Detection reagent for detecting bladder cancer gene methylation, kit and application

Abstract

The invention discloses a detection reagent for detecting bladder cancer gene methylation, a kit and application. The detection reagent for detecting the methylation of the bladder cancer gene comprises a methylation sensitive restriction enzyme combination, a first primer pair and a first probe which are used for detecting the methylation of the VIM gene, and a second primer pair and a second probe which are used for detecting the methylation of the TMEFF2 gene. The kit comprises the detection reagent for detecting bladder cancer gene methylation. According to the kit provided by the invention, nucleic acid in a sample can be prevented from being damaged, so that the detection rate of the low-frequency methylated sample is improved.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology medicine, and particularly relates to a detection reagent, a kit and application for detecting bladder cancer gene methylation. BACKGROUND

[0002] Bladder cancer is one of the most common malignant tumors in the urinary system, and early diagnosis and postoperative monitoring are crucial to improve the survival rate of patients. Urine, as a non-invasive and easily available sample, is an ideal source for the diagnosis of bladder cancer. Gene methylation is an early and stable event in tumorigenesis, and the methylation of the VIM gene has been confirmed to be highly related to bladder cancer.

[0003] However, the current methylation detection technology based on urine DNA has the following outstanding technical bottlenecks: 1. Inherent defects of bisulfite treatment: almost all existing technologies rely on bisulfite treatment of genomic DNA to convert unmethylated cytosine to uracil, while methylated cytosine remains unchanged. This process has serious drawbacks. First, DNA damage is severe, because the treatment process (high temperature, strong acid) causes DNA strand breakage, and the DNA recovery rate is extremely low (usually <50%), especially for exfoliated cell DNA in urine, which seriously affects the detection sensitivity. Second, the experimental process is complicated and time-consuming, with as many as ten steps, requiring 8-12 hours, which cannot meet the needs of rapid clinical diagnosis. Finally, incomplete conversion and overconversion can lead to false positive and false negative results, affecting the detection specificity. 2. Low degree of integration: most existing solutions divide DNA extraction, bisulfite conversion and PCR amplification into multiple independent steps, which is complex to operate, easy to cause sample cross contamination, and requires high technical requirements for operators. Therefore, there is an urgent need in the art for a urine gene methylation detection scheme that can avoid bisulfite treatment and achieve integrated rapid operation.

[0004] It should be noted that the information disclosed in the above background section is only used to strengthen the understanding of the background of the application, and therefore can include information that does not constitute prior art known to those of ordinary skill in the art. SUMMARY

[0005] In order to solve the above-mentioned problems in the prior art, the application provides a detection reagent, a kit and application for detecting bladder cancer gene methylation. The technical problems to be solved by the application are solved by the following technical solutions: In a first aspect, the application provides a detection reagent for detecting bladder cancer gene methylation, comprising a methylation-sensitive restriction enzyme combination, a first primer pair and a first probe for VIM gene methylation detection, and a second primer pair and a second probe for TMEFF2 gene methylation detection. The nucleotide sequence of the first primer pair is shown as SEQ ID NO: 1 and SEQ ID NO: 2, and the nucleotide sequence of the first probe is shown as SEQ ID NO: 3; the nucleotide sequence of the second primer pair is shown as SEQ ID NO: 4 and SEQ ID NO: 5, and the nucleotide sequence of the second probe is shown as SEQ ID NO: 6; the target detection sample of the detection reagent is urine.

[0006] In an embodiment of the present application, the methylation-sensitive restriction enzyme combination comprises a first enzyme combination or a second enzyme combination. The first enzyme combination comprises AccII, HapII and NaeI. The second enzyme combination comprises AccII and HapII.

[0007] In an embodiment of the present application, the first enzyme combination comprises AccII:HapII:NaeI in a volume ratio of 1:3:2, wherein the concentrations of the AccII, the HapII and the NaeI are the same; and the second enzyme combination comprises AccII:HapII in a volume ratio of 3:2, wherein the concentrations of the AccII and the HapII are the same. For example, in the first enzyme combination, the concentrations of the three enzymes AccII, HapII and NaeI are all 5U / μL; and in the second enzyme combination, the concentrations of the two enzymes AccII and HapII are both 5U / μL.

[0008] In an embodiment of the present application, the first probe and the second probe are labeled with different fluorescent signals.

[0009] In a second aspect, the present application provides a use of the detection reagent for detecting bladder cancer gene methylation in the preparation of a product for detecting bladder cancer gene methylation.

[0010] In a third aspect, the present application provides a kit for detecting bladder cancer gene methylation, comprising the detection reagent for detecting bladder cancer gene methylation.

[0011] In an embodiment of the present application, the kit further comprises a pair of internal reference primers, an internal reference probe, a DNA polymerase, a PCR buffer and dNTP.

[0012] In an embodiment of the present application, the methylation-sensitive restriction enzyme combination is mixed with the DNA polymerase to obtain an enzyme mixture solution, and the enzyme mixture solution is placed in a separate container.

[0013] In a fourth aspect, the present application provides a use of the kit for detecting bladder cancer gene methylation, comprising: S1, extracting DNA in urine to obtain a DNA sample; S2, mixing the enzyme mixed solution, the PCR premix reaction solution and the DNA sample; The enzyme mixed solution comprises a methylation-sensitive restriction enzyme combination and a DNA polymerase; The PCR premix reaction solution comprises a first primer pair, a first probe, an internal reference primer pair, an internal reference probe, a PCR buffer and dNTP, or the PCR premix reaction solution comprises a second primer pair, a second probe, an internal reference primer pair, an internal reference probe, a PCR buffer and dNTP; S3, performing an enzyme cutting reaction at 37 DEG C for 25-35 min, then performing a PCR reaction, collecting a fluorescent detection signal and performing result analysis.

[0014] Compared with the prior art, the application has the following beneficial effects: 1. The application adopts a specific combination of methylation-sensitive restriction enzymes to perform enzyme cutting, and then detects gene methylation through PCR, so that compared with the method of treating with sulfite in the prior art, the DNA of the sample is less damaged, and the detection sensitivity can be improved.

[0015] 2. The method provided in the application has a high detection rate for low-frequency methylation samples, because when the nucleic acid concentration is 0.20 ng / µL, the VIM gene and the TMEFF2 gene have a methylation rate greater than 1.00%, and the detection rate of methylation is 100%.

[0016] 3. The method provided in the application has a short detection time, and the whole process can be completed within 3 hours, so that the detection efficiency is greatly improved compared with the prior art.

[0017] The application will be further described in detail below with reference to the accompanying drawings and embodiments. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 is an application flowchart of a kit for detecting bladder cancer gene methylation provided by an embodiment of the application. DETAILED DESCRIPTION

[0019] In order to further illustrate the technical means and effects adopted by the application to achieve the predetermined purposes, the detection reagent, kit and application for detecting bladder cancer gene methylation according to the application are described in detail below with reference to the accompanying drawings and specific embodiments.

[0020] The foregoing and other technical contents, features and effects of the present application can be clearly presented in the following detailed description of the embodiments with reference to the accompanying drawings. Through the description of the embodiments, the technical means and effects adopted by the present application to achieve the predetermined purposes can be understood more deeply and specifically. However, the accompanying drawings are provided for reference and illustration only, and are not intended to limit the technical solutions of the present application.

[0021] It should be noted that in this paper, the terms "first" and "second" are used only for descriptive purposes, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined with "first" and "second" can explicitly or implicitly include one or more of the features. Moreover, the terms "include", "contain" or any other variant are intended to cover non-exclusive inclusion, so that the article or device including a series of elements not only includes those elements, but also includes other elements not explicitly listed.

[0022] Example 1 The kit provided by the present application was used to detect 6 positive urine samples and 2 negative urine samples.

[0023] Sample collection: collect the middle section of morning urine, transfer 15-50 mL to a conical bottom centrifuge tube, centrifuge at 3000xg for 10 min (g is the standard gravity acceleration), discard the supernatant, and reserve the urine sediment for use.

[0024] Reagent preparation includes (the reagents used in the extraction process of the exfoliated cell DNA in the urine sample and the reagents are from the urine genomic DNA extraction kit (magnetic bead method), Haimei Biological Technology Co., Ltd., item number NT0322-1): PNS liquid preparation: take PN agent, add 5 mL of EL liquid (Elution Buffer, elution buffer), and fully oscillate or blow to dissolve. After preparation, mark as PNS liquid, which can be used immediately or divided into 1 mL / tube, and stored at 2-8℃.

[0025] BDS liquid preparation: take 75 mL of BD liquid, add 50 mL of isopropanol with a volume concentration of 100%, mix thoroughly, and mark as BDS liquid for standby.

[0026] WBS1 liquid preparation: take 9.5 mL of the first washing buffer (WB1 liquid), add 12.5 mL of 96-100% ethanol, mix thoroughly. Mark as WBS1 liquid, and store at 15-20℃.

[0027] WBS2 liquid preparation: take 6.5 mL of the second washing buffer (WB2 liquid), add 15 mL of 96-100% ethanol, mix thoroughly. Mark as WBS2 liquid, and store at 15-20℃.

[0028] (1) The extraction process of the exfoliated cell DNA in the urine sample includes the following steps: A1, add 200 μL PNS solution to the centrifuge tube containing urine sediment, and mix well using a vortex oscillator for 1 minute.

[0029] A2, add 2 mL LS1 solution, tightly cover the tube, and mix well using a vortex oscillator for 30 seconds.

[0030] A3, add 500 μL LS2 solution, tightly cover the tube, and mix well using a vortex oscillator for 1 minute.

[0031] A4, incubate the mixture in a 58℃ (±1℃) water bath or metal bath for 30 minutes.

[0032] A5, add 5 mL BDS solution to the lysate after incubation, tightly cover the tube, and mix well using a vortex oscillator for 15-30 seconds.

[0033] A6, stand at room temperature for 5 minutes.

[0034] A7, magnetic bead adsorption: add 30 μL MB solution (magnetic bead suspension), mix for 3 minutes. Place the centrifuge tube on the magnetic separator and stand for 1 minute to allow the magnetic beads to adsorb to the tube wall. Carefully aspirate the supernatant.

[0035] A8, first washing: add 800 μL WBS1 solution to the tube, mix by blowing or vortexing, then transfer all the liquid to a 1.5 mL centrifuge tube. Place the 1.5 mL centrifuge tube on the magnetic separator and stand for 1 minute, then carefully aspirate the supernatant.

[0036] A9, second washing: add 800 μL WBS2 solution to the 1.5 mL centrifuge tube containing the magnetic beads, mix by vortexing at room temperature for 30 seconds. Place the centrifuge tube on the magnetic separator and stand for 1 minute, then carefully aspirate the supernatant.

[0037] A10, third washing (ethanol washing): add 900 μL anhydrous ethanol to the tube, mix by vortexing at room temperature for 30 seconds. Place the centrifuge tube on the magnetic separator and stand for 1 minute, then carefully aspirate all the supernatant.

[0038] A11, drying: open the centrifuge tube cover, incubate on a 56℃ (±1℃) heating block for 3 minutes to evaporate the residual ethanol.

[0039] A12, elution: add 50-100 μL pre-equilibrated to room temperature (15-25℃) elution buffer (EL solution) to the dried magnetic beads. Tightly cover the lid, vortex for 30 seconds, and incubate at room temperature for 3 minutes to allow the DNA to fully dissolve in the elution buffer (EL solution).

[0040] A13, Collect DNA: Place the centrifuge tube on a magnetic separator and let stand for 1 minute. Carefully pipette the supernatant and transfer the supernatant to a new sterile centrifuge tube, which is the DNA solution of the extracted urine sample. If used within 24 hours, it can be stored at 2-8°C; long-term storage should be placed at -15 to -30°C.

[0041] (2) Detection of VIM gene methylation in 8 samples Melt the PCR premix reaction solution and enzyme mixed solution (RE enzyme solution) at room temperature, and centrifuge the RE enzyme solution before use to collect the liquid on the wall.

[0042] Take n x 9.65 μL of PCR premix reaction solution and n x 0.35 μL of RE enzyme solution, and mix to obtain a pre-mixed solution. Wherein, n is the number of samples to be tested, in this embodiment, there are 8 samples, each sample is set up a duplicate well, and it also includes a positive control sample (PC) and a negative control sample (NC), so in this embodiment n is equal to 18. In order to have redundancy, n is usually greater than 18 in actual preparation. The positive control sample uses a known nucleic acid concentration of VIM gene methylation + β-actin unmethylated DNA solution, that is, sequence sample 1 in Example 2, and the corresponding nucleotide sequence is shown as SEQ ID NO: 10. The negative control sample uses a known β-actin unmethylated DNA solution, and the corresponding nucleotide sequence is ATGGAGGAGGCTCAGCAAGTCTTCTGGACTGTGAACCTGTGTCTGCCACTGTGTGCTGGGTGGTGGTCATCTTTCCCACCAGGCTGTGGCCTCTGCAACCTTCAAG (SEQ ID NO: 12).

[0043] Wherein, the components of the VIM gene methylation detection PCR premix reaction solution are shown in Table 1.

[0044] Table 1. Components of the PCR premix reaction solution for VIM gene methylation detection

[0045] Wherein, VIM-F is the forward primer of VIM gene (SEQ ID NO: 1), VIM-R is the reverse primer of VIM gene (SEQ ID NO: 2), and VIM-P is the probe of VIM gene (SEQ ID NO: 3); IC-F is the forward primer of the internal reference gene (β-actin) (SEQ ID NO: 7), IC-R is the reverse primer of the internal reference gene (β-actin) (SEQ ID NO: 8), and IC-P is the probe of the internal reference gene (β-actin) (SEQ ID NO: 9).

[0046] The nucleotide sequence of SEQ ID NO: 1 is CGGCGGGACAGCAGG; The nucleotide sequence of SEQ ID NO: 2 is CCGCCGGTGACTAAG; The nucleotide sequence of SEQ ID NO: 3 is GAGAGGGGTGGG; The nucleotide sequence of SEQ ID NO: 7 is ATGGAGGAGGCTCAGCAAGTC; The nucleotide sequence of SEQ ID NO: 8 is TGCTGGGTGGTGGTCATCTTT; The nucleotide sequence of SEQ ID NO: 9 is CTTGAAGGTTGCAGAGGCCA.

[0047] According to the pre-mixed solution 10 μL and the dosage of each sample 15 μL, mix and add to 20 PCR reaction tubes or 20 reaction wells of a PCR reaction plate, and carry out the reaction according to the reaction program in Table 2.

[0048] Table 2. Reaction program

[0049] In step 1 of Table 2, the methylation-sensitive restriction enzyme combination (AccII: HapII is 3:2 in this example, and the concentration of AccII and HapII is 5 U / μL) is used to cut the specific site of non-methylation.

[0050] In step 2 of Table 2, 95℃, keep for 5 minutes, to inactivate the methylation-sensitive restriction enzyme combination and pre-denature the DNA.

[0051] In step 3 of Table 2, 40 cycles are carried out, each cycle including: 95℃ denaturation for 20 seconds, 60℃ annealing for 30 seconds, and 72℃ extension for 20 seconds. The fluorescence signal is collected at each cycle to 60℃ annealing, and the fluorescence signal collection channel is set to the detection channel (FAM channel) and the internal reference channel (VIC channel). The cycle threshold (Ct) results of each sample are shown in Table 3.

[0052] Table 3. Summary of VIM and TMEFF2 gene methylation detection results by two methods

[0053] (3) TMEFF2 gene methylation detection in 8 samples The difference from the VIM gene methylation detection is the composition of the PCR premix reaction solution. The composition of the PCR premix reaction solution for TMEFF2 gene methylation detection is shown in Table 4.

[0054] Table 4. Components of PCR premix reaction solution for TMEFF2 gene methylation detection

[0055] Wherein, TMEFF2-F is the forward primer of TMEFF2 gene (SEQ ID NO: 4), TMEFF2-R is the reverse primer of TMEFF2 gene (SEQ ID NO: 5), and TMEFF2-P is the probe of TMEFF2 gene (SEQ ID NO: 6).

[0056] The nucleotide sequence of SEQ ID NO: 4 is TTCCCAGAACTCCCTCCTTATG; The nucleotide sequence of SEQ ID NO: 5 is CATGATCTCGAGAGTTTCAGCAA; The nucleotide sequence of SEQ ID NO: 6 is CTTCCCGCGTCTCCGGCG.

[0057] The detection results of TMEFF2 gene methylation of 8 samples are shown in Table 3.

[0058] Comparative Example 1 The VIM gene and TMEFF2 gene methylation of the 8 samples in Example 1 were detected by using the existing bisulfite treatment method.

[0059] The aliquot of the DNA solution of the urine sample extracted in Example 1 was subjected to bisulfite treatment (using a nucleic acid extraction kit based on biological nanomagnetic beads, Haimei Biotechnology Co., Ltd., product number NT0322-1). The following steps were included: B1, prepare a bisulfite mixture in a PCR octuple tube, and add the following components in order: 40.00 μL of DNA solution of each sample, 15.00 μL of DNA protective agent, 85.00 μL of bisulfite solution, and the total volume is 140.00 μL.

[0060] B2, cover the tube cap, mix the mixture thoroughly by vortexing or gently blowing, and place it at room temperature (15-25°C) for 5 minutes to ensure uniformity of the reaction system.

[0061] B3, place the PCR tube in a thermal cycler, and run the following bisulfite conversion program: First step: denaturation at 95°C for 5 minutes to dissociate the DNA double strands.

[0062] Second step: incubation at 60°C for 25 minutes to promote the reaction of bisulfite with DNA.

[0063] Step 3: Denature at 95°C for 5 minutes, dissociate DNA again to enhance transformation efficiency.

[0064] Step 4: Incubate at 60°C for 85 minutes, extend reaction time to ensure complete conversion of unmethylated cytosine.

[0065] Step 5: Denature at 95°C for 5 minutes, further optimize DNA structure.

[0066] Step 6: Incubate at 60°C for 175 minutes, complete final conversion reaction.

[0067] B4, After the transformation is complete, briefly centrifuge the reaction system (for example, centrifuge at 10,000 rpm for 10 seconds) to accumulate the liquid at the bottom of the tube. Transfer all the liquid to a clean 1.5 mL centrifuge tube.

[0068] B5, Add 310 μL of freshly prepared BD solution and 30 μL of MB solution, vortex to mix for 10 seconds, and collect droplets by instantaneous centrifugation (5 seconds).

[0069] B6, Add 250 μL of ethanol (96-100%), mix by inverting the tube 5 times for 5 minutes to ensure that the DNA is fully bound to the magnetic beads, and centrifuge for 5 seconds.

[0070] B7, Place the centrifuge tube in a magnetic stand and let it stand for 2 minutes to allow the magnetic beads to be adsorbed to the tube wall, and discard the supernatant.

[0071] B8, Add 500 μL of WS1 solution, vortex to mix for 10 seconds, and centrifuge for 5 seconds, and discard the supernatant after the magnetic beads are separated for 2 minutes.

[0072] B9, Add 500 μL of WS2 solution, vortex to mix, and let it stand at room temperature for 15 minutes (during which time, gently invert the tube 3-5 times to evenly distribute the magnetic beads), centrifuge for 5 seconds, and discard the supernatant after the magnetic beads are separated for 2 minutes.

[0073] B10, Repeat step (step B8) twice, for a total of three WS1 solution washes.

[0074] B11, Add 250 μL of ethanol (96-100%), vortex to mix, and centrifuge for 5 seconds, and discard the supernatant after the magnetic beads are separated for 2 minutes.

[0075] B12, Centrifuge for 5 seconds, and carefully pipette the remaining droplets (avoid touching the magnetic beads) with a micropipette.

[0076] B13, Open the cap, and air dry at room temperature for 10 minutes until no visible liquid remains on the surface of the magnetic beads (avoid over-drying, which can affect DNA elution efficiency).

[0077] B14, add 50 μL EL solution, vortex mixing for 10 seconds, centrifuge for 5 seconds, magnetic bead separation for 2 minutes, and the supernatant is the purified DNA, which is stored at -20°C for standby.

[0078] The purified DNA of each sample is used for VIM gene and TMEFF2 gene methylation detection, and the difference from Example 1 is that the pre-prepared mixed solution includes n x 9.65 μL of PCR premixed reaction solution and n x 0.35 μL of DNA polymerase solution. Only the PCR reaction program is used, as shown in Table 5.

[0079] Table 5. PCR reaction program

[0080] In step 1, 95°C, keep for 5 minutes, to pre-denature the DNA.

[0081] In step 2, 40 cycles are performed, each cycle including: 95°C denaturation for 20 seconds, 60°C annealing for 30 seconds, and 72°C extension for 20 seconds. The fluorescence signal is collected at each cycle to 60°C annealing, and the fluorescence signal collection channel is set to the detection channel (FAM channel) and the internal reference channel (VIC channel); the results are shown in Table 3.

[0082] Referring to the data in Table 3, for the VIM gene, using the same sample, the average Ct value of the FAM channel of 6 positive samples detected by the kit provided by the present application is = 30.62, and the average Ct value of the FAM channel of 6 positive samples detected after being treated by bisulfite is = 31.82. For the TMEFF2 gene, using the same sample, the average Ct value of the FAM channel of 6 positive samples detected by the kit provided by the present application is = 30.62, and the average Ct value of the FAM channel of 6 positive samples detected after being treated by bisulfite is = 31.82. Compared with the bisulfite method, the cycle threshold of the sample is lower using the method provided by the present application, that is, the fluorescence signal appears earlier, indicating that the method provided by the present application can reduce the damage to the DNA during sample processing, increase the number of effective templates in PCR, and at the same time, the method provided by the present application is simple to operate, the steps are simplified, and the workload of the experimental operator is also reduced.

[0083] Referring to the data in Table 3, for the VIM gene, using the same sample, the average Ct value of the FAM channel of 6 positive samples detected by the kit provided by the present application is = 29.31, which is less than the average Ct value of the VIC channel of 8 samples detected after being treated by bisulfite = 30.68. For the TMEFF2 gene, using the same samples, the average Ct value of the VIC channel for 8 samples detected by the kit provided by the present application was = 29.38, which was less than the average Ct value of the VIC channel for 8 samples detected after being treated by sulfite = 30.46. It is further illustrated that the method provided by the present application can reduce the influence of sulfite treatment on DNA in the sample.

[0084] Example 2 This example uses four artificially synthesized sequence samples. Sequence sample 1 is a VIM methylation + β-actin non-methylation sequence, sequence sample 2 is a TMEFF2 methylation + β-actin non-methylation sequence, sequence sample 3 is a VIM non-methylation + β-actin non-methylation sequence, and sequence sample 4 is a TMEFF2 non-methylation + β-actin non-methylation sequence.

[0085] The nucleotide sequence of sequence sample 1 (SEQ ID NO: 10) is CGGCGGGACAGCAGGGCGCGGTGAGTCAC C GC C GGTGACTAAGCGACCCCACCCCTCTCCCTCGGGCCGAAGGGGTGGTGATGGAGGAGGCTCAGCAAGTCTTCTGGACTGTGAACCTGTGTCTGCCACTGTGTGCTGGGTGGTGGTCATCTTTCCCACCAGGCTGTGGCCTCTGCAACCTTCAAGGGAGG; wherein the cytosine nucleotides corresponding to the 30th and 33rd bases in the sequence of SEQ ID NO: 10 are methylated.

[0086] The nucleotide sequence of sequence sample 2 (SEQ ID NO: 11) is CGGCTTCCCAGAACTCCCTCCTTATGGCAGCAGCTTCC C GCGTCTC CGGCGCAGCTTCTCAGCGGACGACCCTCTCGCTCCAGGGCTGAGCCCAGTCCCTGGATGTTGCTGAAACTCTCGAGATCATGCGCGGGTTTGTGGTGATGGAGGAGGCTCAGCAAGTCTTCTGGACTGTGAACCTGTGTCTGCCACTGTGTGCTGGGTGGTGGTCATCTTTCCCACCAGGCTGTGGCCTCTGCAACCTTCAAGGGAGGAGC; wherein the cytosine nucleotides at positions 39 and 47 of the sequence of SEQ ID NO: 11 are methylated.

[0087] The nucleotide sequence of the sequence sample 3 is SEQ ID NO: 10, wherein the cytosine nucleotides at positions 30 and 33 are not methylated; the nucleotide sequence of the sequence sample 4 is SEQ ID NO: 11, wherein the cytosine nucleotides at positions 39 and 47 are not methylated.

[0088] The four synthetic sequences were quantified by qubit 4.0 to detect the nucleic acid concentration of each sequence sample. The nucleic acid concentration of the sequence sample 1 was 2.53 ng / µL, the nucleic acid concentration of the sequence sample 2 was 2.26 ng / µL, the nucleic acid concentration of the sequence sample 3 was 2.05 ng / µL, and the nucleic acid concentration of the sequence sample 4 was 2.43 ng / µL.

[0089] Each sequence sample was prepared to the same nucleic acid concentration (0.2 ng / µL). Thus, the sequence sample 1 solution and the sequence sample 3 solution were mixed to prepare the nucleic acid samples to be tested with VIM methylation rates of 10%, 5%, 3%, 1% and 0.5%, respectively, and each nucleic acid sample to be tested corresponding to a VIM methylation rate was repeated 20 times. For example, to prepare a nucleic acid sample with a VIM methylation rate of 10%, the sequence sample 1 solution was mixed with the sequence sample 3 solution in a volume ratio of 10:90. Similarly, the sequence sample 2 solution and the sequence sample 4 solution were mixed to prepare the nucleic acid samples to be tested with TMEFF2 methylation rates of 10%, 5%, 3%, 1% and 0.5%, respectively, and each nucleic acid sample to be tested corresponding to a TMEFF2 methylation rate was repeated 20 times.

[0090] The VIM methylation + β-actin non-methylation sequence and the TMEFF2 methylation + β-actin non-methylation sequence are mixed in equal proportions (same volume) as a positive control (PC), and the VIM non-methylation + β-actin non-methylation sequence and the TMEFF2 non-methylation + β-actin non-methylation sequence are mixed in equal proportions (same volume) as a negative control (NC).

[0091] The components of the PCR premix reaction solution for VIM gene methylation detection in Example 1 (as shown in Table 1) and the components of the PCR premix reaction solution for TMEFF2 gene methylation detection (as shown in Table 4), and the methylation-sensitive restriction endonuclease combination (AccII: HapII is 3:2 in this example, and the concentrations of AccII and HapII are both 5 U / µL) are used to perform detection by using the same reaction procedure (as shown in Table 2) in Example 1, and the results are shown in Table 6.

[0092] Table 6. Detection results of VIM gene and TMEFF2 gene under different methylation rates

[0093] In this example, the methylation gene and the non-methylation gene are artificially synthesized, and the concentration is quantified to detect the detection rate of VIM gene and TMEFF2 gene methylation under different methylation rates. Referring to the detection results in Table 6, when the nucleic acid concentration is 0.20 ng / µL, the methylation detection rate of the VIM gene and the TMEFF2 gene provided by the present application is 100% when the methylation rate is higher than 1.00%. The methylation detection rate of the VIM gene is 85% when the methylation rate is 0.5%, and the methylation detection rate of the TMEFF2 gene is 80% when the methylation rate is 0.5%. It shows that the restriction endonuclease combination, specific primers and probes provided by the present application have a high detection rate for low-frequency methylation samples.

[0094] The above is a further detailed description of the present application in combination with specific preferred embodiments, and the specific implementation of the present application cannot be limited to these descriptions. For ordinary skilled persons in the technical field to which the present application belongs, without departing from the concept of the present application, a number of simple deductions or substitutions can be made, and all of them should be regarded as falling within the protection scope of the present application.

Claims

1. A detection reagent for detecting methylation of bladder cancer genes, characterized in that, It includes a methylation-sensitive restriction endonuclease combination, a first primer pair and a first probe for detecting VIM gene methylation, and a second primer pair and a second probe for detecting TMEFF2 gene methylation; The nucleotide sequences of the first primer pair are shown in SEQ ID NO: 1 and SEQ ID NO: 2, and the nucleotide sequence of the first probe is shown in SEQ ID NO: 3; the nucleotide sequences of the second primer pair are shown in SEQ ID NO: 4 and SEQ ID NO: 5, and the nucleotide sequence of the second probe is shown in SEQ ID NO:

6. The target sample for the test reagent is urine.

2. The detection reagent for detecting bladder cancer gene methylation according to claim 1, characterized in that, The methylation-sensitive restriction endonuclease combination includes a first enzyme combination or a second enzyme combination; The first enzyme combination includes AccII, HapII, and NaeI; The second enzyme combination includes AccII and HapII.

3. The detection reagent for detecting bladder cancer gene methylation according to claim 2, characterized in that, The first enzyme combination comprises AccII:HapII:NaeI in a volume ratio of 1:3:2, wherein the concentrations of AccII, HapII, and NaeI are the same; the second enzyme combination comprises AccII:HapII in a volume ratio of 3:2, wherein the concentrations of AccII and HapII are the same.

4. The detection reagent for detecting bladder cancer gene methylation according to claim 1, characterized in that, The first probe and the second probe are labeled with different fluorescent signals.

5. The use of the detection reagent according to any one of claims 1-4 in the preparation of a product for detecting bladder cancer gene methylation.

6. A kit for detecting bladder cancer gene methylation, characterized in that, The detection reagent for detecting bladder cancer gene methylation is included according to any one of claims 1-4.

7. The kit for detecting bladder cancer gene methylation according to claim 6, characterized in that, It also includes internal reference primer pairs, internal reference probes, DNA polymerase, PCR buffer, and dNTPs.

8. The kit for detecting bladder cancer gene methylation according to claim 7, characterized in that, The methylation-sensitive restriction endonuclease combination is mixed with the DNA polymerase to obtain an enzyme mixture solution, which is placed in a separate container.

9. The application of the kit for detecting bladder cancer gene methylation according to claim 8, characterized in that, include: S1. Extract DNA from urine to obtain a DNA sample; S2. Mix the enzyme mixture, PCR premixed reaction solution, and DNA sample. The enzyme mixture includes a combination of methylation-sensitive restriction endonucleases and DNA polymerase; The PCR premixed reaction solution includes a first primer pair, a first probe, an internal reference primer pair, an internal reference probe, a PCR buffer, and dNTPs; or the PCR premixed reaction solution includes a second primer pair, a second probe, an internal reference primer pair, an internal reference probe, a PCR buffer, and dNTPs. S3. Perform enzyme digestion reaction at 37℃ for 25-35 minutes, then perform PCR reaction, collect fluorescence detection signal and analyze the results.

Images