Application of Hsacirc0002688 as prognostic marker and therapeutic target of triple negative breast cancer
By detecting the expression level of Hsa_circ_0002688 and inhibiting its expression using siRNAs, the prognostic assessment and treatment challenges of triple-negative breast cancer were solved, and effective inhibition of breast cancer cell migration and invasion was achieved, providing new therapeutic targets and drug strategies.
Patent Information
- Application Number
- CN202610127784.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-29
- Publication Date
- 2026-04-10
AI Technical Summary
Current technologies lack effective treatment strategies to address the invasiveness and high mortality of triple-negative breast cancer. The expression level of Hsa_circ_0002688 is closely related to breast cancer metastasis, but there is a lack of corresponding prognostic markers and therapeutic targets.
Hsa_circ_0002688 was used as a prognostic biomarker for triple-negative breast cancer. Its expression level was used to assess patient prognosis. Targeted siRNAs were used to silence or inhibit its expression to suppress the migration and invasion of breast cancer cells, reduce the nuclear accumulation of USP10 and the binding affinity of SRSF6.
Hsa_circ_0002688 can serve as an independent prognostic factor, assessing patient survival through expression levels. Furthermore, silencing or inhibiting its expression can significantly suppress the migration and invasion of breast cancer cells, providing a novel therapeutic target and drug strategy.
Smart Images
Figure CN121826153A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, specifically to the application of Hsa_circ_0002688 as a prognostic biomarker and therapeutic target for triple-negative breast cancer. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] Breast cancer is a malignant tumor that occurs in the glandular epithelium of the breast and is one of the most common malignant tumors in women. Breast cancer mainly includes Luminal A, Luminal B, HER2-overexpressing breast cancer, and triple-negative breast cancer (TNBC). The purpose of breast cancer classification is to determine the optimal treatment plan for patients based on known associations between the molecular biology of the underlying tumor and treatment sensitivity. Triple-negative breast cancer accounts for approximately 15% of all breast cancers and is characterized by high invasiveness, high mortality, and poor prognosis. It is also showing a trend towards younger age of onset and is a highly heterogeneous cancer. Its molecular characteristics include negative expression of estrogen receptor (ER), progesterone receptor (PR), and HER2. There is currently a lack of standardized treatment options for triple-negative breast cancer. Therefore, developing new treatment strategies for triple-negative breast cancer has become an urgent clinical need.
[0004] circRNAs are a class of covalently closed circular non-coding RNA molecules lacking a 5' cap and a 3' ploy-(A) tail. They are highly conserved and stable, effectively resisting degradation by exonucleases. Unlike other linear RNAs, the unique closed circular structure of circRNAs makes them intrinsically resistant to RNase R digestion. circRNA expression is stage-specific, tissue- and organ-specific, evolutionarily conserved, structurally stable, and difficult to degrade, possessing potential biomarker functions. Furthermore, circRNAs perform various functions, such as competitively binding to miRNAs to regulate target mRNAs, encoded peptides, and stable protein complexes to modulate downstream biological processes. In recent years, numerous basic research articles have reported the involvement of circRNAs in biological processes, suggesting they may become clinical diagnostic indicators and therapeutic targets for various diseases. Therefore, circular RNAs hold promise as ideal diagnostic biomarkers and therapeutic targets for triple-negative breast cancer. Summary of the Invention
[0005] To overcome the above problems, this invention provides the application of Hsa_circ_0002688 as a prognostic biomarker and therapeutic target for triple-negative breast cancer.
[0006] To achieve the above technical objectives, the present invention adopts the following technical solution:
[0007] In a first aspect, the invention provides the use of Hsa_circ_0002688 as a prognostic biomarker for triple-negative breast cancer in the preparation of products for assessing the prognosis of triple-negative breast cancer; The nucleotide sequence of Hsa_circ_0002688 is shown in SEQ ID NO: 1.
[0008] In one or more embodiments, the product includes a reagent kit.
[0009] In one or more embodiments, Hsa_circ_0002688 is derived from breast cancer cells or tissue.
[0010] A second aspect of the present invention provides the use of a reagent or kit for detecting the expression level of Hsa_circ_0002688 in the preparation of products for assessing the prognosis of triple-negative breast cancer; The nucleotide sequence of Hsa_circ_0002688 is shown in SEQ ID NO: 1.
[0011] In one or more embodiments, the product includes a reagent kit.
[0012] In one or more embodiments, the reagent or kit for detecting the expression level of Hsa_circ_0002688 contains a primer pair for detecting Hsa_circ_0002688, which includes a forward primer (CAGAGAGCACGCTACAACAC) with a nucleotide sequence as shown in SEQ ID NO: 2 and a reverse primer (GAGGAACACAGAACACTCGC) with a nucleotide sequence as shown in SEQ ID NO: 3.
[0013] In one or more embodiments, Hsa_circ_0002688 is derived from breast cancer cells or tissue.
[0014] A third aspect of the present invention provides a product for assessing the prognosis of triple-negative breast cancer, comprising a primer pair for detecting Hsa_circ_0002688.
[0015] In one or more embodiments, the primer pair includes a forward primer (CAGAGAGCACGCTACAACAC) with a nucleotide sequence as shown in SEQ ID NO: 2 and a reverse primer (GAGGAACACAGAACACTCGC) with a nucleotide sequence as shown in SEQ ID NO: 3.
[0016] In one or more embodiments, the detection reagent or kit further includes a quantitative real-time PCR (qRT-PCR) detection reagent.
[0017] In one or more embodiments, the detection reagent or kit further includes: an internal reference primer for homogenization, which is a primer pair with β-actin as the internal reference, and the nucleotide sequences of the upstream and downstream primers are shown in SEQ ID NO: 4 and SEQ ID NO: 5.
[0018] Hsa_circ_0002688 is present in the tissues of patients with triple-negative breast cancer, and its expression level is closely related to the metastatic status of triple-negative breast cancer. Based on the median Hsa_circ_0002688 expression level, triple-negative breast cancer patients were randomly divided into high-expression and low-expression groups. Univariate and multivariate Cox regression analyses further confirmed that Hsa_circ_0002688 is an independent prognostic factor affecting overall survival (OS) and disease-free survival (DFS) in patients with triple-negative breast cancer.
[0019] A fourth aspect of the invention provides the use of a substance that silences or inhibits the expression of Hsa_circ_0002688 in the preparation of a medicament for treating triple-negative breast cancer.
[0020] In one or more embodiments, the substance that silences or inhibits Hsa_circ_0002688 expression includes siRNAs that target Hsa_circ_0002688, the siRNAs comprising a sense strand of nucleotide sequence as shown in SEQ ID NO: 6 and an antisense strand as shown in SEQ ID NO: 7.
[0021] In one or more embodiments, the application of the drug includes at least one of the following: (1) It inhibited the migration and invasion of triple-negative breast cancer cells; (2) Reduce the nuclear accumulation of ubiquitin-specific protease 10 (USP10); (3) It reduced the binding affinity of arginine / serine-rich splicing factor 6 (SRSF6) and ubiquitin-specific protease 10 (USP10).
[0022] In a fifth aspect, the present invention provides a medicament for treating triple-negative breast cancer, comprising a substance that silences or inhibits the expression of Hsa_circ_0002688.
[0023] In one or more embodiments, the substance that silences or inhibits Hsa_circ_0002688 expression includes siRNAs that target Hsa_circ_0002688, the siRNAs comprising a sense strand of nucleotide sequence as shown in SEQ ID NO: 6 and an antisense strand as shown in SEQ ID NO: 7.
[0024] In one or more embodiments, the drug further includes pharmaceutically acceptable carriers, excipients, and diluents.
[0025] The non-pharmaceutical active ingredients that may be included, such as carriers, excipients, and diluents, are well known in the art, and those skilled in the art can determine that they meet clinical standards.
[0026] Preferably, the carrier, excipients, and diluents include, but are not limited to, lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylparaben, propylparaben, talc, magnesium stearate, and mineral oil.
[0027] Preferably, the dosage form of the drug is a suspension, emulsion, granules, spray, injection, transdermal absorbent, a dosage form suitable for transfection, tablet, powder, granules or capsule.
[0028] A sixth aspect of the present invention provides a pharmaceutical composition comprising the medicament for treating triple-negative breast cancer as described in the fifth aspect.
[0029] Transwell and scratch assays showed that silencing or inhibiting Hsa_circ_0002688 expression significantly suppressed the migration and invasion of triple-negative breast cancer cells. 3D tumor sphere invasion assays further demonstrated that silencing or inhibiting Hsa_circ_0002688 expression significantly weakened the migration and invasion of triple-negative breast cancer cells. Furthermore, silencing or inhibiting Hsa_circ_0002688 expression reduced the nuclear accumulation of ubiquitin-specific protease 10 (USP10) and decreased the binding affinity of arginine / serine-rich splicing factor 6 (SRSF6) and ubiquitin-specific protease 10 (USP10). Overexpression of Hsa_circ_0002688, however, enhanced the migration and invasion of triple-negative breast cancer cells; therefore, Hsa_circ_0002688 could serve as a therapeutic target for triple-negative breast cancer.
[0030] The beneficial effects of this invention are as follows: This invention relates to the field of biomedical technology, specifically to the application of Hsa_circ_0002688 as a prognostic biomarker and therapeutic target for triple-negative breast cancer.
[0031] Hsa_circ_0002688 is present in the tissues of patients with triple-negative breast cancer, and its expression level is closely related to the metastatic status of triple-negative breast cancer. Based on the median Hsa_circ_0002688 expression level, triple-negative breast cancer patients were randomly divided into high-expression and low-expression groups. Univariate and multivariate Cox regression analyses further confirmed that Hsa_circ_0002688 is an independent prognostic factor affecting overall survival (OS) and disease-free survival (DFS) in patients with triple-negative breast cancer. Therefore, Hsa_circ_0002688 can serve as a prognostic biomarker for triple-negative breast cancer.
[0032] Transwell and scratch assays showed that silencing or inhibiting Hsa_circ_0002688 expression significantly suppressed the migration and invasion of triple-negative breast cancer cells. Furthermore, silencing or inhibiting Hsa_circ_0002688 expression reduced the nuclear accumulation of ubiquitin-specific protease 10 (USP10) and decreased the binding affinity of arginine / serine-rich splicing factor 6 (SRSF6) and USP10. Overexpression of Hsa_circ_0002688, however, enhanced the migration and invasion of triple-negative breast cancer cells; therefore, Hsa_circ_0002688 could serve as a therapeutic target for triple-negative breast cancer. Attached Figure Description
[0033] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0034] Figure 1 To verify the expression of Hsa_circ_0002688 in triple-negative breast cancer tissues using in situ hybridization (ISH) experiments; Figure 2 The expression of Hsa_circ_0002688 is associated with the prognosis of TNBC patients, where A represents overall survival (OS) and B represents disease-free survival (DFS) of TNBC patients. Figure 3To verify through Transwell assays that interference with Hsa_circ_0002688 can inhibit the migration and invasion of TNBC cells, where A represents the Transwell assay verification that interference with Hsa_circ_0002688 can inhibit the migration of TNBC cells, B represents the quantification of A, C represents the Transwell assay verification that interference with Hsa_circ_0002688 can inhibit the invasion of TNBC cells, and D represents the quantification of C; Figure 4 To verify that interfering with Hsa_circ_0002688 can inhibit the migration of TNBC cells in the scratch healing assay, where A is an image of the MDA-MB-231 cell line in the scratch healing assay, B is the quantification of A, C is an image of the MDA-MB-468 cell line in the scratch healing assay, and D is the quantification of C. Figure 5 Interference with Hsa_circ_0002688 can inhibit lung metastasis of tumors. In this study, A represents in vivo fluorescence imaging, B represents images of lung metastatic nodules, and C represents the quantification of B. Figure 6 In Figure A, HE staining confirmed that interfering with Hsa_circ_0002688 can inhibit lung metastasis of tumors. In Figure B, ISH assay was used to detect the expression of Hsa_circ_0002688 in tissues, and IHC assay was used to detect the expression of N-cad and Vimentin in tissues. Figure 7 To verify in Transwell assays that overexpression of Hsa_circ_0002688 promotes the migration and invasion of TNBC cells, where A represents the Transwell assay verification that overexpression of Hsa_circ_0002688 promotes the migration of TNBC cells, B represents the quantification of A, C represents the Transwell assay verification that overexpression of Hsa_circ_0002688 promotes the invasion of TNBC cells, and D represents the quantification of C; Figure 8 To demonstrate that overexpression of Hsa_circ_0002688 promotes lung metastasis, A represents in vivo fluorescence imaging, B represents images of lung metastatic nodules, and C represents the quantification of B. Figure 9 Immunofluorescence experiments showed that interference with Hsa_circ_0002688 weakened the colocalization relationship between SRSF6 and USP10. In this diagram, A represents the immunofluorescence results, and B to E are the quantifications of the immunofluorescence results in the first, second, third, and fourth rows, respectively. Figure 10To verify the effect of interference or enhancement of Hsa_circ_0002688 on the binding of SRSF6 and USP10 in Co-IP experiments, where A is the Co-IP experiment verifying that interference weakens the binding of SRSF6 and USP10, and B is the Co-IP experiment verifying that enhancement of Hsa_circ_0002688 leads to enhanced binding of SRSF6 and USP10. Figure 11 To verify the effects of SRSF6 or USP10 interference on the increased TNBC migration or invasion capacity induced by Hsa_circ_0002688 overexpression using Transwell assays, A represents the effect of SRSF6 interference on the increased TNBC migration capacity induced by Hsa_circ_0002688 overexpression using Transwell assays, B represents the quantification of A, C represents the effect of USP10 interference on the increased TNBC invasion capacity induced by Hsa_circ_0002688 overexpression using Transwell assays, and D represents the quantification of C. Detailed Implementation
[0035] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0036] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.
[0037] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0038] Patient samples: Tissue specimens of triple-negative breast cancer were obtained from cancer patients at Qilu Hospital of Shandong University who underwent surgery and were diagnosed histologically.
[0039] In situ hybridization (ISH) assay: In situ hybridization was performed using the Enhanced Sensitive In situ Hybridization Detection Kit I (Wuhan Boster Biological Engineering Co., Ltd., China). A digoxigenin-labeled Hsa_circ_0002688 specific probe (nucleotide sequence shown in SEQ ID NO: 8 (TGAAGAAGACTCTGTGTTC)) was designed and synthesized by Shanghai Gemma Pharmaceutical Technology Co., Ltd. Following standard procedures, tissue sections were processed sequentially: first, fixed with 4% paraformaldehyde (15 min), then blocked with 30% hydrogen peroxide + methanol (1:50 v / v) for 30 min, followed by pepsin digestion (15–30 min, 37 °C). After pre-hybridization in solution (37 °C, 4 h), the sections were hybridized with the digoxigenin-labeled Hsa_circ_0002688 probe (37 °C, overnight). Subsequent treatments included sequential incubation with blocking reagents, biotinylated rat anti-digoxigenin antibody, streptavidin-biotin-peroxidase (SABC) complex, and biotinylated peroxidase. Signal detection was achieved by 3,3'-diaminobenzidine (DAB) staining followed by hematoxylin counterstaining (Solepro Science & Technology Co., Ltd., Beijing, China), and then bright-field microscopy imaging was performed.
[0040] HE staining: First, dewax the paraffin sections by baking them in a 60℃ oven for 30 min. Then, sequentially immerse them in xylene I (10 min), xylene II (10 min), anhydrous ethanol (5 min), 95% ethanol (3 min), and 80% ethanol (3 min) for gradient dehydration. Finally, rinse with running water for 1 min to rehydrate. Next, immerse in Harris hematoxylin staining solution for 5–8 min, rinse off excess stain with running water, differentiate with 1% hydrochloric acid ethanol for 1–3 s (nuclear staining depth needs to be controlled under a microscope), and then rinse with running water for 15 min to regain blue color. Then, stain with 0.5% eosin ethanol solution for 1–3 min, and quickly dehydrate with 95% ethanol and anhydrous ethanol for 10 s each. Finally, clear with xylene I and II for 3 min each, mount with neutral resin, and gently press the coverslip to avoid air bubbles.
[0041] Transwell invasion and migration assays: Transwell invasion and migration assays were performed using a Transwell system (Costar, Corning Incorporated, Lowell, Massachusetts, USA). For the migration assay, triple-negative breast cancer cells suspended in serum-free medium were seeded into the upper chamber, while the lower chamber contained 700 μL of Duchenne Modified Eagle Medium (DMEM) containing 20% fetal bovine serum (FBS) as a chemokine. After incubation at 37 °C, unmigrated cells on the upper membrane surface were wiped off with a cotton swab, and migrated cells on the lower surface were fixed with methanol and stained with 0.5% crystal violet. The invasion assay followed the same protocol, but used a matrix gel-coated membrane (BD Biosciences, Bedford, Massachusetts, USA) to simulate extracellular matrix penetration. All experiments were repeated three times and performed independently.
[0042] Scratch healing assay: Transfected cells were seeded at 100% density in 24-well plates and cultured in DMEM medium supplemented with 10% fetal bovine serum for approximately 24 h to form a complete monolayer. A uniform wound was then created in each well using a sterile 10 μL plastic pipette tip. After rinsing with PBS to remove detached cells, initial wound images were acquired using an Olympus optical microscope. Subsequently, cells were cultured in serum-free DMEM medium to minimize the influence of proliferation, and additional images were acquired at 24 h and 48 h to monitor wound closure and quantify differences in migration ability between groups.
[0043] Immunohistochemistry (IHC) assay: 10 mM sodium citrate buffer (pH 6.0) was used for antigen retrieval. Pathological sections were incubated overnight at 4 °C with primary antibodies Ki-67 (1:1000) and TRIM38 (1:200). Secondary antibodies were incubated according to the instructions of the immunohistochemistry kit (PV9000, ZSGB-BIO). 3,3'-Diaminobenzidine (DAB) (ZLI-9018, ZSGB-BIO) was used as the chromogenic agent, and hematoxylin was used for counterstaining.
[0044] Immunofluorescence (IF) staining: Cells were seeded onto glass coverslips in 24-well plates or confocal dishes. After fixation with methanol for 15 min at room temperature, cells were blocked with 10% bovine serum albumin (BSA) in PBS for 1 h, and then incubated overnight with primary antibody at 4 °C. After washing three times with PBST, secondary antibody (FITC or rhodamine-labeled IgG) and DAPI were sequentially applied to the coverslips or confocal dishes and incubated at room temperature for 30 min. Subsequently, the cells were analyzed using a Zeiss LSM980 confocal microscope.
[0045] Co-immunoprecipitation (Co-IP) assay: Cells were lysed in IP lysis buffer (Beyotime, P0013, China) at 4 °C for 30 min, followed by centrifugation at 12000 × g at 4 °C for 30 min. 500 μg of total protein was collected from the supernatant and incubated with 5 μg of specific primary antibody or control IgG at 4 °C for 2 h using continuous rotation. Then, the protein-antibody complex was incubated overnight at 4 °C with 40 μL of Protein A / G agarose beads (Santa Cruz Biotechnology, SC-2003) for capture. The beads were washed four times with IP lysis buffer (300 × g, 5 min each time), then resuspended in 40 μL of 2 × SDS loading buffer and denatured at 95 °C for 10 min. The immunoprecipitated protein was then analyzed by Western blotting.
[0046] RNA extraction and quantitative real-time PCR (qRT-PCR): Total RNA was extracted from cells or tissues using RNA-easy separation reagent (Novozymes, China). RNA purity and concentration were detected using NanoDrop 2000 (Thermo Fisher, USA). cDNA (nucleotide sequence as shown in SEQ ID NO: 1) was synthesized using the PrimeScript reverse transcription kit (Takara, Japan). qRT-PCR analysis was performed using SYBR Premix Ex Taq II (Takara) on a Light Cycler 480 II real-time quantitative PCR system (Roche, Switzerland), with β-actin as an internal control.
[0047] The primer pair for detecting Hsa_circ_0002688 includes a forward primer (CAGAGAGCACGCTACAACAC) with a nucleotide sequence as shown in SEQ ID NO: 2 and a reverse primer (GAGGAACACAGAACACTCGC) with a nucleotide sequence as shown in SEQ ID NO: 3.
[0048] The internal reference primers used for homogenization are primer pairs with β-actin as the internal reference. The nucleotide sequences of the upstream and downstream primers are shown in SEQ ID NO: 4 (CACTGTGCCCATCTACGAG) and SEQ ID NO: 5 (AATGTCACGCACGATTTCC).
[0049] Example 1 In situ hybridization and HE staining revealed that Hsa_circ_0002688 was present in the tissues of patients with triple-negative breast cancer. Figure 1To further analyze the correlation between the expression level of Hsa_circ_0002688 and the clinicopathological characteristics and overall survival of patients with triple-negative breast cancer (TNBC), 90 patients diagnosed with TNBC at the Department of Breast Surgery, Qilu Hospital of Shandong University from 2011 to 2019 were selected. The expression level of Hsa_circ_0002688 in the tumor tissue of these patients was quantitatively detected by qRT-PCR. The analysis showed that the expression level of Hsa_circ_0002688 was closely related to the metastatic status of TNBC (as shown in Table 1). Based on the expression level of Hsa_circ_0002688 in TNBC patients, they were divided into high expression group and low expression group according to the median mean. Univariate and multivariate Cox regression analyses (as shown in Table 2) further confirmed that Hsa_circ_0002688 is an independent prognostic factor affecting overall survival (OS) and disease-free survival (DFS) in TNBC patients. Figure 2 ).
[0050] Table 1. Association analysis between clinicopathological features and Hsa_circ_0002688 expression in triple-negative breast cancer patients.
[0051] Table 2 Univariate and multivariate analyses of prognostic factors for overall survival (OS) in patients with triple-negative breast cancer
[0052] Example 2 The specific method for silencing or inhibiting Hsa_circ_0002688 expression in triple-negative breast cancer cells was as follows: Hsa_circ_0002688-specific siRNAs were designed and synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd. The sense strand of siRNA-1 is: GAAGACUCUGUGUUCUAAGTT, and the antisense strand is: CUUAGAACACAGAGUCUUCTT; the sense strand of siRNA-2 is: AGACUCUGUGUUCUAAGAATT, and the antisense strand is: UUCUUAGAACACAGAGUCUTT. Transient transfection was performed using Lipofectamine 2000 (Ingenieur Pharmaceuticals, California, USA) according to the manufacturer's protocol.
[0053] The specific method for overexpressing Hsa_circ_0002688 in triple-negative breast cancer cells: The Hsa_circ_0002688 overexpression vector (pLO5 - Hsa_circ_0002688) and its control plasmid (pLO5 - ciR) were purchased from Guangzhou Gediao Biotechnology Co., Ltd. Transient transfection was performed using Lipofectamine 2000 (Ingenieur, California, USA) according to the manufacturer's protocol.
[0054] In vivo fluorescence imaging: Fluorescein potassium salt was injected intraperitoneally. After a 10-minute wait, an anesthetic (2.5% tribromoethanol) was injected intraperitoneally. Once the animal was fully anesthetized, it was fixed in a supine position at the center of the imaging darkroom platform. The small animal in vivo optical imaging system was then activated for imaging.
[0055] Transwell and scratch assays showed that silencing Hsa_circ_0002688 significantly inhibited the migration and invasion of triple-negative breast cancer cells. Figure 3 and Figure 4 ).
[0056] A mouse model of lung metastasis caused by tail vein injection of triple-negative breast cancer cells was established. In vivo fluorescence imaging and HE staining results confirmed that, compared with the control group, silencing Hsa_circ_0002688 significantly inhibited lung metastasis of triple-negative breast cancer cells. Figure 5 In situ hybridization and immunohistochemical analysis showed that silencing Hsa_circ_0002688 in vivo inhibited the expression of N-cadherin and vimentin in tumor tissues, which was consistent with the results of in vitro experiments. Figure 6 ).
[0057] Overexpression of Hsa_circ_0002688 in triple-negative breast cancer cell lines was found to enhance both cell invasion and migration abilities. Figure 7 In vivo experiments overexpressing Hsa_circ_0002688 also confirmed the above results. Figure 8 In conclusion, Hsa_circ_0002688 can promote the invasive and migration abilities of triple-negative breast cancer.
[0058] Example 3 The specific method for silencing or inhibiting USP10 expression in triple-negative breast cancer cells: A USP10-specific siRNA was designed and synthesized by Shanghai Gemma Pharmaceutical Technology Co., Ltd. The siRNA forward sequence is GAGGAAUACUUAGGCUUCATT, and the reverse sequence is UGAAGCCUAAGUAUUCCUCTT. Transient transfection was performed using Lipofectamine 2000 (Ingenieur Pharmaceuticals, California, USA) according to the manufacturer's protocol.
[0059] Immunofluorescence assays showed that knockdown of Hsa_circ_0002688 significantly inhibited the co-localization of SRSF6 and USP10 by reducing nuclear accumulation of USP10. Figure 9 Co-IP experiments further demonstrated that knocking down Hsa_circ_0002688 reduced the binding affinity of SRSF6-USP10. Figure 10 (A), while overexpression of Hsa_circ_0002688 enhances this interaction ( Figure 10 Hsa_circ_0002688 acts as a molecular scaffold that promotes the binding of SRSF6 to USP10. In vitro functional experiments demonstrated that knockdown of USP10 reversed the enhanced migration and invasion of TNBC cells induced by Hsa_circ_0002688 overexpression. Figure 11 Therefore, USP10 is a key functional mediator of Hsa_circ_0002688's oncogenic function.
[0060] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. Application of Hsa_circ_0002688 as a prognosis marker of triple-negative breast cancer in the preparation of a product for evaluating the prognosis of triple-negative breast cancer. The nucleotide sequence of Hsa_circ_0002688 is shown as SEQ ID NO:
1.
2. Application of a reagent or kit for detecting the expression amount of Hsa_circ_0002688 in the preparation of a product for evaluating the prognosis of triple-negative breast cancer. The nucleotide sequence of Hsa_circ_0002688 is shown as SEQ ID NO:
1.
3. Use according to claim 2, wherein the compound is ###0002### The reagent or kit for detecting the expression amount of Hsa_circ_0002688 contains a primer pair for detecting Hsa_circ_0002688, and the primer pair for detecting Hsa_circ_0002688 includes a forward primer with a nucleotide sequence shown as SEQ ID NO: 2 and a reverse primer with a nucleotide sequence shown as SEQ ID NO:
3.
4. A product for assessing the prognosis of triple-negative breast cancer, characterized by, The primer pair for detecting Hsa_circ_0002688.
5. The product of claim 4, wherein, The primer pair includes a forward primer with a nucleotide sequence shown as SEQ ID NO: 2 and a reverse primer with a nucleotide sequence shown as SEQ ID NO:
3.
6. Application of a substance that silences or inhibits the expression of Hsa_circ_0002688 in the preparation of a drug for treating triple-negative breast cancer.
7. Use according to claim 6, wherein The substance that silences or inhibits the expression of Hsa_circ_0002688 includes siRNAs targeting Hsa_circ_0002688, and the siRNAs include a sense strand with a nucleotide sequence shown as SEQ ID NO: 6 and an antisense strand shown as SEQ ID NO:
7. Or, the application of the drug includes at least one of the following: (1) Inhibiting the migration and invasion of triple-negative breast cancer cells; (2) Reducing the nuclear accumulation of ubiquitin-specific protease 10 (USP10); (3) Reducing the binding affinity of arginine / serine-rich splicing factor 6 (SRSF6) and ubiquitin-specific protease 10 (USP10).
8. A medicament for treating triple-negative breast cancer, characterized by, The substance that silences or inhibits the expression of Hsa_circ_0002688.
9. The medicament according to claim 8, wherein The substance that silences or inhibits the expression of Hsa_circ_0002688 includes siRNAs targeting Hsa_circ_0002688, and the siRNAs include a sense strand with a nucleotide sequence shown as SEQ ID NO: 6 and an antisense strand shown as SEQ ID NO:
7.
10. A pharmaceutical composition, characterized by, The drug for treating triple-negative breast cancer of claim 8 or 9.