Immunotherapy using low immunogenic engineered cells
By expressing NK repressor protein and knocking out the second signaling molecule in pluripotent stem cells, the immunogenicity problem of allogeneic T cells or NK cells has been solved, enabling large-scale preparation and easy application of low-immunogenic cell products, thus improving the efficacy and accessibility of immunotherapy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-11
- Publication Date
- 2026-04-10
AI Technical Summary
Existing technologies make it difficult to develop allogeneic T-cell or NK-cell products with low immunogenicity, resulting in autologous cell therapy being time-consuming, labor-intensive, and costly, and making it difficult to effectively control cannibalism and host immune responses.
By upregulating the expression of selected genes containing NK repressor proteins such as Clec2d, Nectin-1, CDH1, CD155 and combinations thereof in pluripotent stem cells (iPSCs), and knocking out second signaling molecules such as CD58, CD54, CD86, the immunogenicity of engineered cells is reduced, while MHC-I molecules are preserved to avoid cannibalism and host immune responses.
This technology enables large-scale, highly homogeneous, and low-cost preparation of low-immunogenic cell products, reducing cannibalism and host immune responses, improving efficacy and survival rates, simplifying the application process, reducing costs, and enhancing the therapeutic effects on cancer and autoimmune diseases.
Smart Images

Figure CN121844043A_ABST
Abstract
Description
Technical Field
[0001] This invention relates generally to the field of immunotherapy, and more specifically to engineered hematopoietic cells (e.g., natural killer (NK) cells or T cells) and their uses. Background Technology
[0002] Currently, most cell therapy products are autologous CAR-T cells. The process of preparing autologous CAR-T cells is time-consuming, labor-intensive, and costly.
[0003] T cells, or T lymphocytes, are a vital class of white blood cells in the immune system. Their multifaceted role in fighting infections, cancer, and autoimmune diseases puts them at the forefront of therapeutic innovation. Ongoing research and clinical trials show great promise in fully utilizing the full potential of T cells in the fight against a variety of human diseases, such as in cancer immunotherapy, where T cells (especially through chimeric antigen receptor (CAR) T cell therapy) are engineered to target and kill pathological target cells, such as cancer cells, B cells, and other T cells. Natural killer (NK) cells are cytotoxic lymphocytes in the innate immune system whose natural function is to kill cells infected by microorganisms and / or cancer cells. T cell and NK cell-mediated immunotherapies have been tried in patients with a variety of diseases, including autoimmune diseases and cancer, such as T cell-mediated immunotherapy for treating acute lymphoblastic leukemia and multiple sclerosis, and NK cell-mediated immunotherapy for treating leukemia and other cancers. Initially, autologous T cells or NK cells were used, by isolating hematopoietic cells from the patient, expanding T cells or NK cells, and then re-infusing the T cells or NK cells into the patient. Transgenic NK cells designed to enhance activity and / or reduce immunogenicity have been described, for example, by providing enhanced IL-15 expression, or by using a CD64 / CD16A fusion protein to enhance CD16 signaling, or by expressing low-immunomodulatory peptides (e.g., containing one or more members selected from PD-L2, TGF-β, CD46, CD55, and CD59), or by being engineered to contain heterologous transcription factors (e.g., STAT) and reduce the activity of endogenous cytokine receptors (e.g., endogenous IL receptors, such as IL-17R), as described, for example, in WO2022095902A1, the contents of which are incorporated herein by reference. Using autologous T cells or NK cells, rather than allogeneic T cells or NK cells, avoids the need for immunosuppressive therapy to prevent rejection of engineered cells. However, perhaps due to their compatibility with the patient's immune system, autologous T cells or NK cells often also fail against cancer, for example, due to inhibitory interactions between autologous T cells or NK cells and their own MHC1 molecules.
[0004] For years, developing an "off-the-shelf" allogeneic T-cell or NK-cell product for patient use has been a goal; however, engineering allogeneic T-cells or NK cells to reduce their immunogenicity (hypoimmunogenicity) has proven challenging. Strategies are needed to avoid activation of host immune cells (e.g., host CD8 T cells and host NK cells) and to avoid fratricide of other NK cells within the host due to a "missing self" response. Another challenge is the difficulty in converting and expanding primary differentiated cells (such as T cells or NK cells), while strategies involving stem cell conversion (e.g., induced pluripotent stem cells (iPSCs) or hematopoietic stem cells (HSCs)) face the challenge that genetic engineering to express or suppress gene expression may interfere with the engineered cells' ability to differentiate into T-cells or NK cells.
[0005] Currently, gene editing for achieving hypoimmunity typically involves knocking out MHC-I and MHC-II to evade host T cell targeting and killing of allogeneic T cells or NK cells. The problem is that knocking out MHC-I can lead to "loss of self"-induced killing by other T cells or NK cells, a phenomenon sometimes referred to as cannibalism. To overcome this cannibalism, NK cell inhibitory molecules, such as human leukocyte antigen (HLA)-E / G, are introduced to suppress the killing by other allogeneic T cells or NK cells. However, due to the heterogeneity of T cells or NK cells, it is difficult to suppress all allogeneic T cells or NK cells by expressing these NK cell inhibitory molecules. Therefore, although allogeneic T cells or NK cells are protected from the host immune system due to the lack of MHC-I and MHC-II, they still rapidly decrease because they cannot effectively suppress fraternal T cells or NK cells. They may also encounter rejection by host NK cells.
[0006] Better methods are needed to engineer low-immunity allogeneic hematopoietic cells. Summary of the Invention
[0007] We were surprised to find that upregulating selected genes in induced pluripotent stem cells (iPSCs) not only allowed iPSCs to continue differentiating into hematopoietic cells (e.g., T cells or NK cells), but also further reduced the activation of host immune cells. For example, engineered cells expressing certain NK repressor proteins reduced the activation of allogeneic (host) NK cells in response to engineered cells, but the expression of selected NK repressor proteins did not interfere with the differentiation of iPSCs containing exogenous genes into selected hematopoietic cells (e.g., T cells or NK cells). For example, the NK repressor proteins expressed by the transgenes were selected from Clec2d, Nectin-1, CDH1, CD155, and combinations thereof.
[0008] Furthermore, we found that in hematopoietic cells (e.g., T cells or NK cells), retaining MHC-I molecules but knocking out selected second signaling molecules (e.g., one or more of CD58, CD54, CD86, or ICAM1), or knocking in one or more of CD47 or tCD64, reduced their stimulation of CD8+ T cells. Therefore, by simply knocking out / knocking in these second signaling molecules, we can induce low immunogenicity in cells.
[0009] By reducing the sensitivity of endogenous immune cells to the recognition and activation of engineered cells—that is, by conferring low immunogenicity to engineered cells—we are able to develop an "off-the-shelf" cell platform for cell-based immunotherapies. Optionally, the cells may be further engineered, for example, by knocking out / knocking in a second signaling molecule and / or inserting a chimeric antigen receptor (CAR) construct.
[0010] Therefore, induced pluripotent stem cells (iPSCs) can provide low-immunogenic cell products, including T cells or NK cells, in this context. These products can be prepared on a large scale, with high homogeneity and low cost. Low-immunogenic cell products derived from iPSC differentiation also overcome the limitations of autologous CAR-T cell therapy. Low-immunogenic cell products resist the cannibalistic effects that often accompany the introduction of engineered immune cells into patients, caused by mixing with endogenous immune cells. This, in turn, improves the survival rate of the product in vivo, thereby enhancing its efficacy. Because low-immunogenic cell products do not induce immune rejection, they can be administered multiple times as needed. Current cell therapy products require infusion after lymphodepletion, a process that can cause toxic side effects and make patients more susceptible to infection. Low-immunogenic cell products can reduce or even eliminate these complex procedures, making the administration of cell therapy products simpler and easier. Similarly, compared to autologous cells, allogeneic primary cells derived from healthy donors (such as primary T cells and primary NK cells) can be stably supplied and mass-produced, reducing the need for patient-specific collection and processing, thereby lowering costs. Furthermore, allogeneic primary cells in this context exhibit stronger, longer-lasting, and lower-immune rejection rates against hematologic malignancies and solid tumors. In conclusion, the development and production of low-immunogenic engineered cells can enhance the efficacy of cell-based immunotherapies, improve accessibility by enabling simpler and lower-cost production of "off-the-shelf" products, and improve the patient experience by eliminating associated immunosuppressive procedures that increase the risk of complications.
[0011] However, we also found that engineering iPSCs may interfere with their ability to differentiate into T cells or NK cells and raise other issues. For example, deleting the conserved gene β-2-microglobulin completely eliminates the surface expression of HLA class I molecules, thereby reducing the immunogenic recognition by host CD8 T cells. Furthermore, as mentioned above, although this approach reduces the immunogenic recognition by host CD8 T cells, the complete loss of HLA class I molecules increases the risk of graft NK cells initiating cannibalism due to the "loss of self" mechanism, and host CD4 T cells can also participate in the rejection of allogeneic cells by recognizing HLA class II molecules.
[0012] Finally, and importantly, engineering (gene knockout or knock-in) should not impair the ability of hematopoietic cells to target and kill pathological target cells (such as cancer cells, B cells, T cells, etc.).
[0013] Therefore, choosing a specific gene modification (whether alone or in combination) requires comprehensive consideration of multiple factors.
[0014] This disclosure provides engineered cells comprising (i) engineered stem cells (e.g., induced pluripotent stem cells (iPSCs)) and (ii) engineered hematopoietic cells (e.g., T cells or NK cells, which may be progeny of the engineered stem cells). The cells are made to have low immunogenicity by transfecting or knocking out selected genes (e.g., knocking out a second signaling molecule (e.g., one or more selected from CD48, CD80, CD86, LAF-1, ICAM1, VLA4, VCAM1, CD2, CD58, CD54, B7, CD155, and CD122), and / or transfecting the cells with a gene for an NK repressor protein (e.g., selected from Clec2d, Nectin-1, CDH1, CD155, CD47, tCD64, and combinations thereof)) without limiting the ability of the engineered stem cells to differentiate into desired hematopoietic cells. This disclosure also provides pharmaceutical compositions comprising such engineered hematopoietic cells, methods for producing such cells, and methods for using such cells to treat diseases such as cancer and autoimmune diseases.
[0015] Furthermore, more specific implementation methods are described in the detailed description and examples below. Attached Figure Description
[0016] Figure 1The sensitivity of engineered K562 cells with gene insertion (i.e. knock-in, “KI”) of HLA-E, Clec2d, Nectin-1, CD155, CD24, CD72, FASL, SERPINB9, VPX, VPU, or NEF to allogeneic peripheral blood natural killer (PBNK) cells was demonstrated.
[0017] Figure 2 A gene construct inserted into K562 cells to overexpress the Clec2d gene and the blue fluorescent protein (BFP) reporter gene is shown.
[0018] Figure 3 The flow cytometry histogram results show that the Clec2d / BFP construct inserted into K562 cells was successfully overexpressed (top figure), and the expression levels of the Clec2d gene from different mammalian species relative to the human control (bottom figure).
[0019] Figure 4 The relative expression levels of human Clec2d / BFP constructs containing K-to-R mutations at different ubiquitination sites are shown.
[0020] Figure 5 The results of CD107a degranulation assays of human cord blood natural killer (CBNK) cells and human PBNK cells exposed to engineered K562 / Clec2d cells are presented. Unmodified K562 cells (K562) were used as a negative control, expected to activate degranulation of allogeneic NK cells. HLA-E overexpressing K562 cells (K562 / HLAE) were used as a positive control, representing current state-of-the-art technology for reducing sensitivity to allogeneic NK cells. The presence (+) or absence (-) of NKG2A indicates whether CBNK / PBNK cells have the ability to bind to HLA-E molecules.
[0021] Figure 6 The results of cytotoxicity studies are presented, in which CBNK and PBNK cells were exposed to unmodified K562 cells (K562), HLA-E-overexpressing K562 cells (K562 / HLAE), and engineered K562 / Clec2d cells. The E:T ratio represents the proportion of effector cells (i.e., CBNK / PBNK) relative to target cells (i.e., K562 cells).
[0022] Figure 7 This study demonstrated a dose-dependent effect of inhibiting the cytotoxicity of CBNK / PBNK cells against engineered K562 / Clec2d cells, in which a human Clec2d construct was transfected into K562 cells overexpressing HLA-E / G and conferred protection against human allogeneic NK cells based on the expression level of Clec2d.
[0023] Figure 8 This study demonstrated the protective effect of human Clec2d against allogeneic human PBNK cell cytotoxicity in 2KO NK cells.
[0024] Figure 9 This study demonstrated the protective effect of monkey Clec2d against monkey NK cell cytotoxicity in K562 cells.
[0025] Figure 10 The results demonstrate that induced pluripotent stem cells (iPSCs) successfully differentiated into embryoid bodies (EBs) after engineered overexpression of Clec2d.
[0026] Figure 11 A gene construct inserted into K562 cells to overexpress the CDH1 gene and the BFP reporter gene is shown.
[0027] Figure 12 The flow cytometry histogram results show that the CDH1 / BFP construct inserted into K562 cells was successfully overexpressed.
[0028] Figure 13 The results of CD107a degranulation assays in CBNK and PBNK cells exposed to engineered K562 / CDH1 cells are presented. K562 was used as a negative control, and K562 / HLAE as a positive control.
[0029] Figure 14 The results of cytotoxicity studies are presented, in which CBNK and PBNK cells were exposed to unmodified K562 cells (K562), HLA-E-overexpressing K562 cells (K562 / HLAE), and engineered K562 / CDH1 cells. The E:T ratio represents the proportion of effector cells (i.e., CBNK / PBNK) relative to target cells (i.e., K562 cells).
[0030] Figure 15 The study demonstrated the effect of inhibiting the cytotoxicity of CBNK / PBNK cells on engineered K562 / CDH1 cells, in which the CDH1 construct was transfected into K562 cells overexpressing HLA-E / G.
[0031] Figure 16 We present dose-dependent results of iPSC differentiation into EB after engineered overexpression of CDH1.
[0032] Figure 17 A gene construct inserted into K562 cells to overexpress the Nectin-1 (NECTIN1) gene and the BFP reporter gene is shown.
[0033] Figure 18The flow cytometry histogram results show that the Nectin-1 / BFP construct inserted into K562 cells was successfully overexpressed.
[0034] Figure 19 The results of CD107a degranulation assays in CBNK and PBNK cells exposed to engineered K562 / NECTIN1 cells are presented. K562 was used as a negative control, and K562 / HLAE as a positive control.
[0035] Figure 20 The results of cytotoxicity studies are presented, in which CBNK and PBNK cells were exposed to unmodified K562 cells (K562), HLA-E-overexpressing K562 cells (K562 / HLAE), and engineered K562 / NECTIN1 cells. The E:T ratio represents the proportion of effector cells (i.e., CBNK / PBNK) relative to target cells (i.e., K562 cells).
[0036] Figure 21 The study demonstrated the effect of inhibiting the cytotoxicity of CBNK / PBNK cells on engineered K562 / NECTIN1 cells, in which the Nectin-1 construct was transfected into K562 cells overexpressing HLA-E / G.
[0037] Figure 22 The results show that iPSCs successfully differentiated into EBs after engineered overexpression of Nectin-1.
[0038] Figure 23 A gene construct inserted into K562 cells to overexpress the CD155 gene and the BFP reporter gene is shown.
[0039] Figure 24 The flow cytometry histogram results show that the CD155 / BFP construct inserted into K562 cells was successfully overexpressed.
[0040] Figure 25 The results of CD107a degranulation assays in CBNK and PBNK cells exposed to engineered K562 / CD155 cells are presented. K562 was used as a negative control, and K562 / HLAE as a positive control.
[0041] Figure 26 The results of cytotoxicity studies are presented, in which CBNK and PBNK cells were exposed to unmodified K562 cells (K562), HLA-E-overexpressing K562 cells (K562 / HLAE), and engineered K562 / CD155 cells. The E:T ratio represents the proportion of effector cells (i.e., CBNK / PBNK) relative to target cells (i.e., K562 cells).
[0042] Figure 27 We demonstrated a dose-dependent effect of inhibiting the cytotoxicity of CBNK / PBNK cells against engineered K562 / CD155 cells, in which the CD155 construct was transfected into K562 cells overexpressing HLA-E / G, and found that lower levels of CD155 expression conferred stronger protection against activation of allogeneic NK cells.
[0043] Figure 28 This study demonstrated the protective effect of human CD155 against allogeneic human PBNK cell cytotoxicity in 2KO NK cells.
[0044] Figure 29 The results show that iPSCs successfully differentiated into EBs after engineered overexpression of CD155.
[0045] Figure 30 The results show the effects of simultaneous knockout of UL16-binding proteins (ULBP)-2, 5, and -6 using unidirectional guide RNA (sgRNA). These proteins encode major histocompatibility complex (MHC) class I-related molecules that bind to the NKG2D receptor, which activates NK cell cytotoxicity. ULBP2 / 5 / 6 knockout in double-knockout endometrial NK cells (SU11) protects SU11 cells from the cytotoxic effects of CBNK and PBNK. (A) shows the indel frequency analysis. (B) shows the flow cytometry histogram results of ULBP2 / 5 / 6 knockout. (C) shows the cytotoxicity of PBNK cells. (D) shows the cytotoxicity of CBNK cells.
[0046] Figure 31 The results of CD107a degranulation assays in CBNK and PBNK cells exposed to ULBP2 / 5 / 6 knockout engineered SU11 cells are presented.
[0047] Figure 32 This study compares the efficacy of specific gene transduction and their inhibition of PBNK cell cytotoxicity against K562 / HLAE / G cells. In descending order of efficacy, the selected genes most effective in conferring protection to K562 / HLAE / G cells are: Clec2d-30 > Nectin-1-10 > CDH1-30 > CD155-10 > Clec2d-10 > CD155-30 > CD24-10.
[0048] Figure 33This study demonstrates the effect of single transgene insertion of the CDH1 construct into ANB iPSCs on their ability to differentiate into EBs. Low expression levels of CDH1 in iPSCs (L4 / L6) allow them to differentiate normally into EBs; however, moderate (M4 / M9) and high (H3 / H5) expression levels of CDH1 interfere with typical EB formation.
[0049] Figure 34 The flow cytometry histogram results show the successful knockout of transforming growth factor (TGF)-β receptor 2 in K562 cells, suggesting that genetic engineering may inhibit iPSC differentiation.
[0050] Figure 35 Flow cytometry analysis of CD86, ICAM1, and CD58 knockouts was presented, showing that the CRISPR-Cas9 construct can effectively knock out the protein expression of these genes.
[0051] Figure 36 The study showed the killing ability of NK cells with CD86, ICAM1, or CD58 knocked out, indicating that knockout does not affect the ability of NK cells to kill cancer cells (Raji cells in this case).
[0052] Figure 37 The knockout of CD58, CD86, and ICAM1 did not affect the expression of MHC-I in eNK cells.
[0053] Figure 38 The results showed that CD58, CD86, and ICAM1 knockout significantly reduced stimulation of CD8+ cells.
[0054] Figure 39 This shows the effects of knocking out various genes and gene combinations on CD8+ stimulation.
[0055] Figure 40 The effects of QN-019 eNK cells containing CD19-CAR, CD16, and IL15 transgenes were demonstrated with and without ICAM1, CD86, and CD58 knockout, showing that these knockouts also reduced the stimulation of CD8+ T cells by QN-019 eNK cells.
[0056] Figure 41 The study showed the effect of the Clec2d mutation on its expression in 293T cells, with the cysteine mutation causing the disappearance of Clec2d expression.
[0057] Figure 42 The structure of the gene construct used to express members of the CLEC family is shown.
[0058] Figure 43 The expression of CLEC family members in 293T is shown.
[0059] Figure 44 The structures of different gene constructs used to express Clec2d are shown.
[0060] Figure 45 This shows the transfection efficiency of different gene constructs.
[0061] Figure 46 This shows the effect of different gene constructs on Clec2d expression in 293T.
[0062] Figure 47 The display shows that NHP Clec2d can protect 2KO CAR-T from NHP CD161. + PBNK's lethality
[0063] Figure 48 The expression of HLA-E and CLEC2D is shown under different MOIs.
[0064] Figure 49 This shows the effect of promoters and MOI on Clec2d expression. Detailed Implementation
[0065] The following descriptions of different implementations are exemplary in nature and are in no way intended to limit the invention, its application, or its uses. I. Definition
[0066] Unless otherwise expressly stated, the following terms as used herein have the meanings described below.
[0067] As used herein, the term "immune cell" generally refers to differentiated hematopoietic cells. Non-limiting examples of immune cells may include NK cells, T cells, monocytes, innate lymphocytes, tumor-infiltrating lymphocytes, macrophages, granulocytes, etc.
[0068] As used herein, the terms "T cell" or "T lymphocyte" are generally accepted in the art and are intended to include thymocytes, naïve cells, and other cellular cells. T lymphocytes, including (e) T lymphocytes, immature T lymphocytes, mature T lymphocytes, resting T lymphocytes, or activated T lymphocytes. Illustrative examples of T cell populations suitable for the methods of the present invention include, but are not limited to, helper T cells (HTL; CD4+). + T cells, cytotoxic T cells (CTLs; CD8) + T cells), CD4 + CD8 +T cells, or any other suitable subset of T cells. Other illustrative examples of T cell populations suitable for use include T cells expressing one or more of the following markers: CD3, CD4, CD8, CD27, CD28, CD45RA, CD45RO, CD62L, CD127, CD197, and HLA-DR. In a particular aspect, the T cell population comprises (e.g., more than 90%, 95%, 97%, 98%, or 99%) CD8+ T cells, is substantially composed of (e.g., more than 90%, 95%, 97%, 98%, or 99%) CD8+ T cells, or is substantially composed of (e.g., more than 90%, 95%, 97%, 98%, or 99%) CD8+ T cells.
[0069] In one aspect, the T cells are obtained from mammalian subjects. In another aspect, the cells are obtained from primate subjects. In a particular aspect, the cells are obtained from human subjects. The T cell population can be obtained from a variety of sources, including but not limited to peripheral blood, peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from sites of infection, ascites, pleural effusion, spleen tissue, and tumors.
[0070] Once a cell population containing T cells is obtained, cell counts and cell viability within the population can be determined. The cell population, or a portion thereof, can be cryopreserved for subsequent use or analysis. The cells in the population (e.g., PBMCs) can be characterized using a variety of cell markers (e.g., CD2, CD3, CD4, CD8, CD14, CD16, CD19, CD25, CD28, CD45RA, CD45RO, CD61, CD62L, CD66b, CD152, CD127, NK1.1, FOXP3, Foxp3+, CXCR3, CCR4, and HLA-DR) and maintained in T cell culture medium.
[0071] In certain respects, PBMC populations are used to isolate T cell populations. Specific cell types can be isolated from PBMCs as described herein or by conventional methods. In some respects, cytotoxic T lymphocytes and helper T lymphocytes can be sorted into naive, memory, and effector T cell subsets before or after activation, expansion, and / or genetic modification. Alternatively, T cells can be obtained commercially.
[0072] As used herein, the term "natural killer cells" or "NK cells" generally refers to a subset of peripheral blood lymphocytes characterized by the expression of CD56 or CD16 and the absence of T cell receptors (i.e., CD3). In some cases, NK cells are CD3- and CD56+ phenotyped, expressing at least one of NKG2C and CD57 (e.g., NKG2C, CD57, or both co-expressed to equal or different degrees), and optionally expressing CD16, but lacking expression of one or more of the following: PLZF, SYK, FceRγ, and EAT-2. In some cases, isolated CD56+ NK cell subsets may exhibit expression of CD16, NKG2C, CD57, NKG2D, NCR ligands, NKp30, NKp40, NKp46, activating and repressive KIRs, NKG2A, and / or DNAM-1.
[0073] As used herein, the terms “immune response” and “activation” of immune cells generally refer to a T-cell-mediated, B-cell-mediated, and / or NK-cell-mediated immune response of the host’s immune system against an object (e.g., a foreign substance, such as exogenous or allogeneic cells). Examples of immune responses include T-cell responses, such as cytokine production, and cytotoxicity, such as antibody-dependent cell-mediated cytotoxicity (ADCC). In some cases, immune responses can be indirectly influenced by T-cell activation, such as antibody production (humoral response) and activation of cytokine-responsive cells (e.g., macrophages). As used herein, “activation” in the context of NK cells generally refers to the induction of a typical immune response, such as NK cell degranulation.
[0074] As used herein, “expression” of genes, DNA, and / or RNA should be understood as a process following the classical pathway that begins with DNA, which can be transcribed into RNA, and RNA can be translated into polypeptides / proteins. “Overexpression” generally refers to an increased expression level of polynucleotide and / or polypeptide sequences relative to their expression levels in the wild-type state.
[0075] As used herein, "engineered" cells should be understood to mean cells whose genomes differ from those of normal, unengineered cells due to the application of genetic engineering techniques to the cell or its progenitor cells, resulting in heterologous or altered nucleic acid sequences. Genetic engineering techniques include DNA cloning; transduction, transformation, and other gene transfer techniques; homologous recombination; site-directed mutagenesis; gene fusion; gene disruption; gene activation; and gene editing. Specifically, engineered cells include, for example, cells that: (a) have a genome that has been genetically engineered to include a transgene (sometimes referred to as "knock-in") and / or a heterologous promoter of an endogenous gene, and / or (b) have a genome that has been genetically engineered to significantly reduce or eliminate the expression of a functional protein expressed by a naturally occurring gene (e.g., using CRISPR-Cas9, prime editing, base editing, gene disruption, or other gene editing methods, sometimes referred to as "knockout").
[0076] This disclosure may refer to a coding sequence that is “operably linked to a heterologous promoter,” meaning that the promoter is capable of driving the expression of the coding sequence (i.e., “operably linked” to the coding sequence), but the coding sequence is not naturally associated with the promoter (i.e., “heterologous” to that promoter). Promoters used for transgenic purposes as described herein include, for example, constitutive promoters, such as viral promoters, and synthetic promoters. For example, the CAG promoter is a strongly synthetic promoter commonly used to drive high levels of gene expression in mammalian expression vectors. It is derived from an early enhancer element of cytomegalovirus (CMV) [C]; the promoter, first exon, and first intron of the chicken β-actin gene [A]; and the splice acceptor of the rabbit β-globin gene [G]. Other strongly constitutive promoters include the adenovirus major late promoter, the human cytomegalovirus immediate early promoter (hCMV-IE), SV40 and Rous Sarcoma virus promoters, the mouse 3-phosphoglycerate kinase promoter, the translation elongation factor 1α (EF-1α) promoter, and the human ubiquitin C promoter. In some embodiments, the coding sequence operatively linked to the heterologous promoter is part of the transgene. In some embodiments, the coding sequence is an endogenous coding region operatively linked to the heterologous promoter to provide elevated or different expression relative to its expression under the control of the native promoter.
[0077] The term "differentiation" generally refers to the process by which undifferentiated ("uncommitted") or less specialized cells acquire the characteristics of specialized cells (such as immune cells). Differentiated or differentiation-induced cells are cells that occupy a more specialized ("committed") position within a cell lineage. The term "committed" refers to cells that have progressed to a point in the differentiation pathway and, under normal circumstances, will continue to differentiate into a specific cell type or a subpopulation of that cell type, and under normal circumstances, cannot differentiate into different cell types or revert to less differentiated cell types.
[0078] The term "pluripotent" generally refers to the ability of a cell to form all lineages of a body or somatic cells (i.e., the embryonic body). For example, embryonic stem cells are a type of pluripotent stem cell capable of forming cells from each of the three germ layers: ectoderm, mesoderm, and endoderm. Pluripotency can be a continuum of developmental potential, ranging from incompletely or partially pluripotent cells that cannot produce a complete organism (e.g., epiblast stem cells) to more primitive, more pluripotent cells that can produce a complete organism (e.g., embryonic stem cells).
[0079] The term "induced pluripotent stem cell" (iPSC) generally refers to stem cells derived from differentiated cells (such as differentiated adult cells, neonatal cells, or fetal cells) that have been induced or altered (i.e., reprogrammed) to differentiate into tissues capable of differentiating into all three germ layers: mesoderm, endoderm, and ectoderm. The resulting iPSCs do not refer to cells found in nature. In some cases, iPSCs can be engineered to directly differentiate into specific cell types (e.g., natural killer (NK) cells or T cells). In other cases, iPSCs can be engineered to first differentiate into tissue-specific stem cells (e.g., hematopoietic stem cells (HSCs)), which can then be further induced to differentiate into specific cell types (e.g., T cells or NK cells).
[0080] The term "embryonic stem cell" (ESC) generally refers to naturally occurring pluripotent stem cells in the inner cell mass of the embryonic blastocyst. Embryonic stem cells are pluripotent and, during development, produce all derivatives of the three primitive germ layers: ectoderm, endoderm, and mesoderm. In some cases, ESCs can be engineered to directly differentiate into specific cell types (e.g., T cells or NK cells). In other cases, ESCs can be engineered to first differentiate into tissue-specific stem cells (e.g., HSCs), which can be further induced to differentiate into specific cell types (e.g., T cells or NK cells).
[0081] The term "isolated stem cells" generally refers to any type of stem cells disclosed herein (e.g., ESCs, HSCs, mesenchymal stem cells (MSCs), etc.) isolated from a multicellular organism. For example, HSCs can be isolated from mammals (such as humans). In another instance, embryonic stem cells can be isolated from an embryo.
[0082] The term "isolated" generally refers to cells or cell populations that have been separated from their original environment. For example, the new environment of isolated cells is substantially free of at least one component found in the environment in which "unisolated" reference cells were present. Isolated cells can be cells from which some or all of their components have been removed relative to their state of being in their native environment, such as cells isolated from tissue or biopsy samples. The term also includes cells from which at least one, some or all of their components have been removed relative to their state of being in their non-native environment, such as cells isolated from cell cultures or cell suspensions.
[0083] The terms “hematopoietic stem and progenitor cell,” “hematopoietic stem cell,” “hematopoietic progenitor cell,” or “hematopoietic precursor cell,” used interchangeably in this article, generally refer to cells morphologically classified as hematopoietic lineages but capable of further hematopoietic differentiation (e.g., differentiation into T cells or NK cells), and include pluripotent hematopoietic stem cells (hematopoietic cells), myeloid progenitor cells, megakaryocyte progenitor cells, erythrocyte progenitor cells, and lymphoid progenitor cells. Hematopoietic stem cells (HSCs) are pluripotent stem cells capable of producing all types of blood cells, including myeloid (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes / platelets, dendritic cells) and lymphoid lineages (T cells, B cells, NK cells). In some cases, HSCs can be CD34+ hematopoietic cells capable of producing mature myeloid and lymphoid cell types (including T cells, NK cells, and B cells).
[0084] The term "immune cells" generally refers to differentiated hematopoietic cells. Non-limiting examples of immune cells may include T cells, NK cells, monocytes, innate lymphocytes, tumor-infiltrating lymphocytes, macrophages, granulocytes, etc. The sources of immune cells described herein include, but are not limited to: peripheral blood, peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from sites of infection, ascites, pleural effusion, spleen tissue, and tumors.
[0085] In one embodiment, the immune cells are derived from primary cells. Methods for obtaining immune cells (e.g., T cells or NK cells) from in situ cells are available in published literature (e.g., Identification of clonogenic commonlymphoid progenitors in mouse bone marrow. Cell, 91(5), 661-672). In one embodiment, primary cell samples are first obtained from peripheral blood or tissue, followed by separation of peripheral blood mononuclear cells (PBMCs) by density gradient centrifugation, and specific immune cells (e.g., T cells or NK cells) are isolated using cell sorting methods. The obtained immune cells are then cultured and expanded in vitro under suitable culture conditions to obtain a large number of immune cells. In another embodiment, the immune cells are derived from induced pluripotent stem cells (iPSCs). Induced pluripotent stem cells (iPSCs) are directed to differentiate into hematopoietic stem cells under stimulation by specific differentiation factors, and subsequently induced to differentiate into immune cells (e.g., T cells or NK cells). Commercially available culture media can be used, and the induction of induced pluripotent stem cell differentiation can be performed according to the instructions.
[0086] The term "NK cells" or "natural killer cells" generally refers to a subset of peripheral blood lymphocytes defined as expressing CD56 or CD16 and lacking the T cell receptor (CD3). In some cases, NK cells are phenotyped as CD3- and CD56+, expressing at least one of NKG2C and CD57 (e.g., NKG2C, CD57, or both expressed to equal or different degrees) and optionally CD16, but lacking expression of one or more of the following: PLZF, SYK, FceRγ, and EAT-2. In some cases, isolated CD56+ NK cell subsets may exhibit expression of CD16, NKG2C, CD57, NKG2D, NCR ligands, NKp30, NKp40, NKp46, activating and repressive KIRs, NKG2A, and / or DNAM-1.
[0087] The term "gene" generally refers to a nucleic acid (e.g., DNA, such as genomic DNA and cDNA) that encodes RNA transcripts and its corresponding nucleotide sequence. For genomic DNA, the term as used herein includes spaced non-coding regions as well as regulatory regions, and may include the 5' and 3' ends. In some uses, the term encompasses the transcribed sequence, including 5' and 3' untranslated regions (5'-UTR and 3'-UTR), exons, and introns. In some genes, the transcribed region contains an "open reading frame" encoding a polypeptide. In some uses of the term, "gene" contains only the coding sequence necessary to encode a polypeptide (e.g., "open reading frame" or "coding region"). In some cases, genes do not encode polypeptides, such as ribosomal RNA genes (rRNA) and transfer RNA (tRNA) genes. In some cases, the term "gene" includes not only the transcribed sequence but also non-transcribed regions, including upstream and downstream regulatory regions, enhancers, and promoters. A gene can refer to an "endogenous gene" or a natural gene located in its native position within an organism's genome. A gene can also refer to an "exogenous gene" or a non-natural gene. Non-natural genes can refer to genes that are not normally found in the host organism but are introduced into the host organism through gene transfer. Non-natural genes can also refer to genes that are not located in their natural position in the genome of an organism. Non-natural genes can also refer to naturally occurring nucleic acid or polypeptide sequences that contain mutations, insertions, and / or deletions (e.g., non-natural sequences).
[0088] The term "expression" generally refers to one or more processes of transcription (e.g., transcription into mRNA or other RNA transcripts) of polynucleotides from a DNA template and / or the subsequent translation of the transcribed mRNA into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides can be collectively referred to as "gene products." If the polynucleotides originate from genomic DNA, expression can include splicing of mRNA in eukaryotic cells. Regarding expression, "upregulation" generally refers to an increase in the expression level of a polynucleotide (e.g., RNA, such as mRNA) and / or polypeptide sequence relative to its expression level in the wild-type state, while "downregulation" generally refers to a decrease in the expression level of a polynucleotide (e.g., RNA, such as mRNA) and / or polypeptide sequence relative to its expression level in the wild-type state. Expression of a transfected gene can occur transiently or stably in the cell. In "transient expression," the transfected gene does not transfer to daughter cells during cell division. Because its expression is limited to the transfected cells, gene expression is lost over time. Conversely, stable expression of a transfected gene can occur when the gene is co-transfected with another gene that confers a selective advantage to the transfected cells. Such a selective advantage could be resistance to a certain toxin presented to the cell.
[0089] The terms “peptide,” “polypeptide,” or “protein,” used interchangeably herein, generally refer to polymers of at least two amino acid residues linked by peptide bonds. This terminology does not imply a specific length of polymer, nor is it intended to suggest or distinguish whether a peptide is produced using recombinant technology, chemical or enzymatic synthesis, or is naturally occurring. These terms apply to naturally occurring amino acid polymers as well as amino acid polymers containing at least one modified amino acid. In some cases, the polymer may be interrupted by non-amino acid chains. These terms include amino acid chains of any length, including full-length proteins, and proteins with or without secondary and / or tertiary structures (e.g., domains). These terms also cover amino acid polymers that have been modified, for example, by disulfide bond formation, glycosylation, esterification, acetylation, phosphorylation, oxidation, and any other manipulation (such as conjugation with a labeled component). As used herein, the terms “amino acid” and “amino acids” generally refer to natural and non-natural amino acids, including, but not limited to, modified amino acids and amino acid analogs. Modified amino acids can include both natural and non-natural amino acids that have been chemically modified to include groups or chemical moieties not naturally present on the amino acid. Amino acid analogs can refer to amino acid derivatives. The term "amino acid" includes both D-amino acids and L-amino acids.
[0090] For peptides, the terms “derivative,” “variant,” or “fragment” as used herein generally refer to peptides that are related to wild-type peptides, for example, by their amino acid sequence, structure (e.g., secondary and / or tertiary), activity (e.g., enzyme activity), and / or function. Compared to wild-type peptides, peptide derivatives, variants, and fragments may contain one or more amino acid changes (e.g., mutations, insertions, and deletions), truncations, modifications, or combinations thereof.
[0091] The term "exogenous gene" refers to a gene introduced into a cell or its progenitor cells through genetic engineering, such as a coding sequence containing a protein of interest that is operatively linked to a heterologous promoter. Exogenous genes used herein may be transiently expressed via viral vectors (such as adeno-associated virus vectors), but in certain embodiments herein, they are stably integrated into the genome of engineered cells. Exogenous genes described herein may be associated with selectable or screenable markers, such as fluorescent markers like blue fluorescent protein (BFP). In some embodiments, induced pluripotent stem cells (iPSCs) are stably transformed with the exogenous gene of interest and selectable or screenable markers and differentiated into hematopoietic cells (e.g., T cells or NK cells) that also express the exogenous gene and can be introduced into a patient as an allogeneic cell therapy.
[0092] As used in this article, “treating” encompasses prevention, relief, symptom improvement, and / or delaying the progression of a disease or condition.
[0093] This disclosure provides a group of induced pluripotent stem cells (iPSCs) and hematopoietic cells derived therefrom, pharmaceutical compositions comprising said cells, and methods of using said cells, wherein said cells are transfected with a gene for selecting to reduce the cytotoxicity of allogeneic immune cells.
[0094] For example, the disclosed hematopoietic cell populations, pharmaceutical compositions, and methods are designed to reduce cannibalism among immune cells engineered to detect, eliminate, and kill diseased cells in subjects in need (e.g., humans, such as those diagnosed with cancer).
[0095] This disclosure describes systems and methods for immunotherapy. The immune cells described herein (e.g., T cells and / or NK cells) can be engineered to exhibit a longer half-life compared to control cells (e.g., unengineered immune cells). Immune cells can be engineered to exhibit stronger proliferative capacity compared to control cells. Immune cells can be engineered to effectively and specifically target diseased cells (e.g., cancer cells, B cells, T cells, or dendritic cells) that control cells cannot achieve or are ineffective at targeting. The engineered immune cells disclosed herein can be engineered ex vivo, in vitro, and, in some cases, in vivo. Engineered immune cells prepared ex vivo or in vitro can be administered to subjects in need to treat diseases (e.g., myeloma, lymphoma, or solid tumors). The engineered immune cells can be autologous to the subject. Alternatively, the engineered immune cells can be allogeneic to the subject.
[0096] We evaluated the effects of gene knock-in and gene knockout on reducing the activation and killing ability of peripheral blood NK cells (PBNK) on engineered cells, and assessed whether these modifications would affect the ability of engineered iPSCs to differentiate into hematopoietic cells (e.g., T cells or NK cells).
[0097] For example, we found that certain transgenes, Clec2d, Nectin-1, CDH1, and CD155, effectively resisted allogeneic PBNK killing, while CD24, CD72, FASL, SERPINB9, VPX, VPU, and NEF did not. Clec2d effectively inhibited allogeneic CBNK / PBNK killing in a dose-dependent manner, and Clec2d did not affect iPSC differentiation into T cells or NK cells. CDH1 effectively inhibited allogeneic PBNK killing; however, high (rather than low) expression of CDH1 in iPSCs affected iPSC differentiation into T or NK cells, indicating that appropriate expression levels are required for the preparation of low-immunogenic iPSC-derived T or NK cells using CDH1. Nectin-1 effectively inhibited allogeneic PBNK killing, and Nectin-1 expression in iPSCs did not affect iPSC differentiation into T or NK cells. We found that CD155 expression effectively inhibited allogeneic CBNK / PBNK cell killing, and that CD155 expression in iPSCs did not affect iPSC differentiation into T or NK cells. Knockout of ULBP2 / 5 / 6 protected double knockout (i.e., knockout of MHC-I and MHC-II SU11) eNK cells from PBNK killing. However, knockout of TGF-β affected iPSC differentiation into T or NK cells.
[0098] Clec2d (also known as lectin-like transcript-1, LLT1, CLEC2D, or OCIL) is a ligand that forms a homodimer on the cell membrane. It interacts with the NK cell receptor NKRP1A (CD161) to transmit an inhibitory signal to NK cells, thereby inhibiting NK cell cytotoxicity and activation. In some embodiments, the extracellular domain region of Clec2d (e.g., amino acids 65-191) is mutated to enhance its interaction with CD161 by stabilizing the Clec2d homodimer through enhanced binding or by replacing amino acids with cysteine residues to form a third disulfide bond; or sequences from non-human species are used to enhance its expression and / or function. For example, Clec2d mutations that enhance interaction with CD161 include mutations at one or more of the following amino acid sites: C163, K16, R175, H176, R180, and K181, such as mutations selected from C163S, K169E, R175E, H176C, R180E, and K181E. Additionally or optionally, the N-terminal transmembrane domain of Clec2d may be replaced with a membrane protein to enhance constitutive expression of Clec2d on the cell membrane; for example, the extracellular domain of Clec2d (e.g., amino acids 65-191) may be fused with the N-terminal transmembrane domain of NKG2 (e.g., NKG2A, NKG2C, or NKG2D) or other type 2 membrane proteins. Additionally or optionally, Clec2d may contain one or more ubiquitination site mutations to enhance the expression level of the Clec2d construct; for example, one or more lysine (K) to arginine (R) mutations (K- to -R mutations). For example, ubiquitination site mutations may include K9R, K94R, K144R, K186R or combinations thereof (e.g., K9 / 94 / 144 / 186R mutations) or consist of K9R, K94R, K144R, K186R or combinations thereof (e.g., K9 / 94 / 144 / 186R mutations).
[0099] We also found that hematopoietic cells (e.g., T cells or NK cells) that retain MHC-I molecule expression but have one or more selected second signaling molecules (e.g., selected from CD48, CD80, CD86, LAF-1, ICAM1, VLA4, VCAM1, CD2, CD58, B7, CD155, and CD122, especially CD58, CD86, and / or ICAM1) exhibit reduced stimulatory effects on CD8+ T cells. Therefore, by simply knocking out these second signaling molecules, we can reduce the immunogenicity of cells.
[0100] Compared to isogenic control cells, the engineered cells of this disclosure exhibit lower immunogenicity and longer half-life after administration to an allogeneic host, thus reducing or eliminating the need for immunosuppressive drugs. For example, the engineered T cells or NK cells derived from engineered iPSCs described herein, after introduction into a patient (or after being challenged by heterologous immune cells in vitro), exhibit a longer half-life compared to control cells (e.g., unengineered isogenic cells) because they are engineered to avoid stimulating heterologous or host CD8+ T cells and NK cells, as well as homologous NK cells.
[0101] In addition to modifications that impart low immunogenicity to the cells, engineered cells may also contain other modifications, such as CAR constructs, to effectively and specifically target diseased cells (e.g., cancer cells, B cells, T cells, DCs) that control cells are ineffective or unable to achieve. For example, engineered cells may contain exogenous genes expressing CAR constructs and / or low-inflammatory antigens or cytokines, such as one or more selected from CD19-CAR, CD16, and IL15 transgenes. For example, engineered cells may be CAR-T cells or CAR-NK cells. The engineered cells disclosed herein can be engineered in vitro, ex vivo, and, in some cases, in vivo. Engineered T cells or engineered NK cells prepared in vitro or ex vivo can be administered to subjects in need to treat diseases (e.g., myeloma or solid tumors).
[0102] Therefore, this disclosure provides low-immunogenic engineered cells (cell 1) [including (i) engineered stem cells, such as induced pluripotent stem cells (iPSCs), and (ii) engineered hematopoietic cells, such as T cells or NK cells (such engineered hematopoietic cells may be progeny of engineered stem cells)], It does not express one or more selected second signaling molecules, resulting in a substantial reduction in the stimulation of hematopoietic cells by heterologous CD8+ T cells [e.g., wherein the second signaling molecule (e.g., one or more selected from CD48, CD80, CD86, LAF-1, ICAM1, VLA4, VCAM1, CD2, CD58, B7, CD155, and CD122) is knocked out in the cell or its progenitor cells]; and / or It expresses one or more genes of one or more NK repressor proteins [e.g., one or more genes of one or more NK repressor proteins (e.g., selected from Clec2d, Nectin-1, CDH1, CD155, and combinations thereof) are transfected into cells or their progenitor cells]; and / or It does not express one or more UL16-binding proteins (ULBP); Among them, iPSCs engineered in the above manner can differentiate into hematopoietic cells; For example, engineered cells with low immunogenicity. a. The engineered cells contain a foreign gene that includes a coding region for an NK repressor protein operatively linked to a heterologous promoter, wherein the NK repressor protein is selected from Clec2d, Nectin-1, CDH1, CD155, and combinations thereof; for example, wherein the NK repressor protein is Clec2d, wherein the extracellular domain of Clec2d is mutated to enhance its interaction with CD161 and / or wherein the N-terminal transmembrane domain of Clec2d is replaced with a membrane protein to enhance constitutive expression of Clec2d on the cell membrane; and / or b. In the engineered cell, one or more genes encoding a second signaling molecule are knocked out or disrupted, such that the one or more genes encoding the second signaling molecule do not express a functional protein, wherein the second signaling molecule is selected from one or more of CD48, CD80, CD86, LAF-1, ICAM1, VLA4, VCAM1, CD2, CD58, B7, CD155, and CD122; and / or c. The genes encoding UL16-binding proteins (ULBP)-2, 5 and 6 are knocked out or disrupted, so that the genes encoding ULBP-2, 5 and 6 do not express functional proteins; iPSCs engineered according to methods (a), (b) and / or (c) can differentiate into hematopoietic cells, such as T cells or NK cells.
[0103] For example, this disclosure provides: 1.1. Cell 1, wherein the engineered cell is an induced pluripotent stem cell (iPSC). 1.2. Cell 1, wherein the engineered cell is derived from induced pluripotent stem cells (iPSCs). 1.3. Cell 1 or 1.2, wherein the engineered cell is a hematopoietic cell. 1.4. Cells 1.3, wherein the engineered cells are hematopoietic stem cells. 1.5. Cells 1.3, wherein the engineered cells are natural killer (NK) cells. 1.6. Cells 1.3, wherein the engineered cells are T cells. 1.7. Cells 1.6, wherein the engineered cells are T cells, wherein the T cells are selected from naive T cells (e.g., CD4+). + αβ and CD8 +αβ8, CTL (Tc cells), Treg (e.g., n T-reg, a T-reg, i T-reg, Tr1, Th3, CD8Treg, NKT cells), memory T cells (e.g., Tcm, Tem, Tpm, TRM, T SCM), dysfunctional T cells, exhausted T cells, Th cells (e.g., Th1, Th2, Th9, Th17, Th22, Tfh). 1.8. Cells 1.6, wherein the engineered cells are T cells, wherein the surface of the T cells has one or more markers selected from CD2, CD4, CD8, NK1.1, FOXP3, CD25, CD28, Foxp3+, CD127, CD152, CXCR3 and CCR4. 1.9. Cells 1.6, wherein the engineered cells are T cells, wherein the T cells secrete one or more cytokines, the cytokines being selected from IFNγ, TNF, IL-2, IL-12, IL-18, IL-4, TGFβ and IL-10. 1.10. Cell 1.6, wherein the engineered cell is a T cell, wherein the nucleus of the T cell contains one or more transcription factors, wherein the transcription factors are selected from EOMES, STAT4, STAT1, FoxP3, and STAT5. 1.11. Cell 1, wherein the engineered cell is a primary cell. 1.12. Cell 1, wherein the engineered cell is derived from a primary cell. 1.13. Any of the aforementioned engineered cells containing a foreign gene that includes a coding region for an NK repressor protein operatively linked to a heterologous promoter, wherein expression of the NK repressor protein reduces the activation of allogeneic NK cells in response to the engineered cells, but does not interfere with the differentiation of iPSCs containing the foreign gene into selected hematopoietic cells, such as T cells or NK cells. 1.14. Engineered cells of cell 1.13, wherein the NK repressor protein is selected from Clec2d, Nectin-1, CDH1, CD155 and combinations thereof. 1.15. Engineered cells of cell 1.13, wherein the NK repressor protein comprises Clec2d. 1.16. Engineered cells of cell 1.13, wherein the NK repressor protein comprises Nectin-1. 1.17. Engineered cells of cell 1.13, wherein the NK repressor protein comprises CDH1. 1.18. Engineered cells of cell 1.13, wherein the NK repressor protein comprises CD155. 1.19. Engineered cells of cell 1.13 containing a foreign gene expressing Clec2d and a foreign gene expressing an NK repressor protein selected from Nectin-1, CDH1 and CD155. 1.20. Any of the aforementioned engineered cells in which the expressed Clec2d contains one or more mutations. 1.21. Any of the aforementioned engineered cells in which the expressed Clec2d contains one or more K-to-R mutations at ubiquitination sites. 1.22. Any of the aforementioned engineered cells in which the expressed Clec2d contains one or more K- to -R mutations at ubiquitination sites, including K9R, K94R, K144R, K186R, K9 / 94R, K9 / 144R, K9 / 186R, K94 / 144R, K94 / 186R, K144 / 186R, K9 / 94 / 144R, K / 9 / 94 / 186R, K9 / 144 / 186R, K94 / 144 / 186R and / or K9 / 94 / 144 / 186R. 1.23. Any of the aforementioned engineered cells in which one or more genes encoding a second signaling molecule are knocked out or destroyed; wherein one or more genes encoding a second signaling molecule are selected from CD48, CD80, CD86, LAF-I, ICAM1, VLA4, VCAM1, CD2, CD58, CD54, B7, CD155 and CD122. 1.24. Any of the aforementioned engineered cells (e.g., wherein one or more genes encoding one or more second signaling molecules are knocked out or disrupted), wherein said cells are hematopoietic cells, such as T cells or NK cells, and wherein said hematopoietic cells exhibit substantially reduced stimulation by heterologous CD8+ T cells; for example, wherein, compared to control cells, such as in in vitro experiments (as described in the embodiments herein), said cells exhibit significantly reduced stimulation by heterologous CD8+ T cells. + T-cell stimulation is reduced by at least 10%, preferably at least 20%, at least 30%, at least 40%, and more preferably at least 50%. 1.25. Any of the aforementioned engineered cells (e.g., wherein one or more genes encoding one or more second signaling molecules are knocked out or disrupted), wherein said cells are primary cells, such as primary T cells or primary NK cells, and wherein said primary cells exhibit substantially reduced responsiveness to stimulation by heterologous CD8+ T cells; for example, wherein said cells show significantly reduced responsiveness to heterologous CD8+ T cells compared to control cells. + T-cell stimulation is reduced by at least 10%, preferably at least 20%, at least 30%, at least 40%, and more preferably at least 50%. 1.26. Any of the aforementioned engineered cells (e.g., wherein one or more genes encoding one or more second signaling molecules are knocked out or disrupted), wherein said cells are derived from primary cells, such as primary T cells or primary NK cells, and wherein said cells derived from primary cells show substantially reduced response to stimulation by heterologous CD8+ T cells; for example, wherein said cells respond significantly less to stimulation by heterologous CD8+ T cells compared to control cells. + T-cell stimulation is reduced by at least 10%, preferably at least 20%, at least 30%, at least 40%, and more preferably at least 50%. 1.27. Any of the aforementioned engineered cells (e.g., wherein one or more genes encoding one or more second signaling molecules are knocked out or disrupted), wherein said cells are induced pluripotent stem cells (iPSCs), and wherein said induced pluripotent stem cells (iPSCs) show substantially reduced stimulation by xenogeneic CD8+ T cells; for example, wherein said cells show significantly reduced stimulation by xenogeneic CD8+ T cells compared to control cells. + T-cell stimulation is reduced by at least 10%, preferably at least 20%, at least 30%, at least 40%, and more preferably at least 50%. 1.28. Any of the aforementioned engineered cells (e.g., wherein one or more genes encoding one or more second signaling molecules are knocked out or disrupted), wherein said cells are derived from induced pluripotent stem cells (iPSCs), such as T cells or NK cells derived from induced pluripotent stem cells (iPSCs), and wherein said cells derived from induced pluripotent stem cells (iPSCs) show substantially reduced response to stimulation by xenogeneic CD8+ T cells; for example, wherein said cells, compared to control cells, show significantly reduced response to xenogeneic CD8+ T cells. + T-cell stimulation is reduced by at least 10%, preferably at least 20%, at least 30%, at least 40%, and more preferably at least 50%. 1.29. Any of the aforementioned engineered cells in which one or more genes encoding one or more second signaling molecules are knocked out or destroyed, wherein the one or more second signaling molecules are selected from one or more of CD86, ICAM1 and CD58. 1.30. Any of the aforementioned engineered cells in which one or more genes encoding one or more second signaling molecules are knocked out or destroyed, wherein the one or more second signaling molecules comprise two or more of CD86, CD58, and ICAM1. 1.31. Any of the aforementioned engineered cells in which one or more genes encoding one or more second signaling molecules are knocked out or destroyed, wherein the one or more second signaling molecules comprise CD86 and CD58. 1.32. Any of the aforementioned engineered cells in which one or more genes encoding one or more second signaling molecules are knocked out or destroyed, wherein the one or more second signaling molecules comprise CD58 and ICAM1. 1.33. Any of the aforementioned engineered cells in which one or more genes encoding one or more second signaling molecules are knocked out or destroyed, wherein the one or more second signaling molecules comprise CD58, CD86, and ICAM1. 1.34. Any of the aforementioned engineered cells in which one or more genes encoding one or more second signaling molecules are knocked out or destroyed, wherein one or more second signaling molecules are knocked out by destroying one or more genes encoding one or more second signaling molecules. 1.35. Any of the aforementioned engineered cells in which one or more genes encoding one or more second signaling molecules are knocked out or disrupted, wherein one or more second signaling molecules are knocked out by CRISPR / Cas9 targeting and disrupting one or more genes encoding one or more second signaling molecules. 1.36. Any of the aforementioned engineered cells in which one or more genes encoding major histocompatibility complex (MHC) class I-related molecules are knocked out, said major histocompatibility complex (MHC) class I-related molecules binding to NKG2D receptors that activate NK cell cytotoxicity, for example in which genes expressing UL16-binding protein (ULBP)-2, 5 and 6 are knocked out. 1.37. Any of the aforementioned engineered cells in which MHC-I and / or MHC-II are absent, for example, in which β-2-microglobulin (B2M) and / or MHC class II transactivator (CIITA) are knocked out. 1.38. Any of the aforementioned engineered cells in which one or more genes expressing one or more UL16-binding protein (ULBP)-2, 5 or 6 are knocked out. 1.39. Any of the aforementioned engineered cells, wherein, compared to control cells, for example in in vitro experiments (as described in the embodiments herein), the stimulation of NKG2A+ and KIR2DL4 cells is reduced by at least 10%, preferably at least 20%, at least 30%, at least 40%, and more preferably at least 50%. 1.40. Any of the aforementioned engineered cells in which β-2-microglobulin (B2M), MHC class II transactivator (CIITA), and UL16-binding protein (ULBP)-2, 5, and 6 are knocked out. 1.41. Any of the aforementioned engineered cells, wherein the cells further comprise one or more transgenes, such as transgenes expressing a chimeric antigen receptor (CAR) construct and / or low-inflammatory antigens or cytokines, such as one or more transgenes selected from CD19-CAR, CD16 and IL15 transgenes. 1.42. Any of the aforementioned engineered cells, wherein the cells are CAR-T cells or CAR-NK cells. 1.43. Any of the aforementioned engineered cells that express human leukocyte antigen (HLA)-E / G. 1.44. Any of the aforementioned engineered cells in which the heterologous promoter is a constitutive promoter, such as selected from the CAG promoter, adenovirus major late promoter, human cytomegalovirus immediate early promoter (hCMV-IE), SV40 and Rous sarcoma virus promoters, mouse 3-phosphoglycerate kinase promoter, translation elongation factor 1α (EF-1α) promoter and human ubiquitin C promoter; for example, the CAG promoter. 1.45. Any of the aforementioned engineered cells, wherein the exogenous gene is stably integrated into the genome of the engineered cell. 1.46. Any of the aforementioned engineered cells, wherein the cells or their progeny persist in circulation for at least 15 days, such as at least 30 days, or at least 60 days after being implanted into a recipient. 1.47. Any of the aforementioned engineered cells in which the recognition and / or activation of allogeneic immune cells (e.g., endogenous T cells or NK cells) is reduced by at least 20%, for example, at least 30%, at least 40%, or at least 50%, relative to syngeneic cells that do not contain one or more transfected genes. 1.48. Any of the aforementioned engineered cells, wherein the cells or their progeny exhibit enhanced resistance to immune rejection (e.g., innate immune rejection) by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, or at least 500%. 1.49. Any of the aforementioned engineered cells, wherein the enhanced resistance to immune rejection (e.g., innate immune rejection) can be determined in vitro in a culture medium containing at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% human complement. 1.50. Any of the aforementioned engineered cells, wherein the cells or their progeny do not exhibit a significant level of cannibalism, for example, due to “loss of self”-induced cytotoxicity. 1.51. Any of the aforementioned engineered cells express normal levels of MHC-I. 1.52. Any of the aforementioned engineered cells express normal levels of transforming growth factor (TGF)-β receptor 2. 1.53. Any of the aforementioned engineered cells that overexpress HLA-E and / or HLA-G, for example, that contains one or more exogenous genes containing coding regions of HLA-E and / or HLA-G operatively linked to a heterologous promoter, for example, that contains an exogenous gene containing a coding region of HLA-E operatively linked to a heterologous promoter, and / or that contains an exogenous gene containing a coding region of HLA-G operatively linked to a heterologous promoter. 1.54. Any of the aforementioned engineered cells, wherein (i) contains a foreign gene that includes a coding region of an NK repressor protein operatively linked to a heterologous promoter, wherein the NK repressor protein is selected from Clec2d, Nectin-1, CDH1, CD155, and combinations thereof, and (ii) does not express one or more genes encoding one or more second signaling molecules that have been knocked out or disrupted, wherein the one or more second signaling molecules are selected from one or more of CD86, ICAM1, and CD58; and / or (iii) does not express UL16-binding proteins (ULBP)-2, 5, and 6. 1.55. Any of the aforementioned engineered cells, wherein (i) contains a foreign gene that includes a coding region of an NK repressor protein operatively linked to a heterologous promoter, wherein the NK repressor protein is selected from Clec2d, Nectin-1, CDH1, CD155, and combinations thereof, and (ii) does not express one or more genes encoding one or more second signaling molecules that have been knocked out or disrupted, wherein the one or more second signaling molecules are selected from one or more of CD86, ICAM1, and CD58; and / or (iii) does not express UL16-binding proteins (ULBP)-2, 5, and 6. 1.56. Any of the aforementioned engineered cells, iPSCs, that (i) contain a foreign gene containing a coding region of an NK repressor protein operatively linked to a heterologous promoter, wherein the NK repressor protein is selected from Clec2d, Nectin-1, CDH1, CD155, and combinations thereof, and (ii) do not express one or more genes encoding one or more second signaling molecules that have been knocked out or disrupted, wherein the one or more second signaling molecules are selected from one or more of CD86, ICAM1, and CD58; and / or (iii) do not express UL16-binding proteins (ULBP)-2, 5, and 6. 1.57. Any of the aforementioned engineered cells, which are NK cells, (i) contain a foreign gene that includes a coding region of an NK repressor protein operatively linked to a heterologous promoter, wherein the NK repressor protein is selected from Clec2d, Nectin-1, CDH1, CD155, and combinations thereof, and (ii) do not express one or more genes encoding one or more second signaling molecules that have been knocked out or disrupted, wherein the one or more second signaling molecules are selected from one or more of CD86, ICAM1, and CD58; and / or (iii) do not express UL16-binding protein (ULBP)-2, 5, and 6; for example, wherein the NK cell is derived from iPSCs within the aforementioned range. 1.58. Any of the aforementioned engineered cells, (i) It contains a foreign gene that includes the coding region of Clec2d operatively linked to a heterologous promoter; (ii) It contains a foreign gene that includes a coding region of HLA-E that is operatively linked to a heterologous promoter; (iii) It contains a foreign gene that includes a coding region of HLA-G operatively linked to a heterologous promoter; (iv) Genes selected from two or more second signaling molecules, namely CD86, ICAM1, and CD58, are knocked out; and (v) Optionally, it does not express UL16-binding proteins (ULBP)-2, 5, and 6. 1.59. The aforementioned engineered cells are iPSCs or T cells derived from said iPSCs. 1.60. The aforementioned engineered cells are iPSCs or NK cells derived from said iPSCs. 1.61. The aforementioned engineered cells are primary cells or T cells derived from the primary cells. 1.62. The aforementioned engineered cells are primary cells or NK cells derived from the primary cells. 1.63. Any of the aforementioned engineered cells, including iPSCs, primary cells, T cells, NK cells, B cells, macrophages, monocytes, cardiomyocytes, islet cells, nerve cells, and endothelial cells; such as iPSCs, and T cells, NK cells, B cells, macrophages, monocytes, cardiomyocytes, islet cells, nerve cells, or endothelial cells derived from said iPSCs or stem cells; such as T cells or NK cells derived from said iPSCs; and primary cells, and T cells, NK cells, B cells, macrophages, monocytes, cardiomyocytes, islet cells, nerve cells, or endothelial cells derived from said primary cells; such as T cells or NK cells derived from said primary cells. 1.64. Any of the aforementioned engineered cells containing a foreign gene comprising a coding region of Clec2d operatively linked to a heterologous promoter, wherein the extracellular domain of Clec2d (e.g., amino acids (AA) 65-191, or amino acids (AA) 160-181) is mutated to enhance its interaction with CD161 [e.g., by enhancing binding or by stabilizing the Clec2d homodimer by substituting amino acids with cysteine residues to form a third disulfide bond, or by using sequences of non-human species to enhance its expression and / or function, e.g., wherein Clec2d includes amino acid positions C163, K16, R175, ...]. Mutations at one or more of H176, R180, and K181, such as one or more mutations selected from C163S, K169E, R175E, H176C, R180E, and K181E]; and / or wherein the N-terminal transmembrane domain of Clec2d is replaced with a membrane protein to enhance constitutive expression of Clec2d on the cell membrane [e.g., wherein the extracellular domain of Clec2d (e.g., amino acids 65-191, or amino acids 160-181) is fused with the N-terminal transmembrane domain of NKG2 (e.g., NKG2A, NKG2C, or NKG2D) or the N-terminal transmembrane domain of another type 2 membrane protein]. 1.65. Any of the aforementioned engineered cells, further comprising any modifications based on cell 2 and its successors or cell 3 and its successors. 1.66. Any of the aforementioned engineered cells used to treat a disease or condition in a patient in need. 1.67. The aforementioned engineered cells, wherein the patient is a human. 1.68. Any of the aforementioned engineered cells, wherein one or more genes knocked in are derived from mammalian genes, such as human, monkey, cow, dog, mouse or rat, preferably human or monkey. 1.69. Any of the aforementioned engineered cells in which the Clec2d gene is replaced by a similar gene within the Clec2d family, such as Clec2b, Clec4a, Clec11a, Clec12a, Clec12b, or Clec14a, such as Clec4a or Clec12a. 1.70. Any of the aforementioned engineered cells present in a pharmaceutical composition comprising the engineered cells, the pharmaceutical composition comprising a pharmaceutically acceptable carrier suitable for administration by injection, such as intravenous, intramuscular, intraperitoneal, intrathecal, or intraosseous injection. 1.71. Any of the aforementioned engineered cells used to treat cancer, for example, including administering a composition containing any of the aforementioned cells to a patient in need. 1.72. Any of the aforementioned engineered cells used to treat cancer, relative to the use of allogeneic cells not selected from the aforementioned one or more engineered cells, results in a reduced level of lymphocyte clearance or immunosuppression required for the treatment. 1.73. Any of the aforementioned engineered cells used to treat cancer, wherein the treatment does not require a lymphocyte clearance step prior to the use of the engineered cells. 1.74. Any of the aforementioned engineered cells used for multiple, on-demand treatment of cancer. 1.75. Any of the aforementioned engineered cells used to treat hematologic cancers or solid tumors (e.g., myeloma or lymphoma), for example, includes the administration of a composition comprising iPSCs, differentiated immune cells (e.g., NK cells, T cells, B cells, NKT cells, macrophages, or monocytes) or differentiated immune cells derived from said iPSCs. 1.76. Any of the aforementioned engineered cells used to treat hematologic cancers or solid tumors (e.g., myeloma or lymphoma), for example, includes the administration of a composition comprising primary cells or immune cells derived from said primary cells (e.g., NK cells, T cells, B cells, NKT cells, macrophages, or monocytes). 1.77. Any of the aforementioned engineered cells used to treat autoimmune diseases, for example, including the administration of a composition comprising iPSCs, differentiated immune cells (e.g., NK cells, T cells, B cells, NKT cells, macrophages, or monocytes) or differentiated immune cells derived from said iPSCs. 1.78. Any of the aforementioned engineered cells used to treat autoimmune diseases, for example, including the administration of a composition comprising primary cells or immune cells derived from said primary cells (e.g., NK cells, T cells, B cells, NKT cells, macrophages, or monocytes). 1.79. Any of the aforementioned engineered cells used to treat diabetes, for example, including the administration of a composition comprising iPSCs, islet cells, or islet cells derived from said iPSCs. 1.80. Any of the aforementioned engineered cells used to treat diabetes, for example, comprising the administration of a composition comprising primary cells, islet cells, or islet cells derived from said primary cells. 1.81. Any of the aforementioned engineered cells used in regenerative medicine treatments, such as cardiomyocyte transplantation for heart injury or failure, islet cell transplantation for diabetes, or neural progenitor cell transplantation for stroke or central nervous system disease / injury, for example, comprising the administration of a composition comprising iPSCs, NK cells, T cells, B cells, macrophages, monocytes, cardiomyocytes, islet cells, nerve cells, neural progenitor cells, endothelial cells, mesenchymal cells, or cells derived from said iPSCs. 1.82. Any of the aforementioned engineered cells used in regenerative medicine treatments, such as cardiomyocyte transplantation for heart injury or failure, islet cell transplantation for diabetes, or neural progenitor cell transplantation for stroke or central nervous system disease / injury, for example, includes the administration of a composition comprising primary cells, NK cells, T cells, B cells, macrophages, monocytes, cardiomyocytes, islet cells, nerve cells, neural progenitor cells, endothelial cells, mesenchymal cells, or cells derived from said primary cells. 1.83. Any of the aforementioned engineered cells used to prepare a drug for treating cancer, such as administering a composition containing any of the aforementioned cells to a patient in need. 1.84. Any of the aforementioned engineered cells used to prepare a drug for treating an autoimmune disease, such as administering a composition containing any of the aforementioned cells to a patient in need. 1.85. Progeny of any of the aforementioned engineered cells. 1.86. A pharmaceutical composition comprising engineered cells according to any of the aforementioned engineered cells, and a pharmaceutically acceptable carrier suitable for injection (e.g., suitable for intravenous infusion), for example, for treating a disease or condition in a human patient, such as for treating cancer or an autoimmune disease.
[0104] For example, in one embodiment, this disclosure provides a low-immunogenic engineered cell (cell 2) containing a foreign gene that includes a coding region for an NK repressor protein operatively linked to a heterologous promoter, wherein expression of the NK repressor protein reduces NK cell response to activation of the engineered cell (e.g., activation of host NK cells or similar NK cells) without interfering with the differentiation of iPSCs containing the foreign gene into selected hematopoietic cells, such as NK cells or T cells, for example, wherein the NK repressor protein is selected from Clec2d, Nectin-1, CDH1, CD155, and combinations thereof.
[0105] For example, this disclosure provides: 2.1. Cell 2, wherein the engineered cell is an induced pluripotent stem cell (iPSC). 2.2. Cell 2, wherein the engineered cell is derived from induced pluripotent stem cells (iPSCs). 2.3. Cell 2 or 2.2, wherein the engineered cell is a hematopoietic cell. 2.4. Cells 2.3, wherein the engineered cells are hematopoietic stem cells. 2.5. Cells 2.3, wherein the engineered cells are natural killer (NK) cells. 2.6. Cells 2.3, wherein the engineered cells are T cells. 2.7. Cell 2, wherein the engineered cell is a primary hematopoietic cell. 2.8. Cell 2, wherein the engineered cell is a primary hematopoietic stem cell. 2.9. Cell 2, wherein the engineered cell is a primary natural killer (NK) cell. 2.10. Cell 2, wherein the engineered cell is a primary T cell. 2.11. Cells 2.6 or 2.10, wherein the engineered cell is a T cell, wherein the T cell is selected from naive T cells (e.g., CD4+). + αβ and CD8 + αβ), CTL (Tc cells), Treg (e.g., n T-reg, a T-reg, i T-reg, Tr1, Th3, CD8 Treg, NKT cells), memory T cells (e.g., Tcm, Tem), dysfunctional T cells, exhausted T cells, Th cells (e.g., Th1, Th2, Th9, Th17, Th22, Tfh). 2.12. Cells 2.6 or 2.10, wherein the engineered cells are T cells, wherein the surface of the T cells has one or more markers selected from CD2, CD4, CD8, NK1.1, FOXP3, CD25, CD28, Foxp3+, CD127, CD152, CXCR3 and CCR4. 2.13. Cells 2.6 or 2.10, wherein the engineered cells are T cells, wherein the T cells secrete one or more cytokines selected from IFNγ, TNF, IL-2, IL-12, IL-18, IL-4, TGFβ and IL-10. 2.14. Cells 2.6 or 2.10, wherein the engineered cells are T cells, wherein the nucleus of the T cells contains one or more transcription factors selected from EOMES, STAT4, STAT1, FoxP3 and STAT5. 2.15. Any of the aforementioned engineered cells, wherein the NK repressor protein is selected from Clec2d, Nectin-1, CDH1, CD155, and combinations thereof. 2.16. Any of the aforementioned engineered cells, wherein the NK repressor protein comprises Clec2d. 2.17. Any of the aforementioned engineered cells, wherein the NK repressor protein comprises Clec2d, wherein the extracellular domain region of Clec2d (e.g., amino acids 65-191) is mutated to enhance its interaction with CD161 [e.g., by enhancing binding or by stabilizing the Clec2d homodimer by substituting amino acids with cysteine residues to form a third disulfide bond, or by using sequences of non-human species to enhance its expression and / or function, e.g., wherein Clec2d is included at amino acid positions C163, K16, R175, H176, R180, and K181]. Mutations at one or more sites, such as one or more mutations selected from C163S, K169E, R175E, H176C, R180E, and K181E]; and / or wherein the N-terminal transmembrane domain of Clec2d is replaced with a membrane protein to enhance constitutive expression of Clec2d on the cell membrane [e.g., wherein the extracellular domain of Clec2d (e.g., amino acids 65-191) is fused with the N-terminal transmembrane domain of NKG2 (e.g., NKG2A, NKG2C, or NKG2D) or the N-terminal transmembrane domain of another type 2 membrane protein]. 2.18. Any of the aforementioned engineered cells, wherein the NK repressor protein comprises Nectin-1. 2.19. Any of the aforementioned engineered cells, wherein the NK repressor protein comprises CDH1. 2.20. Any of the aforementioned engineered cells, wherein the NK repressor protein comprises CD155. 2.21. Any of the aforementioned engineered cells in which one or more genes encoding the second signaling molecule are knocked out or destroyed. 2.22. Any of the aforementioned engineered cells in which one or more genes encoding the second signaling molecule are knocked out or destroyed; wherein the one or more genes encoding the second signaling molecule are selected from CD48, CD80, CD86, LAF-I, ICAM1, VLA4, VCAM1, CD2, CD58, B7, CD155 and CD122. 2.23. Any of the aforementioned engineered cells in which one or more genes encoding major histocompatibility complex (MHC) class I-related molecules are knocked out, said major histocompatibility complex (MHC) class I-related molecules binding to NKG2D receptors that activate NK cell cytotoxicity, for example in which genes expressing UL16-binding protein (ULBP)-2, 5 and 6 are knocked out. 2.24. Any of the aforementioned engineered cells in which MHC-I and / or MHC-II are missing, for example, in which β-2-microglobulin (B2M) and / or MHC class II transactivator (CIITA) are knocked out. 2.25. Any of the aforementioned engineered cells in which β-2-microglobulin (B2M), MHC class II transactivator (CIITA), and UL16-binding protein (ULBP)-2, 5, and 6 are knocked out. 2.26. Any of the aforementioned engineered cells, wherein the cells further comprise one or more transgenes, such as transgenes expressing a chimeric antigen receptor (CAR) construct and / or low-inflammatory antigens or cytokines, such as one or more transgenes selected from CD19-CAR, CD16 and IL15 transgenes. 2.27. Any of the aforementioned engineered cells, wherein the cells are CAR-T cells or CAR-NK cells. 2.28. Any of the aforementioned engineered cells in which the heterologous promoter is a constitutive promoter, such as selected from the CAG promoter, adenovirus major late promoter, human cytomegalovirus immediate early promoter (hCMV-IE), SV40 and Rous sarcoma virus promoters, mouse 3-phosphoglycerate kinase promoter, translation elongation factor 1α (EF-1α) promoter and human ubiquitin C promoter; for example, the CAG promoter. 2.29. Any of the aforementioned engineered cells, wherein the exogenous gene is stably integrated into the genome of the engineered cell. 2.30. Any of the aforementioned engineered cells, wherein the cells or their progeny persist in circulation for at least 15 days, such as at least 30 days, or at least 60 days, after being implanted into a recipient. 2.31. Any of the aforementioned engineered cells in which the recognition and / or activation of allogeneic immune cells (e.g., endogenous T cells or NK cells) is reduced by at least 20%, for example, at least 30%, at least 40%, or at least 50%, relative to syngeneic cells that do not contain one or more transfected genes. 2.32. Any of the aforementioned engineered cells, wherein the cells or their progeny exhibit enhanced resistance to immune rejection (e.g., innate immune rejection) by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, or at least 500%. 2.33. Any of the aforementioned engineered cells, wherein the enhanced resistance to immune rejection (e.g., innate immune rejection) can be determined in vitro in a culture medium containing at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% human complement. 2.34. Any of the aforementioned engineered cells, wherein the cells or their progeny do not exhibit a significant level of cannibalism, for example, due to “loss of self”-induced cytotoxicity. 2.35. Any of the aforementioned engineered cells express normal levels of MHC-I. 2.36. Any of the aforementioned engineered cells, including any modifications based on cell 1 and its successors or cell 3 and its successors. 2.37. Any of the aforementioned engineered cells used to treat a disease or condition in a patient in need. 2.38. The aforementioned engineered cells, wherein the patient is a human. 2.39. Any of the aforementioned engineered cells present in a pharmaceutical composition comprising the engineered cells, the pharmaceutical composition comprising a pharmaceutically acceptable carrier suitable for administration by injection, such as intravenous, intramuscular, intraperitoneal, intrathecal, or intraosseous injection. 2.40. Any of the aforementioned engineered cells used to treat cancer, for example, including administering a composition containing any of the aforementioned cells to a patient in need. 2.41. Any of the aforementioned engineered cells used to treat cancer, relative to the use of allogeneic cells not selected from the aforementioned one or more engineered cells, results in a reduced level of lymphocyte clearance or immunosuppression required for the treatment. 2.42. Any of the aforementioned engineered cells used to treat cancer, wherein the treatment does not require a lymphocyte clearance step prior to the use of the engineered cells. 2.43. Any of the aforementioned engineered cells used for multiple, on-demand treatment of cancer. 2.44. Any of the aforementioned engineered cells used to treat autoimmune diseases, including, for example, administering to a patient in need a composition containing any of the aforementioned cells. 2.45. Any of the aforementioned engineered cells used to treat autoimmune diseases, wherein the level of lymphocyte clearance or immunosuppression required for the treatment is reduced compared to the use of allogeneic cells not selected from the aforementioned one or more engineered cells. 2.46. Any of the aforementioned engineered cells used to treat an autoimmune disease, wherein the treatment does not require a lymphocyte clearance step prior to the use of the engineered cells. 2.47. Any of the aforementioned engineered cells used for multiple, on-demand treatment of autoimmune diseases. 2.48. Any of the aforementioned engineered cells used to prepare a drug for treating cancer or an autoimmune disease, such as administering a composition containing any of the aforementioned cells to a patient in need. 2.49. Progeny of any of the aforementioned engineered cells. 2.50. A pharmaceutical composition comprising engineered cells according to any of the aforementioned engineered cells, and a pharmaceutically acceptable carrier suitable for injection (e.g., suitable for intravenous infusion), for example, for treating a disease or condition in a human patient, such as for treating cancer.
[0106] In another embodiment, this disclosure provides low-immunogenic engineered cells (cell 3), such as engineered stem cells or engineered hematopoietic cells, wherein one or more selected second signaling molecules are knocked out, resulting in a substantial reduction in the stimulation of said engineered cells by heterologous CD8+ T cells (e.g., host CD8+ cells).
[0107] For example, this disclosure provides: 3.1. Cell 3, wherein the engineered cell is an induced pluripotent stem cell (iPSC). 3.2. Cell 3, wherein the engineered cell is derived from induced pluripotent stem cells (iPSCs). 3.3. Cell 3 or 3.2, wherein the engineered cell is a hematopoietic cell. 3.4. Cells 3.3, wherein the engineered cells are hematopoietic stem cells. 3.5. Cells 3.3, wherein the engineered cells are natural killer (NK) cells. 3.6. Cells 3.3, wherein the engineered cells are T cells. 3.7. Cell 3, wherein the engineered cell is a primary hematopoietic cell. 3.8. Cell 3, wherein the engineered cell is a primary hematopoietic stem cell. 3.9. Cell 3, wherein the engineered cell is a primary natural killer (NK) cell. 3.10. Cell 3, wherein the engineered cell is a primary T cell. 3.11. Cells 3.6 or 3.10, wherein the engineered cell is a T cell, wherein the T cell is selected from naive T cells (e.g., CD4+). + αβ and CD8 + αβ), CTL (Tc cells), Treg (e.g., n T-reg, a T-reg, i T-reg, Tr1, Th3, CD8 Treg, NKT cells), memory T cells (e.g., Tcm, Tem), dysfunctional T cells, exhausted T cells, Th cells (e.g., Th1, Th2, Th9, Th17, Th22, Tfh). 3.12. Cells 3.6 or 3.10, wherein the engineered cells are T cells, wherein the surface of the T cells has one or more markers selected from CD2, CD4, CD8, NK1.1, FOXP3, CD25, CD28, Foxp3+, CD127, CD152, CXCR3 and CCR4. 3.13. Cells 3.6 or 3.10, wherein the engineered cells are T cells, wherein the T cells secrete one or more cytokines selected from IFNγ, TNF, IL-2, IL-12, IL-18, IL-4, TGFβ and IL-10. 3.14. Cells 3.6 or 3.10, wherein the engineered cells are T cells, wherein the nucleus of the T cells contains one or more transcription factors selected from EOMES, STAT4, STAT1, FoxP3 and STAT5. 3.15. Any of the aforementioned engineered cells, wherein the engineered cells (or their progeny) remain in circulation for at least 30 days, for example, at least 60 days, after being implanted into a recipient. 3.16. Any of the aforementioned engineered cells, wherein the hematopoietic cells exhibit substantially reduced stimulation of heterologous CD8+ T cells relative to syngeneic cells that have not had the one or more selected second signaling molecules knocked out, by at least 20%, for example at least 30%, or for example at least 50%. 3.17. Any of the aforementioned engineered cells, wherein the cells or their progeny do not exhibit a significant level of cannibalism, for example, due to “loss of self”-induced killing. 3.18. Any of the aforementioned engineered cells express normal levels of MHC-I. 3.19. Any of the aforementioned engineered cells, wherein the one or more second signaling molecules are selected from one or more of CD48, CD80, CD86, LAF-I, ICAM1, VLA4, VCAM1, CD2, CD58, B7, CD155, and CD122. 3.20. Any of the aforementioned engineered cells, wherein the one or more second signaling molecules are selected from at least two of CD48, CD80, CD86, LAF-I, ICAM1, VLA4, VCAM1, CD2, CD58, B7, CD155, and CD122. 3.21. Any of the aforementioned engineered cells, wherein the one or more second signaling molecules are selected from one or more of CD86, ICAM1, and CD58. 3.22. Any of the aforementioned engineered cells, wherein the one or more second signaling molecules comprise two or more of CD86, CD58, and ICAM1. 3.23. Any of the aforementioned engineered cells, wherein the one or more second signaling molecules comprise CD86 and CD58. 3.24. Any of the aforementioned engineered cells, wherein the one or more second signaling molecules comprise CD58 and ICAM1. 3.25. Any of the aforementioned engineered cells, wherein the one or more second signaling molecules comprise CD58, CD86, and ICAM1. 3.26. Any of the aforementioned engineered cells, wherein the one or more second signaling molecules are knocked out by disrupting one or more genes encoding the one or more second signaling molecules. 3.27. Any of the aforementioned engineered cells, wherein the one or more second signaling molecules are knocked out by CRISPR / Cas9 targeting and disrupting one or more genes encoding the one or more second signaling molecules. 3.28. Any of the aforementioned engineered cells, wherein the cells further comprise one or more transgenes, such as transgenes expressing CAR constructs and / or low-inflammatory antigens or cytokines, such as one or more transgenes selected from CD19-CAR, CD16 and IL15 transgenes. 3.29. Any of the aforementioned engineered cells, wherein the cells are CAR-T cells or CAR-NK cells. 3.30. Any of the aforementioned engineered cells, wherein, compared to control cells, for example in in vitro experiments (as described in the embodiments herein), the cells exhibit at least a 10% reduction in stimulation of heterologous CD8+ T cells, preferably at least 20%, at least 30%, at least 40%, and more preferably at least 50%. 3.31. Any of the aforementioned engineered cells, and a method of using them to treat cancer, the method comprising administering to a patient in need a composition containing any of the aforementioned cells. 3.32. A method of using any of the aforementioned engineered cells to treat an autoimmune disease, the method comprising administering a composition containing any of the aforementioned cells to a patient in need. 3.33. Any of the aforementioned engineered cells, including any modifications based on cell 1 and its successors or cell 2 and its successors. 3.34. Any of the aforementioned engineered cells used to treat a disease or condition in a patient in need. 3.35. The aforementioned engineered cells, wherein the patient is a human. 3.36. Any of the aforementioned engineered cells present in a pharmaceutical composition comprising the engineered cells, the pharmaceutical composition comprising a pharmaceutically acceptable carrier suitable for administration by injection, such as intravenous, intramuscular, intraperitoneal, intrathecal, or intraosseous injection. 3.37. Any of the aforementioned engineered cells used to treat cancer, for example, including administering a composition containing any of the aforementioned cells to a patient in need. 37.1. Any of the aforementioned engineered cells used to treat cancer, wherein the level of lymphocyte clearance or immunosuppression required for the treatment is reduced compared to the use of allogeneic cells not selected from the aforementioned one or more engineered cells. 3.38. Any of the aforementioned engineered cells used for multiple, on-demand treatment of cancer. 3.39. Any of the aforementioned engineered cells used to prepare a drug for treating cancer, such as by administering a composition containing any of the aforementioned cells to a patient in need. 3.40. Any of the aforementioned engineered cells used to treat autoimmune diseases, including, for example, administering to a patient in need a composition containing any of the aforementioned cells. 40.1. Any of the aforementioned engineered cells used to treat autoimmune diseases, wherein the level of lymphocyte clearance or immunosuppression required for the treatment is reduced compared to the use of allogeneic cells not selected from the aforementioned one or more engineered cells. 40.2. Any of the aforementioned engineered cells used to treat an autoimmune disease, wherein the treatment does not require a lymphocyte clearance step prior to the use of the engineered cells. 3.41. Any of the aforementioned engineered cells used for multiple, on-demand treatment of autoimmune diseases. 3.42. Any of the aforementioned engineered cells used to prepare a drug for treating an autoimmune disease, such as administering a composition containing any of the aforementioned cells to a patient in need. 3.43. Progeny of any of the aforementioned engineered cells. 3.44. A pharmaceutical composition comprising engineered cells according to any of the aforementioned engineered cells, and a pharmaceutically acceptable carrier suitable for injection (e.g., suitable for intravenous infusion), for example, for treating a disease or condition in a human patient, such as for treating cancer or an autoimmune disease.
[0108] This disclosure also provides a pharmaceutical composition comprising a low-immunogenic engineered cell according to any one of cell 1 and subsequent items, or cell 2 and subsequent items, or cell 3 and subsequent items, and a pharmaceutically acceptable carrier suitable for injection (e.g., suitable for intravenous infusion). For example, a pharmaceutically acceptable carrier suitable for intravenous infusion could be an isotonic saline solution, such as 0.9% w / v saline solution, lactated Ringer's solution, or an isotonic solution formulated for cell culture or cell therapy, such as an isotonic solution containing physiologically acceptable levels of sodium chloride, glucose, electrolytes, albumin, and optionally a cryoprotectant [e.g., an isotonic solution containing 31.25% (v / v) Plasma-Lyte A, 31.25% (v / v) 5% glucose / 0.45% sodium chloride, 10% Dextran 40 (LMD) / 5% glucose, 20% (v / v) 25% human serum albumin (HSA), and 7.5% (v / v) Cryoserv® dimethyl sulfoxide (DMSO)]. In some embodiments, the pharmaceutical composition is frozen during storage and thawed before administration to the patient. The engineered cells according to any one of Cell 1 and its subsequent items include, for example, engineered cells that are allogeneic relative to the patient and that the cells or their progeny survive in circulation for at least 15 days (e.g., at least 30 days, e.g., at least 60 days) after being implanted into the recipient; for example, the cell population comprises T cells or NK cells, wherein one or more genes transferred into the cells comprise Clec2d, Nectin-1, CDH1, CD155 or combinations thereof; and / or wherein genes expressing UL16-binding protein (ULBP)-2, 5 and 6 are knocked out; and / or wherein one or more second signaling molecules are knocked out, the second signaling molecules being selected from one or more of CD86, ICAM1 and CD58.
[0109] In another embodiment, this disclosure provides T cells and T cells derived from iPSCs or primary cells, wherein one or more genes are transfected into said cells to reduce the recognition and activation of allogeneic immune cells, for example, to substantially reduce the stimulation of heterologous CD8+ T cells by T cells or T cells derived from iPSCs or primary cells.
[0110] In another embodiment, this disclosure provides NK cells and NK cells derived from iPSCs or primary cells, wherein one or more genes are transfected into said cells to reduce the recognition and activation of allogeneic immune cells, for example, to substantially reduce the stimulation of said NK cells or NK cells derived from iPSCs or primary cells on heterologous CD8+ T cells.
[0111] In another embodiment, this disclosure provides iPSCs and hematopoietic cells derived therefrom, wherein one or more genes are transfected into the cells to reduce the recognition and activation of allogeneic immune cells, for example, to substantially reduce the stimulation of heterologous CD8+ T cells by the iPSCs or their progeny, for example, wherein the progeny of the iPSCs comprises engineered cells according to any one of cell 1 and its successor, or cell 2 and its successor, or cell 3 and its successor.
[0112] In another embodiment, this disclosure provides a method of treating cancer comprising administering to a patient in need engineered cells according to any one of cell 1 and its successors, or cell 2 and its successors, or cell 3 and its successors, or a pharmaceutical composition comprising engineered cells according to any one of cell 1 and its successors, or cell 2 and its successors, or cell 3 and its successors, for example, wherein the cells are allogeneic relative to the patient, and wherein the patient’s endogenous NK cells or CD8+ T cells are not substantially stimulated by the administration; for example, wherein the cells or their progeny persist in circulation for at least 15 days, for example, at least 30 days, for example, at least 60 days after being implanted into the recipient; for example, wherein the cell population comprises T cells and / or NK cells, wherein one or more genes transferred into the cells comprise Clec2d, Nectin-1, CDH1, CD155 or combinations thereof; and / or wherein one or more second signaling molecules comprising one or more of CD86, ICAM1 and CD58 are knocked out, and / or wherein genes expressing UL16-binding protein (ULBP)-2, 5 and 6 are knocked out.
[0113] In another embodiment, this disclosure provides a method of treating an autoimmune disease, comprising administering to a patient in need engineered cells according to any one of cell 1 and its successors, or cell 2 and its successors, or cell 3 and its successors, or a pharmaceutical composition comprising engineered cells according to any one of cell 1 and its successors, or cell 2 and its successors, or cell 3 and its successors, for example, wherein the cells are allogeneic relative to the patient, and wherein the patient’s endogenous NK cells or CD8+ T cells are not substantially stimulated by the administration; for example, wherein the cells or their progeny persist in circulation for at least 15 days, for example, at least 30 days, for example, at least 60 days after being implanted into the recipient; for example, wherein the cell population comprises T cells and / or NK cells, wherein one or more genes transferred into the cells comprise Clec2d, Nectin-1, CDH1, CD155 or combinations thereof; and / or wherein one or more second signaling molecules comprising one or more of CD86, ICAM1 and CD58 are knocked out, and / or wherein genes expressing UL16-binding protein (ULBP)-2, 5 and 6 are knocked out.
[0114] In another embodiment, this disclosure provides a method for preparing hematopoietic cells, wherein (i) one or more genes are transferred into the cells and / or (ii) one or more genes are knocked out, such that innate immune rejection (e.g., NK cell activation or CD8+ T cell stimulation) is substantially reduced, the method comprising culturing the engineered induced pluripotent stem cells (iPSCs) (e.g., iPSCs according to cell 1.1, cell 2.1, or cell 3.1) into engineered hematopoietic cells, the engineered hematopoietic cells being, for example, engineered cells according to any one of cell 1, or cell 1.2 and subsequent, or cell 2, or cell 2.2 and subsequent, or cell 3, or cell 3.2 and subsequent; for example, wherein one or more genes transferred into the cells include Clec2d, Nect In-1, CDH1, CD155 or combinations thereof; and / or one or more second signaling molecules comprising one or more of CD86, ICAM1 and CD58 are knocked out, and / or genes expressing UL16-binding protein (ULBP)-2, 5 and 6 are knocked out; for example, wherein the hematopoietic cell is a T cell, and the condition for inducing iPSC differentiation into a hematopoietic cell is the condition for further inducing its differentiation into a T cell; or wherein the hematopoietic cell is an NK cell, and the condition for inducing iPSC differentiation into a hematopoietic cell is the condition for further inducing its differentiation into an NK cell. Example Example 1: Cells expressing NK repressors
[0115] Candidate NK inhibitory ligands were evaluated by transforming K562 cells with the candidate ligands and assessing their resistance to umbilical cord blood NK cells and peripheral blood NK cells (CBNK / PBNK). The following single genes were overexpressed in K562 cells via electroporation (using the CAG promoter to drive the gene of interest, with BFP as an optional marker under the control of the hEF1A promoter): Clec2d, Nectin-1, CDH1, CD155, CD24, CD72, FASL, SERPINB9, VPX, VPU, and NEF. After purification by flow cytometry, resistance to PBNK was measured in the following cells: (i) K562 cells overexpressing a single gene, (ii) wild-type K562 cells not overexpressing any transgene (negative control), and (iii) K562 cells overexpressing HLA-E (positive control). Results are summarized in Figure 1 .
[0116] Single gene knock-in screening in K562 cells showed that Clec2d, Nectin-1, CDH1, and CD155 effectively resisted allogeneic PBNK killing, while CD24, CD72, FASL, SERPINB9, VPX, VPU, and NEF did not.
[0117] Clec2d Clec2d is a homologous ligand of the inhibitory NK receptor (NKR)-P1B and NKR-P1D (CD161b / d). To test whether Clec2d can inhibit NK cell killing, Clec2d was delivered to K562 cells along with the BFP reporter gene, and transgene expression was analyzed by flow cytometry. Figure 2 Gene constructs inserted into K562 cells are shown for overexpressing the Clec2d gene under the control of the CAG promoter and the blue fluorescent protein (BFP) reporter gene under the control of the human elongation factor-1α (hEF1a) promoter, with the two genes separated by a chromatin insulator (A2CBX). Figure 3 The figure above shows the histogram results of flow cytometry, indicating that the Clec2d / BFP construct inserted into K562 cells was successfully overexpressed; Figure 3 The figure below shows the relative expression levels of the Clec2d / BFP gene from different mammalian species. Figure 4 The relative expression levels of human Clec2d / BFP constructs containing K-to-R mutations at various ubiquitination sites are shown. Figure 5 The results of CD107a degranulation assays of human cord blood natural killer (CBNK) cells and human PBNK cells exposed to engineered K562 / Clec2d cells are presented. Unmodified K562 cells (K562) were used as a negative control, expected to activate degranulation of allogeneic NK cells. HLA-E overexpressing K562 cells (K562 / HLAE) were used as a positive control, representing current state-of-the-art technology for reducing sensitivity to allogeneic NK cells. The presence (+) or absence (-) of NKG2A indicates whether CBNK / PBNK cells have the ability to bind to HLA-E molecules. Figure 6 The results of cytotoxicity studies are presented, in which CBNK and PBNK cells were exposed to unmodified K562 cells (K562), HLA-E-overexpressing K562 cells (K562 / HLAE), and engineered K562 / Clec2d cells. The E:T ratio represents the proportion of effector cells (i.e., CBNK / PBNK) relative to target cells (i.e., K562 cells). Figure 7This study demonstrated a dose-dependent effect of inhibiting the cytotoxicity of CBNK / PBNK cells against engineered K562 / Clec2d cells, in which a human Clec2d construct was transfected into K562 cells overexpressing HLA-E / G and conferred protection against human allogeneic NK cells based on the expression level of Clec2d. Figure 8 This further demonstrates the protective effect provided by Clec2d expression, in which human Clec2d expression in 2KO NK cells (i.e., MHC-I and MHC-II knockout SU11 cells) reduces the cytotoxicity of allogeneic human PBNK cells. Figure 9 A parallel example is provided in which monkey Clec2d in K562 cells reduces the cytotoxicity of monkey NK cells.
[0118] Engineered K562 cells are not capable of killing cancer cells, so in our therapeutic products we use engineered NK cells, which are products of engineered iPSC differentiation (iPSC-NK cells). Figure 10 The results demonstrate that induced pluripotent stem cells (iPSCs) successfully differentiated into embryoid bodies (EBs) after engineered overexpression of Clec2d.
[0119] CDH1 To test whether CDH1 could inhibit NK cell killing, CDH1 was delivered to K562 cells along with the BFP reporter gene, and transgene expression was analyzed by flow cytometry. Figure 11 A gene construct inserted into K562 cells to overexpress the CDH1 gene and the BFP reporter gene is shown. Figure 12 The flow cytometry histogram results show that the CDH1 / BFP construct inserted into K562 cells was successfully overexpressed. Figure 13 The results of CD107a degranulation assays in CBNK and PBNK cells exposed to engineered K562 / CDH1 cells are presented. K562 was used as a negative control, and K562 / HLAE as a positive control. Figure 14 The results of cytotoxicity studies are presented, in which CBNK and PBNK cells were exposed to unmodified K562 cells (K562), HLA-E-overexpressing K562 cells (K562 / HLAE), and engineered K562 / CDH1 cells. The E:T ratio represents the proportion of effector cells (i.e., CBNK / PBNK) relative to target cells (i.e., K562 cells). Figure 15 The study demonstrated the effect of inhibiting the cytotoxicity of CBNK / PBNK cells on engineered K562 / CDH1 cells, in which the CDH1 construct was transfected into K562 cells overexpressing HLA-E / G. Figure 16 We present dose-dependent results of iPSC differentiation into EB after engineered overexpression of CDH1. Figure 33 This study demonstrates the effect of single transgene insertion of the CDH1 construct into ANB iPSCs on their ability to differentiate into EBs. Low expression levels of CDH1 in iPSCs (L4 / L6) allow them to differentiate normally into EBs; however, moderate (M4 / M9) and high (H3 / H5) expression levels of CDH1 interfere with typical EB formation.
[0120] Nectin-1 : Figure 17 A gene construct inserted into K562 cells to overexpress the Nectin-1 (NECTIN1) gene and the BFP reporter gene is shown. Figure 18 The flow cytometry histogram results show that the Nectin-1 / BFP construct inserted into K562 cells was successfully overexpressed. Figure 19 The results of CD107a degranulation assays in CBNK and PBNK cells exposed to engineered K562 / NECTIN1 cells are presented. K562 was used as a negative control, and K562 / HLAE as a positive control. Figure 20 The results of cytotoxicity studies are presented, in which CBNK and PBNK cells were exposed to unmodified K562 cells (K562), HLA-E-overexpressing K562 cells (K562 / HLAE), and engineered K562 / NECTIN1 cells. The E:T ratio represents the proportion of effector cells (i.e., CBNK / PBNK) relative to target cells (i.e., K562 cells). Figure 21 The study demonstrated the effect of inhibiting the cytotoxicity of CBNK / PBNK cells on engineered K562 / NECTIN1 cells, in which the Nectin-1 construct was transfected into K562 cells overexpressing HLA-E / G. Figure 22 The results show that iPSCs successfully differentiated into EBs after engineered overexpression of Nectin-1.
[0121] CD155 : Figure 23 A gene construct inserted into K562 cells to overexpress the CD155 gene and the BFP reporter gene is shown. Figure 24 The flow cytometry histogram results show that the CD155 / BFP construct inserted into K562 cells was successfully overexpressed. Figure 25 The results of CD107a degranulation assays in CBNK and PBNK cells exposed to engineered K562 / CD155 cells are presented. K562 was used as a negative control, and K562 / HLAE as a positive control. Figure 26The results of cytotoxicity studies are presented, in which CBNK and PBNK cells were exposed to unmodified K562 cells (K562), HLA-E-overexpressing K562 cells (K562 / HLAE), and engineered K562 / CD155 cells. The E:T ratio represents the proportion of effector cells (i.e., CBNK / PBNK) relative to target cells (i.e., K562 cells). Figure 27 We demonstrated a dose-dependent effect of inhibiting the cytotoxicity of CBNK / PBNK cells against engineered K562 / CD155 cells, in which the CD155 construct was transfected into K562 cells overexpressing HLA-E / G, and found that lower levels of CD155 expression conferred stronger protection against activation of allogeneic NK cells. Figure 28 This further demonstrates the protective effect provided by CD155 expression, in which expression of human CD155 in 2KO NK cells (i.e., MHC-I and MHC-II knockout SU11 cells) reduces the cytotoxicity of allogeneic human PBNK cells. Figure 29 The results show that iPSCs successfully differentiated into EBs after engineered overexpression of CD155.
[0122] Overall efficacy in inhibiting cytotoxicity : Figure 32 This study demonstrates the comparative efficacy of specific gene transfections and their inhibition of PBNK cell cytotoxicity against K562 / HLAE / G cells. Transduction was performed using lentiviral vectors at a multiplicity of infection (MOI, i.e., the ratio of viral particles to host cells in a given infection medium) of 10 or 30. In descending order of efficacy, the selected genes most effective in conferring protection to K562 / HLAE / G cells were: Clec2d-30 > Nectin-1-10 > CDH1-30 > CD155-10 > Clec2d-10 > CD155-30 > CD24-10, where 10 or 30 refers to the MOI of the transduction. Example 2: Knockout
[0123] Selected genes were knocked out using the CRISPR-Cas9 system. These gene knockouts can also be combined with one or more gene knock-ins from the previous embodiment to provide optimal efficacy in avoiding PBNK stimulation.
[0124] Figure 30 The results demonstrate the simultaneous knockout of UL16-binding proteins (ULBP)-2, 5, and -6 using single-direction guide RNA (sgRNA). These proteins encode major histocompatibility complex (MHC) class I-related molecules that bind to the NKG2D receptor, which activates cytotoxicity in NK cells. The sgRNA construct used for this purpose is as follows: SEQ ID NO 1: GCACAGAAGGAUCUUGGUAG SEQ ID NO 2: GUGGUCCAGGUCUGAACUUA SEQ ID NO 3: AGUUCAGACCUGGACCACGG SEQ ID NO 4: CCUUGAACCGCACACCACCG SEQ ID NO 5: ACCUGGACCACGGUGGGUG
[0125] SU11 cells are double-knockout endometrial NK cells, lacking β-2-microglobulin (B2M, a component of MHC class I molecules) and MHC class II transactivator (CIITA). Therefore, the absence of MHC-I and MHC-II in SU11 cells makes them vulnerable to NK cell "loss of self" induced killing. ULBP2 / 5 / 6 knockout in SU11 cells protects them from the cytotoxic effects of CBNK and PBNK. (A) shows the insertion / deletion frequency analysis. (B) shows the flow cytometry histogram results for ULBP2 / 5 / 6 knockout. (C) shows the cytotoxicity of PBNK cells. (D) shows the cytotoxicity of CBNK cells. Figure 31 The results of CD107a degranulation assays in CBNK and PBNK cells exposed to ULBP2 / 5 / 6 knockout engineered SU11 cells are presented.
[0126] Figure 34 The flow cytometry histogram results show the successful knockout of transforming growth factor (TGF)-β receptor 2 in K562 cells, suggesting that genetic engineering may inhibit iPSC differentiation. Example 2: Knockout of cells by second signaling molecules
[0127] eNK cells were derived from iPSCs and cultured in NK medium containing: 95% serum-free lymphocyte medium KBM 581 (Corning, catalog #88581CM), 5% human AB serum (Access Bio, catalog #515), 1x non-essential amino acid solution (Gibco, catalog #11140050), 2 mM L-glutamine (Gibco, catalog #25030081), and 200 IU / ml IL2 (R&D, catalog #202-GMP). The CD86, ICAM1, and CD58 genes in eNK cells were knocked out using the CRISPR / Cas9 system. CRISPR / Cas9 consists of two components: Cas9 and sgRNA. Cas9 protein was purchased from Thermo Fisher Scientific (catalog #A36499), and sgRNA was synthesized by Genescript Biotech Corp. The Cas9 protein and sgRNA were mixed to form a ribonucleoprotein complex (RNP), which was then delivered to eNK cells using the Lonza system. The sgRNA was selected from the following sequences:
[0128] Flow cytometry analysis on day 7 after electroporation showed that these genes were effectively knocked out at the protein level. The highest efficiencies were observed for hCD86-sg3, ICAM1-sg1, and hCD58-sg3, reaching 85.95%, 88.93%, and 90.32%, respectively. See also Figure 35 The results show that using the CRISPR-Cas9 construct can effectively knock out CD86, ICAM1, and CD58.
[0129] We mixed eNK cells with specific gene knockouts with a GFP-labeled cancer cell line (Raji) at a ratio of 0.3:1, and continuously monitored GFP signaling using Incucyte. We found that these edited eNK cells exhibited comparable killing ability against Raji cells to wild-type (WT) eNK cells, indicating that gene knockout does not affect the tumor-killing ability of eNK cells. See also Figure 36 The results showed that knocking out CD86, ICAM1, or CD58 did not affect the ability of eNK cells to kill cancer cells.
[0130] After knocking out the ICAM1 / CD86 / CD58 genes, we examined MHC-I expression in these eNK cells and found that MHC-I expression was unaffected. MHC-I is a key inhibitory ligand for NK cells, and its presence protects eNK cells from attack by allogeneic NK cells in the patient's body. See also Figure 37 The results showed that CD58 / CD86 / ICAM1 knockout did not affect the expression of MHC-I in eNK cells.
[0131] The stimulatory effect of edited eNK cells on T cells was evaluated using a T cell proliferation assay. Specifically, frozen human PBMCs (purchased from SAILY Bio, Shanghai, China) were thawed, labeled with Cell Trace Dye carboxyfluorescein succinimide (CFSE, purchased from Thermo Fisher Scientific, catalog number #C34554), and co-cultured with designated eNK cells in NK medium containing 20 IU / ml IL-2 (instead of 200 IU / ml) for 6 days, with the medium changed every other day. On day 6, the percentage of CFSE-negative proliferative CD3+CD8+ T cells was measured by flow cytometry. Knockout of the ICAM1 / CD86 / CD58 genes resulted in significantly lower stimulation of CD8+ T cells by NK cells compared to the WT and SH sg1 groups (sgRNAs targeting safe harbors, without knocking out any functional proteins). The effect of CD58 knockout was comparable to that of B2M knockout (MHC-I stimulates CD8+ T cells by binding to TCRs on CD8+ T cells. B2M is a component of MHC-I; B2M knockout leads to MHC-I deficiency, thus avoiding stimulation of CD8+ T cells). See also Figure 38 The results showed that CD58, CD86 and ICAM1 knockout significantly reduced stimulation of CD8+ cells.
[0132] Different combinations of ICAM1, CD86, and CD58 knockout were tested. Figure 39 As shown, triple knockout of CD58 / CD86 / ICAM1 significantly reduced the stimulation of CD8+ T cells, while double knockout of CD58+CD86 had the lowest stimulation of CD8+ T cells. Example 3: Second signal knockout in transgenic cells
[0133] In QN-019 eNK cells (containing CD19-CAR, CD16, and IL15 transgenes), we tested and found that ICAM1 / CD86 / CD58 knockout reduced eNK cell stimulation of CD8+ T cells, indicating that knocking out these second signaling molecules does indeed reduce the immunogenicity of another eNK cell line. See also Figure 40 . Example 4: NK Repression Construct Sequence
[0134] This study identified Clec2d, CDH1, Nectin1, and CD155 as NK cell repressor genes, and found that constructs expressing or containing all or part of these genes can confer protection against NK cell-related cytotoxicity to engineered cells expressing these genes / constructs. Table 1 describes exemplary sequences of constructs containing NK cell repressor gene sequences derived from different mammalian species. Table 1. Sequences of NK repressor constructs Example 5: Clec2d expression in 293 T
[0135] Clec2d gene, such as Figure 41 The mutations were performed as shown, specifically H176C and C163S. Then, 293T cells were transiently transfected with Lipofectamine-3000, and FACS analysis was performed 48 hours post-transfection. Results are as follows... Figure 41 As shown.
[0136] like Figure 41 As shown, compared with the WT group, the cysteine mutation caused the disappearance of Clec2d expression. Example 6: Expression of CLEC family members in 293 T
[0137] Will Figure 42 The gene construct shown was transiently transfected into 293T cells using Lipofectamine-3000, with each group repeated twice. Results are as follows: Figure 43 As shown.
[0138] like Figure 43 As shown, CLEC family members were successfully expressed in 293T cells. Example 7: Screening of Clec2d nucleic acid constructs
[0139] Will Figure 44 The gene construct shown was transiently transfected into 293T cells using Lipofectamine-3000. Results are as follows: Figures 45-46 As shown.
[0140] like Figure 45 and Figure 46 As shown, engineered Clec2d was successfully expressed in 293T cells. Example 8: Preparation of Double Knockout (2KO) CAR-T and PBNK Kill Test
[0141] NHP PBMCs were isolated from the peripheral blood of adult cynomolgus monkeys using a standard protocol with FicollPaque PLUS (GE Healthcare Bio-Sciences). Total T cells were isolated from the PBMCs using the NHP pan-T cell isolation kit according to the manufacturer's instructions (Miltenyi Biotec; catalog number #130-091-993). Polyclonal T cells were synthesized using NHP anti-CD2 / anti-CD3 / anti-CD28 stimulated magnetic beads (bead-to-T cell ratio 1:2) (Miltenyi Biotec, catalog number #130-092-919) supplemented with 10% AB serum (Access Biologicals) and recombinant human IL-2 (rhIL-2, 200 U / mL; R&D Systems). TM OpTmizer TM T-cells were activated in serum-free medium (SFM) (ThermoFisher Scientific, catalog number #A1048501). Lentiviral transduction was performed on day 1 or 2 using lentiboost (SIRION Biotech, catalog number #SB-P-LV-101-01) and χHIV-Clec2d, χHIV-CD20 CAR lentiviruses (MOI range: 5-20) via spinoculation. Gene knockout was performed using an RNP containing synthetic sgRNA (synthesized by Genescript) and Cas9 protein (ThermoFisher Scientific, catalog number #A36499).
[0142] NHP PBNK preparation: NHP PBMCs were isolated from the peripheral blood of adult cynomolgus monkeys using a standard protocol with FicollPaque PLUS (GE Healthcare Bio-Sciences). NHP PBNKs were sorted from the PBMCs using CD3-NKG2A+ labeling. PBNKs were further separated into CD161 PBMCs using FACS. - / + Subgroup.
[0143] like Figure 47 As shown, NHP Clec2d can protect 2KO CAR-T cells from NHP CD161. +PBNK killing effect. A. Clec2d was successfully overexpressed at different levels in NHP CAR-T cells (Clec2d-L: low Clec2d expression; Clec2d-H: high Clec2d expression); B. The expression of the Clec2d receptor CD161 varied in NHP donors, ranging from 20% to 90%; C. NHPClec2d can protect 2KO CAR-T cells from NHP CD161. + PBNK lethality; D. NHP Clec2d cannot protect 2KO CAR-T from NHP CD161-PBNK lethality. Example 9: Expression of HLA-E-2A-Clec2d in human T cells
[0144] Gene expression in human T cells: Human PBMCs were isolated from adult peripheral blood using a standard protocol with FicollPaque PLUS (GE Healthcare Bio-Sciences). Total T cells were isolated from PBMCs using a human pan-T cell isolation kit according to the manufacturer's instructions (Miltenyi Biotec; catalog number #130-096-535). Polyclonal T cells were generated using human T cell transactin... TM The stimulant (Miltenyi Biotec, catalog number #130-111-160) was administered to CTS supplemented with 10% AB serum (AccessBiologicals) and recombinant human IL-2 (rhIL-2, 100 U / mL; R&D Systems). TM OpTmizer TM T cells were activated in serum-free culture medium (ThermoFisher Scientific, catalog number #A1048501). Lentiviral transduction was performed on day 1 or 2 using polybrene (Sigma, catalog number #TR-1003-G) and HIV-HLA-E-2A-Clec2d lentivirus (MOI range: 5-100) via centrifugation infection. Expression was detected by FACS using the corresponding antibody.
[0145] Figure 48 The expression of HLA-E and CLEC2D under different MOIs is shown. Example 10: Clec2d expression under different promoters and MOIs
[0146] Gene expression in human T cells: Human PBMCs were isolated from adult peripheral blood using a standard protocol with FicollPaque PLUS (GE Healthcare Bio-Sciences). Total T cells were isolated from PBMCs using a human pan-T cell isolation kit according to the manufacturer's instructions (Miltenyi Biotec; catalog number #130-096-535). Polyclonal T cells were generated using human T cell transactin... TM The stimulant (Miltenyi Biotec, catalog number #130-111-160) was administered to CTS supplemented with 10% AB serum (AccessBiologicals) and recombinant human IL-2 (rhIL-2, 100 U / mL; R&D Systems). TM OpTmizer TM T cells were activated in serum-free medium (ThermoFisher Scientific, catalog number #A1048501) for T cell expansion. Lentiviral transduction was performed on day 1 or 2 using polybrene (Sigma, catalog number #TR-1003-G) and HIV-Clec2d lentivirus (MOI range: 5-20) carrying different promoters (CAG vs EF1a). Expression was detected by FACS using the corresponding antibodies.
[0147] Figure 49 The effects of promoter and MOI on Clec2d expression are shown. Figure 49 As shown, compared with the control group, Clec2d expression was increased in human donor T cells, and the expression level of Clec2d was the highest when the promoter was EF1a and MOI=5. Table 2. Promoter Sequences Table 3. Protein / peptide sequences
Claims
1. Low immunogenic engineered cells, a. It does not express one or more selected second signaling molecules, resulting in a substantial reduction in the stimulation of the engineered cells by heterologous CD8+ T cells; and / or b. One or more genes that express one or more NK repressors; and / or c. It does not express one or more UL16-binding proteins (ULBP); The engineered cells mentioned above are iPSCs that have been engineered to differentiate into hematopoietic cells; or, The engineered cells are primary cells.
2. The engineered cell according to claim 1, a. The engineered cells contain a foreign gene that includes a coding region for an NK repressor protein operatively linked to a heterologous promoter, wherein the NK repressor protein is selected from Clec2d, Nectin-1, CDH1, CD155, and combinations thereof; and / or b. In the engineered cell, one or more genes encoding a second signaling molecule are knocked out or disrupted, such that the one or more genes encoding the second signaling molecule do not express a functional protein, wherein the second signaling molecule is selected from one or more of CD48, CD80, CD86, LAF-1, ICAM1, VLA4, VCAM1, CD2, CD58, CD54, B7, CD155, and CD122; and / or c. The genes encoding UL16-binding proteins (ULBP)-2, 5, and 6 are knocked out or disrupted, so that the genes encoding ULBP-2, 5, and 6 do not express functional proteins.
3. The engineered cell according to claim 1 or 2, wherein one or more selected second signaling molecules are knocked out, thereby substantially reducing the stimulation of the hematopoietic cells by heterologous CD8+ T cells, wherein the second signaling molecule is selected from one or more of CD86, ICAM1 and CD58.
4. The engineered cell according to claim 1, 2 or 3, comprising a foreign gene, the foreign gene comprising a coding region of an NK repressor protein operatively linked to a heterologous promoter, wherein expression of the NK repressor protein reduces the activation of allogeneic NK cells in response to the engineered cell, but does not interfere with the differentiation of iPSCs containing the foreign gene into selected hematopoietic cells, wherein the NK repressor protein is selected from Clec2d, Nectin-1, CDH1, CD155 and combinations thereof.
5. The engineered cell according to claim 4, a. The engineered cells further overexpress HLA-E and / or HLA-G; and / or b. The engineered cells described therein also lack MHC-I and / or MHC-II.
6. The engineered cell according to claim 4, wherein the exogenous gene is derived from a mammalian gene, such as human, monkey, cow, dog, mouse or rat, preferably human or monkey.
7. The engineered cells according to claim 4, expressing one or more of SEQ ID No. 17-25 and / or SEQ ID No. 29-33.
8. The engineered cell according to claim 4, wherein the NK repressor protein is Clec2d, wherein... a. The Clec2d is mutated; and / or b. The Clec2d is derived from a non-human species; and / or c. The extracellular domain of the Clec2d is fused with a membrane protein.
9. The engineered cell according to claim 8, wherein... a. Amino acids 160-181 in the extracellular domain of the Clec2d are mutated, for example, the mutation includes mutations at one or more of the amino acid positions C163, K169, R175, H176, R180, and K181, for example, one or more mutations selected from C163S, K169E, R175E, H176C, R180E, and K181E; b. The Clec2d was mutated by replacing an amino acid with a cysteine residue; c. The membrane protein is the N-terminal transmembrane domain of NKG2 protein or other type 2 membrane protein, such as proteins selected from NKG2A, NKG2C and NKG2D.
10. The engineered cell according to claim 8 or 9, wherein the Clec2d mutation comprises one or more ubiquitination site mutations, such as K9R, K94R, K144R, and K186R.
11. The engineered cell according to any one of the preceding claims, wherein the Clec2d gene is replaced by a similar gene within the Clec2d family, such as Clec2b, Clec4a, Clec11a, Clec12a, Clec12b, or Clec14a, such as Clec4a or Clec12a.
12. The engineered cell according to any one of the preceding claims, wherein the engineered cell is an induced pluripotent stem cell (iPSC) or a stem cell.
13. The engineered cell according to any one of the preceding claims, wherein the engineered cell is an immune cell, cardiomyocyte, pancreatic islet cell, nerve cell, hematopoietic cell, such as hematopoietic stem cell, T cell, natural killer (NK) cell, macrophage or monocyte; for example, wherein the cell is a primary cell or derived from iPSC or stem cell according to claim 12.
14. The engineered cell according to any one of the preceding claims, wherein the engineered cell is a T cell, wherein the T cell is selected from naive T cells, CTLs, Tregs, memory T cells, dysfunctional T cells, exhausted T cells, and Th cells.
15. The engineered cell according to any one of the preceding claims, wherein the engineered cell is a T cell, and wherein the surface of the T cell has one or more markers selected from CD2, CD4, CD8, NK1.1, FOXP3, CD25, CD28, Foxp3+, CD127, CD152, CXCR3 and CCR4.
16. The engineered cell according to any one of the preceding claims, wherein the engineered cell is a T cell, wherein the T cell secretes one or more cytokines, the cytokines being selected from IFNγ, TNF, IL-2, IL-12, IL-18, IL-4, TGFβ and IL-10.
17. The engineered cell according to any one of the preceding claims, wherein the engineered cell is a T cell, wherein the T cell contains one or more transcription factors selected from EOMES, STAT4, STAT1, FoxP3 and STAT5.
18. The engineered cell according to any one of the preceding claims, wherein the engineered cell further comprises one or more exogenous genes, the exogenous genes expressing a chimeric antigen receptor (CAR) construct and / or a low-inflammatory antigen or cytokine; optionally, wherein the one or more exogenous genes express CD19-CAR, CD16, IL15, BCMA-CAR, HLAE, or a combination thereof.
19. The engineered cell according to any one of the preceding claims, wherein the engineered cell further comprises the deletion or depletion of one or more genes selected from TCR, CIITA, B2M or combinations thereof.
20. The engineered cell according to any one of the preceding claims, wherein the cell or its progeny persists in circulation for at least 15 days after being implanted into a recipient.
21. The engineered cell according to any one of the preceding claims, wherein the cell or its progeny, after being implanted into a recipient, exhibits at least a 20% reduction in the activation of allogeneic immune cells compared to syngeneic cells that do not contain one or more transfected genes.
22. The engineered cell according to any one of the preceding claims, wherein the cell or its progeny, after being implanted into a recipient, exhibits at least 5% enhanced resistance to immune rejection relative to syngeneic cells that do not contain one or more transfected genes.
23. A pharmaceutical composition comprising engineered cells as described in any one of the preceding claims, and a pharmaceutically acceptable carrier or diluent.
24. A method of treating a disease, comprising administering to a subject in need an effective amount of engineered cells according to any one of claims 1-22 or a pharmaceutical composition according to claim 23, wherein the disease is cancer, an autoimmune disease, heart injury or failure, diabetes, ischemia, or a central nervous system disease / injury, such as myeloma, lymphoma, hematologic malignancy, solid tumor, or stroke.
25. The method of claim 24, wherein the administration is performed via intravenous and / or intraosseous injection and / or tissue / organ transplantation.
26. The method of claim 24, wherein, relative to the administration of allogeneic cells not derived from engineered cells according to any one of claims 1-22, the method uses reduced levels of lymphocyte clearance or immunosuppression.
27. The method of claim 24, wherein the method does not require a lymphocyte removal step prior to using the engineered cells according to any one of claims 1-22.
28. The method of claim 24 or 25, wherein the method allows for multiple applications as needed.
29. A method for preparing hematopoietic cells according to claim 13, comprising culturing iPSCs according to claim 12 under conditions that induce differentiation of iPSCs according to claim 12 into hematopoietic cells according to claim 13.
Citation Information
Patent Citations
Systems and methods for enhanced immunotherapies
WO2022095902A1