacer fragment + NF-κB motif + spacer fragment, NF-κB motif + spacer fragment + NF-κB motif + spacer fragment + NF-κB motif, and so on up to 10 NF-κB motifs). The pDMP-miR vector was double-digested with Mlu I and EcoRI restriction endonucleases. Then, the synthesized nucleotide sequences were ligated to the digested vectors using a seamless cloning method. The resulting series of vectors containing 1 to 10 NF-κB motifs were identified by cloning and sequencing. Then, pAAV-MCS (Stratagene) was double-digested with Mlu I and Afe I. Using vectors containing 1 to 10 NF-κB motifs as templates, the resulting target fragments containing the NF-κB motifs-minimal promoter-miR30 sequence were amplified and inserted into the digested vectors to obtain the NF-κB-responsive pNM1~10 series vectors. The amplification primers for the target fragments were F: 5'-TGCGGCCGCACACGT-3'; R: 5'-GCTATCTCGAGTGCGGCC-3'. Furthermore, this invention also constructed the pNM-zsGreen vector for screening pNM vectors suitable for AML-specific treatment.Specifically, the zsGreen sequence was amplified from the pHIV-zsGreen plasmid (Addgene) using amplification primers: F: 5'-GGATCCATGGCCCAGTCC-3'; R: 5'-AGCGCTTTAGGGCAAGGCGG-3'. Then, the pNM1-10 series vectors were double-digested with EcoRI and AfeI, respectively. The amplified zsGreen sequence was ligated into the digested pNM1-10 series vectors using a seamless cloning method. Cloning and sequencing confirmed the presence of pNM-zsGreen series vectors containing 1 to 10 NF-κB motifs.

[0072] Simultaneously, this invention, in conjunction with the miR30 system, constructed the pNM6-miR30-shGBA vector (selecting a vector with an optimal number of 6 motifs), named pNM6-miGBA. Figure 3 (a) miR30 gene interference technology utilizes the structural characteristics of miR30 to insert shRNA into the miR30 backbone of NF-κB-responsive pNM1~10 series vectors, silencing the expression of target genes in specific tissues or cells through tissue-specific promoters. The reason for not directly expressing shGBA is that shRNA is mainly regulated by pol III (lacking cell specificity), while NF-κB belongs to pol II and can express miGBA (ensuring cell specificity). Figure 3 (a) Finally, miR30-shGBA and NM6 were combined to design three different miR30-shGBA for human and mouse sources, named mihGBA-1, 2, 3 and mimGBA-1, 2, 3 respectively.

[0073] The specific steps are as follows: Using the BLOCK-iT™ RNAi Designer tool (https: / / rnaidesigner.thermofisher.com / rnaiexpress / ), three groups of human or mouse shRNAs targeting the GBA CDS region were designed. Specific target sites are shown in Table 1. The shGBA sequences designed based on these targets are shown in Table 2, and the oligonucleotide sequences used to synthesize shGBA are shown in Table 3. The forward and reverse strands of the oligonucleotides synthesized in Table 3 (synthesized by Sangon) were denatured and annealed (95 °C, 10 min; then cooled to room temperature) to obtain double-stranded DNA (dsDNA). Then, a Golden Gate reaction was performed using T4 DNA ligase and BsmBI endonuclease. The reaction system (10 μL) consisted of 10 units of BsmBI, 600 units of T4 DNA ligase, 1×T4 DNA ligase buffer, 1 nM dsDNA, and 50 ng pNM6 vector. Golden Gate reactions were performed on a PCR instrument: 10 cycles of 37 °C, 5 min and 16 °C, 10 min, followed by 37 °C, 30 min and 80 °C, 5 min. This yielded pNM6-mihGBA-1, 2, 3 and pNM6-mimGBA-1, 2, 3 vectors. The vector pNM6-mihGBA-1 / pNM6-mimGBA-2, which showed the highest GBA silencing efficiency in human / mouse cells, was named pNM6-miGBA. As a negative control vector, the NT fragment from plasmid pcDNA™ 6.2-GW / EmGFP-miR-Neg (Thermo Fisher Scientific) was copied into the pNM6 vector and named pNM6-NT. The plasmid map of pNM6-miGBA can be found in [link to pNM6-miGBA]. Figure 1 The gene structure of pNM6-mihGBA-1 is shown in Figure A. Figure 1 As shown in B, the structures of the pNM6-mihGBA2,3 and pNM6-mimGBA-1,2,3 vectors in this application can be obtained simply by replacing the bases in the boxes with the sequences SEQ ID NO.9~SEQ ID NO.13 in Table 2. All plasmids were verified to be correct by DNA sequencing.

[0074] Table 1 Targets of miGBA

[0075] Table 2. Sequences of shGBA designed based on miGBA targets.

[0076] Table 3 shows the oligonucleotide sequences used to construct miRNA expression plasmids.

[0077] 2. Cell Culture

[0078] The AML cells and normal cells used in this invention are: KG1a (human acute myeloid leukemia cells), WEHI-3 (mouse myeloid leukemia cells), SKNO01 (human acute myeloid leukemia cells), and C1498 (mouse acute myeloid leukemia cells), which were purchased from the American Type Culture Collection (ATCC). THP-1 (human monocytic leukemia cells), U937 (human monocytic leukemia cells), HL60 (human acute promyelocytic leukemia cells), MCF12a (human normal mammary epithelial cells), BEAS-2B (human normal lung epithelial cells), HMEC-1 (human microvascular endothelial cells), NIH-3T3 (mouse embryonic fibroblasts), L929 (mouse fibroblasts), GES-1 (human gastric mucosal epithelial cells), MRC-5 (human embryonic lung cells), AML-12 (mouse normal hepatocytes), HL-1 (mouse cardiomyocytes), HEK-293T (human embryonic kidney cells), and C2C12 (mouse myoblasts) were purchased from the Cell Resource Center of the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. C1498-GFP cells were purchased from Shanghai Xinyu Biotechnology Co., Ltd., and EL9611 (mouse erythroleukemia cells) were obtained from Nanjing Municipal Hospital of Traditional Chinese Medicine. NB4 (human acute promyelocytic leukemia cells) and ML-2 (human acute myeloid monocytic leukemia cells) were purchased from the German Microbiology and Cell Culture Collection (DSMZ). All cell lines were identified and tested for mycoplasma.

[0079] KG1a, WEHI-3, SKNO01, C1498, THP-1, U937, HL60, NB4, ML-2, and EL9611 were cultured in RPMI-1640 (Gibco); MCF12a, NIH-3T3, L929, GES-1, MRC-5, C2C12, and HEK-293 were cultured in DMEM (Gibco); HL-1 was cultured in Claycon medium (Sigma, 51800C) with additional 0.1 mM norepinephrine (Sigma, 489350) and 2 mM L-glutamine (Sigma, G8540). HMEC-1 was cultured in MCDB131 (Gibco, 10372019) with additional 10 ng / ml hEGF (Sigma, GF144). AML-12 cells were cultured in DMEM / F12 medium supplemented with 1% ITS liquid medium supplement (Sigma, I3146) and 40 ng / mL dexamethasone (Sigma, 265005). All cell cultures were supplemented with 10% fetal bovine serum (Gibco, 10091148) and 100 U / mL penicillin (Gibco) and 100 μg / mL streptomycin (Gibco), and cultured in a humidified incubator at 37°C with 5% CO2.

[0080] 3. Cell transfection and acridine orange & ethidium bromide (AO & EB) staining experiments

[0081] The various cells in the logarithmic growth phase cultured in step 2 (1×10⁶) 5Cells were seeded into 24-well plates and cultured overnight. Then, 500 ng of plasmids (pNM6-NT, pNM6-mihGBA-1, 2, 3, and pNM6-mimGBA-1, 2, 3) were transfected with 2.5 µL of Lipofectamine 2000 (Thermo). Depending on the cell species, C1498 and HL-1 cells were transfected with mouse-targeted miGBA vectors for 24 h, 48 h, and 72 h; KG1a and MCF12a cells were transfected with human-targeted miGBA vectors for 24 h, 48 h, and 72 h. At the corresponding time points, all cells were stained with AO & EB (Sangon, E607308). According to the kit instructions, for adherent cells, the culture medium was removed, PBS buffer was added, and then AO and EB were added at 10 µL each per 180 µL of PBS buffer. Cells were incubated at room temperature in the dark for 5 min. For suspension cells, centrifuge at 1,000 rpm for 5 min, then remove the culture medium. Subsequent steps are the same as for adherent cells. Live cells will appear uniformly green, while necrotic cells will stain orange. Images of the cells are taken under a fluorescence microscope to observe live and dead cells, and data are statistically analyzed using ImageJ software.

[0082] 4. CCK-8 Experiment

[0083] The reagents used in CCC-8, including TNFα, Bafilomycin A1 (BA1), ZVAD-FMK (ZVAD), Necrostatin-1s (Nec1s), Liproxstatin-1 (lipro-1), and Ac-DMLD-CMK (Ac), were purchased from MedChemExpress.

[0084] Cell viability was measured and analyzed using the Cell Counting Kit-8 (CCK-8, Beyotime). Cells (5 × 10⁻⁶) were... 3The plasmid was seeded into 96-well plates and incubated overnight at 37°C with 5% CO2. Then, the plasmid (200 ng / well) was transfected into the cells using Lipofectamine 2000. TNF-α induction (final concentration 10 ng / mL) was performed 1 h before transfection. After overnight transfection, FeNPs (final concentration 10 μg / mL) were added as needed, and the cells were incubated for 24 h, 48 h, and 72 h. FeNPs were obtained from AMAG Pharmaceuticals. In experiments on the effects of various inhibitors on cell viability, overnight transfected cells were incubated with inhibitors for 48 hours. The inhibitors used included pyroptosis inhibitors (Ac, 20 μM, MCE, HY-P10939), apoptosis inhibitors (ZVAD, 50 μM, MCE, HY-16658B), necrosis inhibitors (Nec1s, 10 μM, MCE, HY-14622A), autophagy inhibitors (BA-1, 1 nM, MCE, HY-100558), and ferroptosis inhibitors (Lipro-1, 50 nM, MCE, HY-12726). TNFα, Bafilomycin A1 (BA1), ZVAD-FMK (ZVAD), Necrostatin-1s (Nec1s), Liproxstatin-1 (lipro-1), and Ac-DMLD-CMK (Ac) were purchased from MedChemExpress. As needed, in experiments investigating the effect of FeNP concentration on cell viability, cells were incubated for 72 h with culture media containing different concentrations of FeNP (0–200 μg / mL). After incubation, CCK-8 reagent (10 μL / well) was added to the cells and incubated for 1 h. Finally, the absorbance of the solution was measured at 450 nm using a microplate reader.

[0085] 5. GBA enzyme activity detection

[0086] According to the method of the GBA enzyme activity assay kit (Abcam, ab273339), cell pellet (1×10⁻⁶) was collected. 7 Homogenize the sample in the lysis buffer, place on ice for 10 min, centrifuge at 12,000×g, 4°C for 10 min, and collect the supernatant as the sample. Add the prepared sample and the GBA substrate containing the fluorescent group to a 96-well plate, mix well, react at 37°C for 30 min, and finally read the fluorescence data on a microplate reader (Ex / Em=360 / 445 nm).

[0087] 6. GPX4 enzyme activity detection

[0088] Cells were collected by centrifugation at 1,000×g, 4°C for 10 min using the GPX4 enzyme activity assay kit (Sigma, 353919). After centrifugation, the cells were lysed on ice using homogenization buffer (50 nM Tris-HCl, pH 7.5; 5 mM EDTA, 1 mM DTT). Subsequently, the cells were centrifuged at 10,000×g, 4°C for 15 min. 20 µL of the supernatant was added sequentially to the wells of a 96-well plate along with 50 µL of Diluted Assay Buffer, 50 µL of Co-Substrate Mixture, and 50 µL of NADPH. 20 µL of cumene hydroperoxide was added to each well, and the plate was gently vortexed for 5 s. The absorbance was then read at 340 nm per minute using a microplate reader, obtaining at least five time points to calculate GPX4 enzyme activity.

[0089] 7. Determination of Glc, Cer, Cer, and Glu

[0090] A known amount of stable isotope internal standard [Glucose-] was first added to the cell pellet. 13 [C6 (MCE, 110187-42-3), d7-Cer (d18:1-d7 / 18:0) (Sigma, 860677P), d5-GlcCer (18:1) (Sigma, 860673P)] were used. Subsequently, a Folch extraction system (methanol:chloroform:water = 2:1:0.8, vortexed for 10 min, centrifuged at 1,6000×g for 10 min, 4℃) was used to recover the organic and aqueous phases, and each phase was divided into two equal parts. The organic phase was dried with nitrogen and then redissolved in methanol. The Cer and GluCer were quantified by reversed-phase C18 column coupled with triple quadrupole mass spectrometry (Waters Xevo TQ-XS) in positive ionization MRM mode, using d7-Cer and d5-GlcCer as internal standards. After drying the aqueous phase with nitrogen, it was resuspended in acetonitrile:water 1:1 and analyzed using a HILIC column in MRM mode on the same UPLC-TQ platform with glucose- 13 C6 (Sigma, 389374) was used as the internal standard for glucose quantification. The entire procedure was completed after the addition of the internal standard to correct for recovery and matrix effects. A matrix-matched standard curve was established in the matrix, and the recovery rate, matrix effect, linear range, recovery correction precision, and stability were verified according to the Matuszewski method to ensure reliable differentiation and reproducible quantification of GlcCer, Cer, and Glu.

[0091] 8. Fe 2+ Detection

[0092] Using Fe 2+Quantitative analysis was performed using a detection kit (Boxbio, AKIC004M). Fe 2+ Under acidic conditions, it can form a blue complex (3,3',5,5'-Tetramethylbenzidine, TPTZ) with tripyridyltriazine. The product has a characteristic absorption peak at 593 nm, and Fe can be quantitatively detected by observing the change in absorbance. 2+ The specific procedures include pretreatment of the sample on ice (cell lysis and tissue homogenization), addition of chromogenic reagents for colorimetric reaction, and reading the absorbance at 593 nm using a microplate reader.

[0093] 9. ELISA testing

[0094] We used ELISA kits to quantitatively detect protein expression, including p-p65 (Abcam, ab176647) and GBA (Aviva, mouse OKEH03366; human OKCD08164). The main steps included: preparing reagents according to the manufacturer's instructions and allowing them to reach room temperature. Adding 50 µL of the sample or control to each well, followed by 50 µL of antibody mixture, incubating at room temperature for 1 h, discarding the supernatant, and washing three times with Wash Buffer. Adding 100 µL of TMB substrate and developing the reaction in the dark for 15 min; then adding 100 µL of stop solution to terminate the reaction, and immediately reading the OD value at 450 nm.

[0095] 10. MDA determination

[0096] Collect 2×10 6 Cells were washed in ice-cold PBS. Cells were resuspended in 300 µL of lysis buffer, and 3 µL of BHT stock solution was added (BHT prevents further peroxidation of the sample during treatment). Homogenization and sonication were then performed. After treatment, the cells were centrifuged at 13,000 × g for 10 min, and the supernatant was collected to obtain the test sample. According to the manufacturer's instructions (Abcam, ab118970), MDA standard solution and Developer Mix were prepared. 600 µL of Developer Mix was mixed with 200 µL of the standard or test sample, and incubated at 95°C for 60 min, followed by 10 min on ice. 200 µL of the above reaction solution was added sequentially to the wells of a 96-well plate, and the OD value was immediately read at 532 nm.

[0097] 11. ROS testing

[0098] Using the lipid peroxidation kit BODIPY ®Lipid peroxidation in cells was detected using the 581 / 591 C11 (Invitrogen) fluorescence microscope, and imaged using emission filters at 590 nm and 510 nm and a 40× objective lens. The fluorescence intensity and ratio in the 590 and 510 channels were analyzed and calculated using ImageJ software to quantify cellular lipid peroxidation. Intracellular •OH radical (•OH) detection and quantification were performed using a Biorab HR8841 kit. This product utilizes the •OH-specific green fluorescent probe O27 for hydroxyl radical detection. O27 can freely permeate the cell membrane and enter the cell, where it is oxidized by •OH, producing a green fluorescent product. The fluorescence data (Ex / Em = 488 / 525 nm) was read using a microplate reader.

[0099] 12. miGBA Measurement

[0100] Lyse each cell using 1 mL of TRIzol (Sigma) (1×10⁻⁶). 7RNA was extracted from the aqueous phase by adding 200 µL of chloroform, precipitating the RNA with 1 mL of isopropanol, washing with 200 µL of 75% ethanol, and then dissolving in 100 µL of ddH2O. The total RNA concentration was measured using Nanodrop. The entire process must be RNase-free to ensure no RNA degradation, thus obtaining the total RNA for each cell. The first strand of miRNA cDNA (Vazyme, MR101) was synthesized using the miRNA 1st Strand cDNA Synthesis Kit. First, genomic DNA was removed using gDNA Wiper Mix. The reaction mixture consisted of 2 µL of 5×gDNA Wiper Mix, 1 µg of total RNA, and ddH2O to a final volume of 10 µL. The reaction program was as follows: 42°C for 2 min. First-strand cDNA was then synthesized using stem-loop primers (Table 3) and reverse transcriptase. The reaction system consisted of: 10 µL genomic DNA removed, 1 µL Stem-loop primer (2 µM), 2 µL 10× RT Mix, 2 µL HiScript II Enzyme Mix, and 5 µL ddH2O. The reaction program was as follows: 25°C for 5 min; 50°C for 15 min; 85°C for 5 min. The synthesized product was used for the quantitative detection of miRNAs. Primers are shown in Table 4. The reaction system consisted of: 0.4 µL forward primer, 0.4 µL Universal miGBA-R, 10 µL 2×Taq Pro Universal SYBR qPCR MasterMix, and 9.2 µL cDNA. The reaction program was as follows: 95°C for 15 min; 35 cycles of 95°C for 5 s and 60°C for 30 s were performed.

[0101] Table 4 Primers for miRNA detection

[0102] 13. TEM imaging

[0103] AML cells and normal cells were transfected overnight with pNM6-NT and pNM6-miGBA, respectively. The positive control group was treated with Erastin (final concentration 10 µM, 8 h). After treatment, cells were fixed overnight at 4°C with calcium carbonate buffer (0.1 M, pH 7.4) containing 2.5% glutaraldehyde. Subsequently, cells were further fixed for 1 h at room temperature with a solution containing 2% osmium tetroxide, 0.1 M dimethylarsine, and 1.5% potassium ferrocyanide. Next, cells underwent a series of fractionated ethanol dehydration processes, and the dehydrated cells were embedded in epoxy resin. The embedded cells were cut into ultrathin sections, stained with uranyl acetate and lead citrate, and finally observed and photographed under a transmission electron microscope.

[0104] 14. LysoSensor staining

[0105] LysoSensor (Invitrogen) was used to monitor the acidification level of lysosomes in cells. After treatment with pNM6-NT and pNM6-miGBA, LysoSensor (final concentration 1 µM) was added and the cells were incubated for 2 h. Afterward, the culture medium was replaced with fresh medium, and observations were performed using a fluorescence microscope. Data were statistically analyzed using ImageJ software.

[0106] 15. Assay of lysosomal proton transport activity

[0107] AML cells, normal cells, and cells transfected with pNM6-NT and pNM6-miGBA were placed in DMEM containing 2 mg / ml FITC-glucan and incubated on ice for 5 min. They were then transferred to a 37 °C incubator and incubated for 30 min, followed by another 30 min in DMEM to allow FITC-glucan to be transported to lysosomes. Lysosomes were collected and resuspended in detection buffer (125 mM KCl, 1 mM EDTA, 20 mM HEPES, pH 7.5) and equilibrated on ice for 1 h. They were then mixed with 5 µM concanavalin A (MCE, HY-P2149) and DMSO, respectively, and incubated at 37 °C for 10 min. FITC fluorescence was recorded using a microplate reader. Subsequently, 5 mM Mg-ATP (Shanghai Xinyu Biotechnology Co., Ltd., XY90005PZ) was added, and the initial slope of fluorescence quenching was measured to assess lysosomal proton transport activity.

[0108] 16. Quantitative PCR (Q-PCR)

[0109] Cells were lysed using 1 mL of TRIzol (Sigma) (1×10⁻⁶ cells / mL). 7RNA was extracted from the aqueous phase using 200 µL chloroform, precipitated with 1 mL isopropanol, washed with 200 µL 75% ethanol, and dissolved in 100 µL ddH2O. Total RNA concentration was measured using Nanodrop. The entire process must be RNase-free to ensure no RNA degradation. cDNA was synthesized via reverse transcription using the HiScript II 1stStrand cDNA Synthesis Kit (Vazyme). Subsequently, quantitative real-time PCR amplification was performed using the HiScript II One Step RT-PCR Kit (Vazyme). The reaction mixture consisted of 2 µL forward primer, 2 µL reverse primer, 25 µL One Step Mix, 2.5 µL One Step Enzyme Mix, 8.5 µL cDNA, and 10 µL ddH2O. The reaction program was as follows: 94°C for 3 min; 35 cycles of 94°C for 30 s and 60°C for 30 s were performed. GADPH was used as an internal control to measure mRNA transcription levels (RQ = 2). –ΔΔCt Corrections were made. Primer information is shown in Table 5. All experiments were repeated three times for verification.

[0110] Table 5 Primer sequences used for qPCR

[0111] 17. Preparation and titration of viruses

[0112] 5×10 6 One HEK-293T cell was seeded at a 75 cm² depth. 2Cells were cultured overnight in DMEM medium in culture flasks, and transfected with three plasmids, including two helper plasmids pAAV-RC (Zoman, ZK735) and pHelper (Zoman, ZK736) and one pAAV plasmid (pNM6-NT or pNM6-miGBA). After 72 h of further culture, cells and culture medium were collected in 50 mL centrifuge tubes and frozen overnight at -80°C. The frozen cells and culture medium were then thawed by incubating in a 37°C water bath for 2 h. The entire freezing and thawing process was repeated three times. After freezing and thawing, pure chloroform (1:10 volume) was added, and the 50 mL centrifuge tubes were vigorously shaken at 37°C for 1 h. After shaking, 1 M NaCl was added, and the tubes were centrifuged at 15,000 rpm for 15 min at 4°C. Immediately afterwards, the supernatant was aspirated, and PEG8000 was added to a final concentration of 10% (w / v). The mixture was shaken until dissolved, and then centrifuged at 15,000 rpm for 15 min at 4°C. The supernatant was discarded, the precipitate was dissolved in PBS, and DNase and RNase (both to a final concentration of 1 µg / mL) were added. The mixture was incubated at room temperature for 30 min. Finally, the incubated reaction solution was extracted once with chloroform (1:1 volume). After separation, the upper aqueous phase was collected in a new test tube to obtain the purified virus. The obtained serotypes of AAV2 virus were named rNM6-NT and rNM6-miGBA, respectively.

[0113] 18. RNA-seq

[0114] This invention comprises six RNA-seq samples (blank groups C1498 and KG1a, FeNPs and pNM6-miGBA co-treated groups, and C1498 and KG1a transfected with pNM6-miGBA alone for 72 h), with each group subjected to three biological replicates. RNA was extracted using TRIzol, and degradation and contamination were detected by 1% agarose gel electrophoresis. Purity was assessed by Nanodrop OD260 / OD280, concentration was quantified using Qubit, and integrity and insert size were determined using Agilent 2100. After passing quality control, 150 bppaired-end sequencing was performed using the Illumina platform, and clean reads were aligned with the reference genome using HISAT2.

[0115] 19. GO and KEGG Analysis

[0116] The expression levels of mRNA for each gene in the samples were analyzed using HTSeq software, and differentially expressed genes (DEGs, P < 0.05) were screened using the DESeq R software package. DEGs with an FDR < 0.05 and an absolute fold change (|fold change|) ≥ 2 were further analyzed using GO and KEGG methods. GO functional enrichment analysis was performed on the DEGs using DAVID, and signaling pathways were mapped in the KEGG database for annotation.

[0117] 20. Treatment of Acute Myeloid Leukemia in Mice

[0118] By injecting 5 x 10 mmol / L into the tail vein of healthy C57BL / 6 (male, 8 weeks old) mice 6 C1498 cells / mouse were used to construct an AML mouse model, and treatment began 10 days after drug administration.

[0119] The mouse experiment was conducted in three batches. The first batch consisted of 12 groups (n=10): healthy mice, PBS injection group, rNM6-NT group, FeNPs group, rNM6-NT+FeNPs (0) group, rNM6-miGBA group, rNM6-miGBA+FeNPs (0) group, rNM6-miGBA+FeNPs (1) group, rNM6-miGBA+FeNPs (2) group, rNM6-miGBA+FeNPs (3) group, rNM6-miGBA+FeNPs (5) group, and rNM6-miGBA+FeNPs (7) group; the numbers in parentheses indicate the number of days between the administration of rNM6-miGBA and FeNPs. The dosage of rNM6-miGBA was 1 x 10⁻⁶. 11 / Mice were administered FeNPs at a dose of 1 mg / kg. The body weight and survival curves of the mice were recorded.

[0120] The second batch consisted of four groups (n=6): healthy mice, rNM6-NT+FeNPs, rNM6-miGBA, and rNM6-miGBA+FeNPs. The interval between rNM6-miGBA and FeNPs administration was 2 days, and the dose of rNM6-miGBA was 1 x 10⁻⁶. 11 / Mice were administered FeNPs at a dose of 1 mg / kg. On day 20 after AML modeling, mice were uniformly euthanized, and the major organs (heart, liver, spleen, lungs, and kidneys) were weighed and observed using H&E staining.

[0121] The third batch of mice was injected intravenously with 5 x 10⁵ C57BL / 6 (male, 8 weeks old) healthy mice via the tail vein. 6C1498-GFP cells / mouse were used to enrich mouse bone marrow AML cells. Four groups (n=6) were selected: healthy mice, NT+FeNPs, rNM6-miGBA, and rNM6-miGBA+FeNPs. The interval between rNM6-miGBA and FeNPs administration was 2 days, and the rNM6-miGBA dose was 1 x 10⁻⁶. 11 / Mice, FeNPs were administered at a dose of 1 mg / kg mice.

[0122] 21. Biosafety Analysis

[0123] We randomly divided healthy C57BL / 6 mice (male, 8 weeks old) into 6 groups (n=6): healthy mice, rNM6-NT, FeNPs, rNM6-NT+FeNPs, rNM6-miGBA, and rNM6-miGBA+FeNPs. The rNM6-miGBA dosage was 1 x 10⁻⁶. 11 In mice, FeNPs were administered at a dose of 1 mg / kg. The interval between tail vein administration of rNM6-miGBA and FeNPs was 2 days. Body weight, complete blood count, liver and kidney biochemical indicators, rAAV abundance, iron content, and pathological conditions (H&E) in major tissues were measured. Simultaneously, the metabolism of rNM6-miGBA and FeNPs in blood (0 min, 1 min, 5 min, 10 min, 30 min, 1 h, 2 h, 4 h, 8 h, 12 h, 24 h) and major tissues (12 h, 24 h, 48 h) was also examined.

[0124] 22. Data Analysis

[0125] All data are expressed as mean ± standard deviation (SD), and statistical analysis and plotting were performed using GraphPad Prism 8.0 software. Normality was first assessed using the Shapiro-Wilk test, and homogeneity of variance among groups was assessed using the Levene test. If the data were normally distributed and homogeneous in variance, a two-tailed, unpaired Student's t-test was used for significance analysis; otherwise, a nonparametric test (Mann-Whitney U test) was used. Statistical significance levels were set as *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

[0126] 23. Experimental Results

[0127] 23.1 Experimental Results of Viral Vectors

[0128] The NF-κB-responsive pNM1~10 series vectors constructed above contain NF-κB-high affinity motifs, minimal promoters, and downstream effector elements (genes or RNAi). Figure 1 The activation of the p65 / p50 heterodimer is a key process in the NF-κB activation pathway, with p65 phosphorylation (p-p65) playing a decisive role in NF-κB transcriptional activity. Therefore, we first examined the activity of p-p65 in 10 AML cell lines and 10 normal cell lines. The results showed that p-p65 was highly activated in all 10 AML cell lines, with relatively high expression levels in THP-1, U937, and KG1a, and the lowest in C1498. Figure 2 (a) In normal cells, p-p65 is almost not expressed ( Figure 2 (a) in the middle.

[0129] Although NF-κB is almost inactive in normal cells, to ensure the in vivo safety of the pNM vector (no response to normal cell substances) and the maximum expression of effector elements in AML cells, we integrated 1-10 designed NF-κB motifs into the pNM vector and used zsGreen as a reporter gene for detection. Figure 2 (b) Data showed that the fluorescence intensity of zsGreen significantly increased in AML cells (KG1a and C1498) with increasing NF-κB motif numbers. However, in normal cells (MCF12a and HL-1), weak green fluorescence was observed in MCF12a when the number of NF-κB motifs increased to 7. Figure 2 (b and c in the original text). Although the fluorescence intensity of pNM7-zsGreen in MCF12a was very weak and not observed in HL-1, considering in vivo safety, we used pNM6 as the subsequent therapeutic carrier ( Figure 3 (a) in the middle.

[0130] The results of cell transfection with pNM6-NT, pNM6-mihGBA-1,2,3, and pNM6-mimGBA-1,2,3 vectors constructed in this invention showed that their expression in AML cells (KG1a, C1498) gradually increased over time (24~72h). Figure 3 (b) effectively silences GBA mRNA ( Figure 4 a) Protein level ( Figure 5 (a and b in the text) significantly inhibited GBA enzyme activity ( Figure 5 (a and b in the text); but it has no effect on normal cells (MCF12a, HL-1). Figure 3 c in Figure 4 b and d in Figure 5 (c and d in the original text). Furthermore, under the induction of TNFα (a classic NF-κB activator), normal cells, like AML cells, will also produce miGBA (…). Figure 3 c), silencing GBA mRNA ( Figure 4 b) Protein level ( Figure 5 e and f in the formula significantly inhibit GBA enzyme activity ( Figure 5 (e and f in the text). This indicates that pNM6-miGBA has NF-κB specificity. We used mihGBA-1, 2, 3, and mihGBA-1 and mimGBA-2, which have the strongest silencing efficiency among mihGBA-1, 2, 3, for subsequent studies ( Figure 4 and Figure 5 ), and named together as miGBA.

[0131] To investigate the cytotoxicity of miGBA against AML cells, we transfected miGBA into AML cells and normal cells. The results showed that miGBA could time-dependently enhance the killing rate of AML cells but had no effect on normal cells. Figure 3 d and Figure 7 and Figure 8 Furthermore, normal cells can also be killed by miGBA under the induction of TNFα, indicating that miGBA is an AML-specific killer based on NF-κB. Figure 3 d and Figure 9 ).

[0132] To investigate the mechanism of miGBA's killing effect on AML cells, we first quantitatively analyzed the GBA substrate GlcCer and its downstream metabolites Cerebrolysin (Cer) and glucose (Glu). The results showed that GBA inhibition led to the accumulation of GlcCer in AML cells, while Cerebrolysin (Cer) and glucose (Glu) were significantly reduced, but normal cells were unaffected. Figure 6 (a and b in the original text). GlcCer is an important component of the lysosomal membrane, and its excessive accumulation can lead to lysosomal storage impairment. The reduction in Glu is not as significant as that in Cer because GBA-mediated GlcCer metabolism is not the main pathway for Glu production. The significant increase in the expression levels of lysosomal markers lamp1 and lamp2 also indicates that miGBA induces lysosomal storage impairment in AML cells. Figure 10 (a) In addition, by detecting the fluorescence intensity of the lysosensor probe and the proton transport activity of lysosomes, we found that lysosomal storage impairment further leads to a decrease in lysosomal activity in AML cells (a). Figure 10 (b and c in the text). However, miGBA has no effect on the lysosomal function of normal cells ( Figure 10We measured the expression of p-p65 in cells after miGBA transfection, and the results showed that miGBA stimulated further activation of p-p65 in AML cells. Figure 6 (c) This is because lysosomal storage impairment leads to increased membrane permeability, and the released large amount of contents activates NF-κB. The activation of p-p65 then forms a positive feedback loop, further promoting miGBA expression, ultimately causing AML cells to die due to lysosomal storage impairment. Figure 6 c and Figure 7 In normal cells, the almost inactive p-p65 cannot initiate this cycle. Figure 6 c and Figure 8 ).

[0133] To explore the specific mechanism of miGBA-induced AML cell death, we first attempted to rescue miGBA-induced cell death using various cell death inhibitors. The results showed that pyroptosis inhibitors (Ac), apoptosis inhibitors (ZVAD), necrosis inhibitors (Nec1s), autophagy inhibitors (BA-1), and ferroptosis inhibitors (Lipro-1) could all rescue miGBA-induced AML cell death to some extent, but Lipro-1 was the most significant. Figure 11 (a) This is because lysosomes are cellular iron reservoirs, and impaired iron storage will release iron ions, inducing ferroptosis. To confirm this hypothesis, we first examined the levels of the ferroptosis marker MDA. The data showed that miGBA, similar to the ferroptosis-positive drug Erastin, significantly upregulated MDA in AML cells, but this upregulation could be reversed by Lipro-1. Figure 11 (b) Transmission electron microscopy (TEM) directly confirmed that miGBA induces lysosomal enlargement and storage disorders in AML cells; mitochondria show signs of shrinkage, increased membrane density, and thickened cristae. Figure 11 (c) It is worth noting that miGBA has a similar effect on mitochondria as Erastin, but Erastin does not cause lysosomal accumulation ( Figure 11 (c) This suggests that miGBA's impaired lysosomal storage is key to inducing ferroptosis in AML cells. We investigated lipid peroxidation levels (lipROS) and Fe in AML cells. 2+ Further assays were performed on the enzyme activity of GPX4 in AML cells, and the results showed that after miGBA induction, lipROS and Fe... 2+ The content of [a substance] increased significantly, and the activity of GPX4, a key antioxidant enzyme in ferroptosis, was inhibited. Figure 11 d in Figure 11 e and Figure 11(f) More importantly, miGBA affects the morphology of normal cell mitochondria and lysosomes, as well as lipROS and Fe. 2+ GPX4 activity was not affected, but Erastin had a significant ferroptosis effect and lacked AML specificity. Figure 11 d in Figure 11 e and Figure 11 (f in the text). This result fully demonstrates the specificity and therapeutic safety of miGBA for AML.

[0134] 23.2 Experimental Results of Vectors and Their Packaging Viruses 23.2.1. pNM6-miGBA and Feraheme (FeNPs) synergistically induce severe ferroptosis in AML cells. To address the high activation of NF-κB in AML cells, we designed an NF-κB-responsive pNM series of vectors. These vectors contain NF-κB-highly-affinity motifs, a minimal promoter, and downstream microRNAs. Although NF-κB is almost inactive in normal cells, to ensure the in vivo safety of the pNM vectors (no response to normal cell substances) and maximal expression of effector elements in AML cells, we designed 1-10 NF-κB motifs to be integrated into the pNM vectors and examined miGBA expression levels. Data showed that miGBA expression significantly increased in AML cells (KG1a and C1498) with increasing NF-κB motif numbers. However, in normal cells (MCF12a and HL-1), miGBA expression levels were low when the number of NF-κB motifs increased to 7. Although pNM7-miGBA shows weak miGBA expression in normal cells, we used pNM6-miGBA as a subsequent therapeutic vector, which can be used for packaging adeno-associated virus, considering in vivo safety.

[0135] Excess Fe 2+ It can undergo the Fenton reaction within cells, generating a large number of toxic hydroxyl radicals (•OH), which further induces the activation of NF-κB, i.e., phosphorylation of p65 (p-p65), positively amplifying the therapeutic effect of miGBA. Furthermore, Fe... 2+ It can also cause lipid peroxidation in cells, leading to ferroptosis. Therefore, this invention introduces Feraheme (FeNPs), a clinically used intravenous iron supplement. As a nanomedicine, its core is composed of iron oxide (Fe3O4 / γ-Fe2O3), containing a large amount of Fe. 2+The outer layer is coated with carboxyglucan and has a diameter of approximately 17-31 nm. Studies have reported that FeNPs are mainly located in lysosomes and can selectively kill AML cells with low-ferrotransporter (FPN) via iron overload and the Fenton reaction, while also possessing protective functions against hematopoietic stem cells (HSCs). The location and biological function of FeNPs are highly consistent with the killing mechanism of miGBA against AML. To expand the ferroptotic effect of miGBA on AML, we investigated the possibility of synergistic treatment of AML with FeNPs and pNM6-miGBA. Data showed that FeNP concentrations of 0-60 μg / mL had good biocompatibility with both AML and normal cells. Figure 12 (a) but FeNPs exceeding 30 μg / mL can induce activation of cell p-p65 ( Figure 12 (b) Importantly, ultra-low doses of FeNPs (10 μg / mL) synergistically with pNM6-miGBA were able to kill the vast majority of AML cells without affecting normal cells. Figure 12 (c) In fact, the concentration of FeNPs is crucial for pNM6-miGBA. First, the FeNP content cannot be too high, as excessively high concentrations of FeNPs will generate a large amount of •OH, which will kill normal cells. Second, the amount of •OH released by FeNPs cannot induce an increase in p-p65 levels in normal cells; otherwise, p-p65 activation will initiate pNM6-miGBA, which is catastrophic for normal cells. Considering safety and therapeutic efficacy, we used an ultra-low dose of FeNPs (10 μg / ml) as the subsequent experimental dose.

[0136] We hypothesize that miGBA-induced AML cell lysosomes experience storage impairment, leading to the accumulation of FeNPs within the lysosomes, continuously generating •OH, stimulating p-p65 activation, forming a positive feedback loop, and ultimately causing AML cells to die from lysosomal damage and ferroptosis. Figure 13 (a) To verify this hypothesis, we directly observed AML cells and normal cells treated with miGBA and FeNPs synergistically using TEM. The results showed that both miGBA alone and miGBA synergistic treatment with FeNPs led to lysosomal storage impairment in AML cells, but had no effect on normal cells. Figure 13 (b) It is noteworthy that a large amount of FeNPs accumulation was observed in the lysosomes of the pNM6-miGBA+FeNPs group, but FeNPs alone had no effect on any of the cells ( Figure 13(b) This suggests the biocompatibility of low-dose FeNPs with lysosomes. We characterized ferroptosis in AML cells and normal cells and found that the pNM6-miGBA+FeNPs group showed the most significant increases in lipROS and •OH, which were much higher than those in the pNM6-miGBA group (b). Figure 13 FeNPs alone do not affect intracellular lipROS and •OH because cells can metabolize low doses of FeNPs (ce). Figure 13 ce in Figure 14 (a) In addition, we also measured intracellular Fe. 2+ The results showed that the pNM6-miGBA+FeNPs group could significantly increase Fe in AML cells. 2+ The level improved the single miGBA response to Fe 2+ Insufficient induction defects ( Figure 13 (f in the text). Similarly, the pNM6-miGBA+FeNPs group significantly inhibited the enzyme activity of GPX4 in AML cells, but had no effect on normal cells. Figure 13 Finally, we examined the synergistic killing effect of pNM6-miGBA and FeNPs on AML cells. The results showed that the pNM6-miGBA+FeNPs group was able to clear the vast majority of AML cells, significantly improving the single efficacy of pNM6-miGBA and FeNPs, and exhibiting good biocompatibility with normal cells. Figure 14 (b) This is due to the positive feedback regulation that continuously activates p-p65 after treatment with pNM6-miGBA and FeNPs. Figure 14 (c) In conclusion, the synergistic treatment of pNM6-miGBA and FeNPs is devastating in its effectiveness against AML.

[0137] To explore the molecular mechanism of synergistic treatment with pNM6-miGBA and FeNPs, we performed RNA-seq analysis on AML cells (C1498 and KG1a). Venn diagrams and volcano plots showed that GBA was significantly knocked down in both C1498 and KG1a cells after treatment with pNM6-miGBA or pNM6-miGBA and FeNPs. Figure 15 (a and b in the text) confirmed the effectiveness of miGBA in silencing GBA mRNA. Furthermore, the ferroptosis marker gene ferritin FTL was significantly upregulated in all treatment groups ( Figure 15 (a and b in the text) suggests that both miGBA and miGBA combined with FeNPs significantly affected iron metabolism in AML. KEGG pathway analysis showed that ferroptosis was most pronounced in KG1a cells after treatment with pNM6-miGBA and FeNPs. Figure 15c). Single pNM6-miGBA treatment is more likely to trigger neurological disorders such as Parkinson's and Alzheimer's ( ). Figure 15 The d in the text is consistent with the physiological function of GBA. In C1498 cells, both single treatment with pNM6-miGBA and synergistic treatment with pNM6-miGBA and FeNPs significantly induced ferroptosis and the Fatty acid metabolism pathway, indicating that iron metabolism and lipid metabolism are disordered in AML cells. Figure 16 KEGG pathway and GO analysis of all Top20 showed that synergistic treatment with pNM6-miGBA and FeNPs induced the disaggregation of AML cellular components; pNM6-miGBA was more inclined to respond to oxidative stress ( Figure 17 The RNA-seq results fully demonstrate the effectiveness of miGBA in interfering with GBA mRNA, and also support the fact that the synergistic treatment of pNM6-miGBA with pNM6-miGBA and FeNPs is ferroptosis as the killing mechanism of AML.

[0138] 23.2.2. In vivo anti-AML effect of synergistic administration of rNM6-miGBA and FeNPs Inspired by the synergistic effect of miGBA and FeNPs on AML cell killing, we packaged pNM6-miGBA into adeno-associated virus rNM6-miGBA (serotype 2) for in vivo treatment of AML in mice. The core reason for using adeno-associated virus and FeNPs in synergistic administration is that the safety of both has been extensively validated in clinical practice, which will help advance the clinical application of this treatment. We treated patients by intravenous injection of rNM6-miGBA and FeNPs, with the dose of rNM6-miGBA being 1×10⁻⁶. 11 The FeNPs dosage was 1 mg / kg, which is 5 times lower than the clinical dose, greatly improving in vivo safety. Figure 18 (a) Since miGBA requires 72 hours to achieve a significant inhibitory effect on GBA activity in cell experiments, while FeNPs typically have a half-life of around 12 hours in the blood, there is a significant difference in their onset time. Therefore, to explore the appropriate dosing interval and determine the optimal dosing time for FeNPs, we set up dosing groups with intervals of 0, 1, 2, 3, 5, and 7 days. Day 0 means simultaneous administration of a mixture of rNM6-miGBA and FeNPs. Data showed that both the rNM6-miGBA+FeNPs group and the rNM6-miGBA group were able to restore mouse body weight and significantly prolong mouse survival (…). Figure 18 (b and c in the text). Experimental results showed that the optimal dosing interval between rNM6-miGBA and FeNPs was 2 and 3 days, enabling 60% of mice to survive for more than 150 days. Figure 18 c). Mouse body weight and survival curve data fully demonstrate that the synergistic administration of rNM6-miGBA and FeNPs has significant anti-AML properties and good safety in vivo. Figure 18 (b and c in the original text). Considering the therapeutic effect, we chose to administer rNM6-miGBA and FeNPs 2 days apart for subsequent animal experiments. To further investigate the in vivo therapeutic mechanism of synergistic administration of rNM6-miGBA and FeNPs, we examined the infiltration of leukemia cells in major mouse tissues. The results showed that synergistic administration of rNM6-miGBA and FeNPs significantly reduced the AML cell load in the spleen, liver, and lungs of mice, and the weight of these tissues was close to that of the healthy mouse group. The effect of miGBA was second best, while FeNPs alone had no effect. Figure 18 (d in the text). The H&E staining results further support this finding. Figure 18 (e). In addition, we introduced C1498-GFP stable cells to track AML cell infiltration in mouse bone marrow. The results showed that synergistic administration of rNM6-miGBA and FeNPs significantly reduced the number of AML cells in the bone marrow, with rNM6-miGBA showing the next best effect, while FeNPs alone had no effect. Figure 18 (f and g in the text). These results fully demonstrate the potent therapeutic effect and biocompatibility of synergistic administration of rNM6-miGBA and FeNPs in vivo for AML.

[0139] To investigate the in vivo therapeutic mechanism of AML synergistic administration of rNM6-miGBA and FeNPs, we enriched bone marrow AML cells from each group and detected GBA expression. The results showed that both the rNM6-miGBA+FeNPs group and the rNM6-miGBA group induced significant miGBA expression in AML cells, downregulated GBA mRNA and protein levels, and inhibited GBA enzyme activity. Figure 19 (a) These data strongly support the in vivo interference function of rNM6-miGBA against GBA. Simultaneously, we also examined the expression levels of GlcCer and its metabolites Cere and Glu. The results were similar to those in the cell experiments: GlcCer significantly accumulated in both the rNM6-miGBA+FeNPs group and the rNM6-miGBA group, while Cere and Glu levels significantly decreased. Figure 19 (b) indicates that lysosomes are impaired in their storage. We further investigated lysosomal function, and the results showed that the rNM6-miGBA+FeNPs group had significantly increased lysosomal markers lamp1 and lamp2, significantly inhibited lysenseor fluorescence intensity and proton transport rate, with miGBA showing the next best effect, and FeNPs alone having no effect. Figure 19The c) indicates that AML lysosomes suffer from storage disorders and functional impairment. Furthermore, we also investigated the ferroptosis markers MDA, •OH, and Fe. 2+ The content and GPX4 enzyme activity were measured, and the results showed that the rNM6-miGBA+FeNPs group could significantly increase MDA, •OH and Fe in AML cells in vivo. 2+ The content of [specific ingredient] significantly inhibited GPX4 enzyme activity, with miGBA showing the next best effect, while FeNPs alone were ineffective. Figure 19 (d) This result indicates that the core mechanism of synergistic administration of rNM6-miGBA and FeNPs in vivo anti-AML is ferroptosis. In summary, synergistic administration of rNM6-miGBA and FeNPs significantly enhances the in vivo anti-AML effect of rNM6-miGBA and FeNPs alone, and synergistic administration can induce lysosomal storage impairment and ferroptosis in AML cells in vivo.

[0140] 23.2.3. In vivo safety of synergistic administration of rNM6-miGBA and FeNPs

[0141] The in vivo safety of rNM6-miGBA and FeNPs is a key indicator of concern in anti-AML treatment. Figure 20 (a) We investigated the in vivo safety of rNM6-miGBA, FeNPs, and their synergistic therapy. Body weight data confirmed that these drugs had no effect on mouse body weight. Figure 20 (b) Furthermore, we also examined the viral abundance and iron content in major tissues (heart, liver, spleen, lung, kidney, and bone marrow) after administration of rNM6-miGBA and FeNPs. The results showed that rNM6-miGBA and FeNPs were distributed in all tissues, with the highest accumulation levels observed in the liver and spleen, respectively. Figure 20 (c and d in the text), which is also an important reason why the synergistic treatment of rNM6-miGBA and FeNP can clear leukemia cell infiltration in the liver, spleen, and lungs. H&E staining, blood routine and biochemical indicators further show that neither rNM6-miGBA nor FeNPs, whether used alone or in combination, has toxicity to major tissues, blood, liver and kidney function. Figure 20 e and Figure 21 Finally, we measured the metabolism of rNM6-miGBA and FeNPs in blood and tissues in vivo, and the results showed that the half-life of FeNPs in blood was 8.18 h ( ). Figure 19 In the context of e), rNM6-miGBA is 11.83 h ( Figure 19 In tissues, rNM6-miGBA and FeNPs accumulate to peak levels in the liver at 24 hours (f). Figure 19 e and Figure 19 (f) At 48 h, FeNPs and miGBA accumulated in bone marrow at approximately 15% and 18%, respectively. In conclusion, both rNM6-miGBA, FeNPs, and their combined administration demonstrated good in vivo safety.

[0142] In summary, this invention has developed a composition of a gene interference vector, recombinant adeno-associated virus, and intravenous iron supplement for the treatment of acute myeloid leukemia (AML). This composition exhibits strong AML killing power and in vivo safety, and has clinical translational potential.

Claims

1. A recombinant adeno-associated virus, characterized in that, The recombinant adeno-associated virus is obtained by transfecting cells with the gene interference vector, packaging plasmid, and helper plasmid. The gene interference vector includes a vector backbone, in which an AML-specific promoter NM gene fragment and a miGBA gene fragment are sequentially included. The AML-specific promoter NM gene fragment contains multiple NF-κB motif gene fragments, spacer gene fragments, and a minimal promoter gene fragment. The miGBA gene fragment sequentially contains a 20-60 bp fragment from the 5' end of miR30, shGBA, and a 20-60 bp fragment from the 3' end of miR30. The shGBA is a gene fragment of shRNA based on the miR30 structure and capable of targeting GBA mRNA. The sequence of the shGBA is shown in SEQ ID NO. 8 to SEQ ID NO.

13.

2. The recombinant adeno-associated virus according to claim 1, characterized in that, The vector backbone includes a pDMP-miR vector or a pAAV-MCS. Preferably, the plurality of NF-κB Motif gene fragments contain 1 to 10 NF-κB Motif DNA fragments, the sequence of which is 5'-GGACTTTCC-3', and the Motif is highly compatible with NF-κB.

3. The recombinant adeno-associated virus according to claim 1, characterized in that, The spacer fragment is 10-20 bp located between NF-κB M Otif DNA fragments. Preferably, the sequence of the spacer fragment is 5'-GGGAATTTCCGG-3'.

4. The recombinant adeno-associated virus according to claim 1, characterized in that, The minimum promoter sequence is 5'-TAGAGGGTATATAATGGAAGCTCGACTTCCA-3'.

5. The recombinant adeno-associated virus according to claim 1, characterized in that, The recombinant adeno-associated virus includes any one of the various serotypes of adeno-associated virus AAV1 to AAV12.

6. The method for constructing recombinant adeno-associated virus according to any one of claims 1 to 5, characterized in that, The method includes transfecting cells with the gene interference vector, packaging plasmid, and helper plasmid. Preferably, the packaging plasmid is pAAV-RC, the helper plasmid is pHelper, and preferably, the cells are HEK-293T cells.

7. A composition, characterized in that, It contains the recombinant adeno-associated virus as described in any one of claims 1 to 5, and also includes an intravenous iron supplement.

8. The composition according to claim 7, characterized in that, The intravenous iron supplement is iron oxide nanoparticles, and preferably, the iron oxide nanoparticles are iron carboxylic maltose injection.

9. The use of the recombinant adeno-associated virus according to any one of claims 1 to 5, or the composition according to claim 7 or 8, in the preparation of a medicament for treating acute myeloid leukemia.

10. The application according to claim 9, characterized in that, The application uses the recombinant adeno-associated virus alone or in combination with an intravenous iron supplement, the combination including a single-dose mixture administration or administration of the intravenous iron supplement after a virus injection.