Application of DNASE1L3, CYP4B1 and / or FAM65B in enhancing nasopharyngeal carcinoma cis-platinum sensitivity

Abstract

The invention discloses application of DNASE1L3, CYP4B1 and / or FAM65B in enhancing the cisplatin sensitivity of nasopharyngeal carcinoma, and belongs to the field of biological medicine. The invention proves that overexpression of the DNASE1L3 gene, the CYP4B1 gene and / or the FAM65B gene can obviously inhibit the activity of nasopharyngeal carcinoma cells and obviously enhance the sensitivity of the nasopharyngeal carcinoma cells to cis-platinum. An in-vivo xenotransplantation tumor model further proves that the in-vivo anti-tumor effect of the cis-platinum can be remarkably enhanced by combining the overexpressed DNASE1L3 gene, the CYP4B1 gene or the FAM65B gene with the cis-platinum, and tumor growth is effectively inhibited. The invention provides a brand new molecular target for overcoming the cisplatin resistance of nasopharynx cancer, provides a new strategy for preparing high-efficiency and low-toxicity nasopharynx cancer treatment drugs and cisplatin sensitizers, and has important clinical application prospects and market values.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to the application of DNASE1L3, CYP4B1 and / or FAM65B in enhancing cisplatin sensitivity in nasopharyngeal carcinoma. Background Technology

[0002] Nasopharyngeal carcinoma (NPC) is a malignant tumor of the head and neck originating from the mucosal epithelium of the nasopharynx, characterized by its unique geographical distribution and high potential for invasion and metastasis. Due to its insidious location and atypical early symptoms, most patients are already in a locally advanced stage at initial diagnosis. Currently, cisplatin-based chemotherapy regimens, such as cisplatin combined with 5-fluorouracil (PF) or gemcitabine (GP), are the standard treatment for patients with locally advanced and metastatic NPC. Although initial treatment is effective for some patients, the frequent occurrence of chemotherapy resistance has become a key bottleneck restricting the improvement of efficacy. Acquired resistance significantly increases the risk of local tumor recurrence (approximately 10%) and distant metastasis (10%-20%), which is also a major cause of treatment failure and patient death in NPC. Therefore, in-depth analysis of the molecular mechanisms of cisplatin resistance in NPC and the exploration of new targets that can effectively reverse resistance and enhance chemosensitivity are of significant clinical importance for improving patient prognosis.

[0003] Existing research indicates that the mechanisms by which tumor cells develop resistance to cisplatin are extremely complex, involving multiple aspects, including reduced intracellular drug accumulation (e.g., through downregulation of the copper transporter CTR1 or enhanced efflux of ATP7A / B), enhanced DNA damage repair capacity (e.g., overactivation of the nucleotide excision repair system), inactivation of apoptosis pathways, and alterations in the tumor microenvironment. Targeting these mechanisms, studies have attempted to develop corresponding sensitization strategies, such as using butyrate sulfoxide (BSO) to deplete glutathione and increase intracellular oxidative stress, or inhibiting DNA repair enzymes to enhance cisplatin-induced DNA damage. However, these strategies face numerous challenges in clinical translation. For example, systemic inhibition of DNA repair may lead to increased toxicity to normal tissues, and due to the heterogeneity and compensatory nature of resistance mechanisms, intervention with a single target often fails to achieve durable and stable sensitization effects. Therefore, there is still an urgent clinical need to discover more specific, safer, and more effective cisplatin-sensitizing targets for nasopharyngeal carcinoma. Summary of the Invention

[0004] The purpose of this invention is to provide the application of DNASE1L3, CYP4B1, and / or FAM65B in enhancing cisplatin sensitivity in nasopharyngeal carcinoma, thereby addressing the problems existing in the prior art. This invention reveals for the first time that overexpression of DNASE1L3, CYP4B1, and FAM65B can significantly enhance cisplatin sensitivity in nasopharyngeal carcinoma, and in vitro and in vivo experiments have confirmed that it can effectively inhibit tumor growth without significant hepatotoxicity or nephrotoxicity. This invention provides novel uses for the above-mentioned genes and pharmaceutical compositions, offering new targets for overcoming cisplatin resistance and preparing highly effective and low-toxicity cisplatin-enhancing drugs for nasopharyngeal carcinoma.

[0005] To achieve the above objectives, the present invention provides the following solution: This invention provides the use of a reagent for enhancing the expression or activity of the DNASE1L3 gene, CYP4B1 gene, and / or FAM65B gene in the preparation of a drug for treating nasopharyngeal carcinoma and / or inhibiting the activity of nasopharyngeal carcinoma cells. The coding sequence of the DNASE1L3 gene is shown in SEQ ID NO. 9; the coding sequence of the CYP4B1 gene is shown in SEQ ID NO. 10; and the coding sequence of the FAM65B gene is shown in SEQ ID NO. 11.

[0006] Optionally, the reagents for enhancing the expression or activity of the DNASE1L3 gene, CYP4B1 gene, and / or FAM65B gene include overexpression vectors containing the DNASE1L3 gene, CYP4B1 gene, and / or FAM65B gene.

[0007] Optionally, the overexpression vector includes plasmid vectors, lentiviral vectors, adenovirus vectors, adenovirus-associated vectors, and CRISPR overexpression systems.

[0008] Optionally, the overexpression vector is a lentiviral vector.

[0009] Optionally, the nasopharyngeal carcinoma cells include NPC / HK1, HNE1, and HNE3 cell lines.

[0010] The present invention also provides a pharmaceutical composition, the active ingredients of which include a reagent for increasing the expression or activity of the DNASE1L3 gene, the CYP4B1 gene and / or the FAM65B gene and cisplatin; the coding sequence of the DNASE1L3 gene is shown in SEQ ID NO.9; the coding sequence of the CYP4B1 gene is shown in SEQ ID NO.10; and the coding sequence of the FAM65B gene is shown in SEQ ID NO.11.

[0011] Optionally, the reagents for enhancing the expression or activity of the DNASE1L3 gene, CYP4B1 gene, and / or FAM65B gene include overexpression vectors containing the DNASE1L3 gene, CYP4B1 gene, and / or FAM65B gene.

[0012] Optionally, the overexpression vector includes a lentiviral vector.

[0013] The present invention also provides the use of the pharmaceutical composition described herein in the preparation of a medicament that enhances the sensitivity of nasopharyngeal carcinoma cells to the cisplatin drug for nasopharyngeal carcinoma.

[0014] The present invention also provides the use of the pharmaceutical composition described herein in the preparation of a medicament for treating nasopharyngeal carcinoma.

[0015] The present invention discloses the following technical effects: This invention reveals for the first time the novel functions of DNASE1L3, CYP4B1, and FAM65B in regulating cisplatin sensitivity in nasopharyngeal carcinoma. Experiments show that overexpression of these genes significantly inhibits nasopharyngeal carcinoma cell viability and markedly enhances their sensitivity to cisplatin. Further confirmation using an in vivo xenograft model demonstrates that the combined use of overexpression of DNASE1L3, CYP4B1, or FAM65B with cisplatin significantly enhances the in vivo antitumor effect of cisplatin, effectively inhibiting tumor growth without increasing significant hepatotoxicity or nephrotoxicity, exhibiting good safety. This invention provides a novel molecular target for overcoming cisplatin resistance in nasopharyngeal carcinoma.

[0016] Based on the above findings, this invention provides novel uses for the aforementioned genes and pharmaceutical compositions comprising them. By enhancing the expression or activity of DNASE1L3, CYP4B1, and / or FAM65B in nasopharyngeal carcinoma cells, the technical challenges of low sensitivity to cisplatin chemotherapy and frequent drug resistance in nasopharyngeal carcinoma in existing technologies can be effectively addressed. This provides a new strategy for preparing highly effective and low-toxicity nasopharyngeal carcinoma treatment drugs and cisplatin sensitizers, and has significant clinical application prospects and market value. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1This chart shows the differential expression levels of DNASE1L3, CYP4B1, and FAM65B in nasopharyngeal carcinoma and rhinitis tissues. Specifically, A represents the statistical analysis of DNASE1L3 expression levels detected by qRT-PCR in nasopharyngeal carcinoma and rhinitis tissues; B represents the statistical analysis of CYP4B1 expression levels detected by qRT-PCR in nasopharyngeal carcinoma and rhinitis tissues; and C represents the statistical analysis of FAM65B expression levels detected by qRT-PCR in nasopharyngeal carcinoma and rhinitis tissues. P<0.05, P<0.01; Figure 2 The effects of overexpression of DNASE1L3, CYP4B1, or FAM65B on the viability of nasopharyngeal carcinoma cells NPC / HK1 (A), HNE1 (B), and HNE3 (C) were detected using the CCK8 assay. P<0.05, P<0.01; Figure 3 The dose-response curves for the sensitivity of cisplatin to nasopharyngeal carcinoma cells by overexpression of DNASE1L3 (A), CYP4B1 (B), or FAM65B (C), respectively; P<0.05, P<0.01; Figure 4 To validate the effects of DNASE1L3, CYP4B1, or FAM65B on enhancing the sensitivity and safety of cisplatin in nasopharyngeal carcinoma xenograft models; where A is an image of xenografts in nude mice of each group; B is the growth curve of xenografts in each group; C is the tumor weight of xenografts in each group; D is the liver weight of nude mice in each group; and E is the kidney weight of nude mice in each group. P<0.05, P<0.01. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] In this invention, the gene DNASE1L3 (Deoxyribonuclease 1 Like 3) [NCBI Gene ID: 1776] encodes a type of Ca 2+ / Mg 2+ Dependent nucleases participate in DNA degradation and maintain extracellular DNA homeostasis; CYP4B1 (Cytochrome P450 Family 4 Subfamily B Member 1) [NCBI Gene ID:1580] belongs to the cytochrome P450 family and is mainly involved in the bioactivation or metabolism of exogenous compounds (such as toxins); FAM65B (Family With Sequence Similarity 65 Member B) [NCBI Gene ID: 9750], also known as RIPOR2, encodes a cell polarization regulator that interacts with the Rho family and participates in cytoskeleton dynamics, cell polarity, and migration regulation.

[0025] The present invention will now be described in detail with reference to specific embodiments.

[0026] Example 1: Detection of the expression of DNASE1L3, CYP4B1, and FAM65B in clinical tissue samples 1. Sample collection Thirty tissue samples from pathologically confirmed nasopharyngeal carcinoma cases and 18 tissue samples from chronic rhinitis cases were collected as controls. All samples were obtained from Hunan Cancer Hospital (Changsha, China), and informed consent was obtained from all patients. After surgical resection, the tissue samples were immediately flash-frozen in liquid nitrogen and stored at -80°C for long-term use.

[0027] 2. Total RNA extraction Take an appropriate amount of frozen tissue and grind it thoroughly into powder in liquid nitrogen. Add 1 mL of RNAiso Plus reagent (Takara, Japan) and extract total RNA according to the instructions. Use a NanoDrop 2000 spectrophotometer to determine the RNA concentration and purity, ensuring that the A260 / A280 ratio is between 1.8 and 2.0.

[0028] 3. Reverse transcription and real-time quantitative PCR 1 μg of total RNA was reverse transcribed into first-strand cDNA using the PrimeScript RT Master Mix kit (Takara, Japan). Using the cDNA as a template, amplification was performed on an ABI 7500 real-time quantitative PCR instrument using the SYBR Premix ExTaq II kit (Takara, Japan). GAPDH was used as an internal control gene. Primer sequences are shown in Table 1.

[0029] Table 1 Primer information for real-time quantitative PCR The reaction conditions were: 95℃ pre-denaturation for 30 seconds; 95℃ denaturation for 5 seconds; 60℃ annealing / extending for 34 seconds, for a total of 40 cycles. Each sample was tested in triplicate. Two [samples] were used. −ΔΔCt The method calculates the relative expression level of the target gene.

[0030] qRT-PCR results are as follows Figure 1 As shown, compared with rhinitis tissue, the mRNA expression levels of DNASE1L3 and CYP4B1 in nasopharyngeal carcinoma tissue were significantly reduced (P<0.05), while the expression level of FAM65B showed no significant difference between the two groups. These results suggest that DNASE1L3 and CYP4B1 may play a tumor-suppressive role in nasopharyngeal carcinoma, and their low expression may be associated with disease development and progression.

[0031] Example 2: Construction of DNASE1L3, CYP4B1, and FAM65B overexpression vectors and verification of their effects on nasopharyngeal carcinoma cell viability. To investigate the effects of DNASE1L3, CYP4B1, and FAM65B on the malignant phenotype of nasopharyngeal carcinoma cells, this embodiment constructed corresponding overexpression vectors and examined their effects on cell viability.

[0032] 1. Construction of overexpression vectors PCR primers were designed based on the coding sequences (CDS) of DNASE1L3, CYP4B1, and FAM65B. Using a human normal tissue cDNA library as a template, the full-length CDS regions of each gene were obtained by PCR amplification. After purification, the amplified products were cloned into the corresponding multiple cloning sites of the pcDNA3.1(+) eukaryotic expression vector (Invitrogen, USA) using homologous recombination or T4 ligase methods to construct recombinant plasmids pcDNA3.1-DNASE1L3, pcDNA3.1-CYP4B1, and pcDNA3.1-FAM65B. All constructed plasmids were validated by sequencing to ensure sequence accuracy. An empty pcDNA3.1(+) plasmid was used as a negative control (NC).

[0033] The CDS sequence of DNASE1L3 (SEQ ID NO.9): ATGTCACGGGAGCTGGCCCCACTGCTGCTTCTCCTCCTCTCCATCCACAGCGCCCTGGCCATGAGGATCTGCTCCTTCAACGTCAGGTCCTTTGGGGAAAGCAAGCAGGAAGACAAGAATGCCATGGATGTCATTGTGAAGGTCATCAAACGCTGTGACATCATACTCGTGATGGAAATCAAGGACAGCAACAACAGGATCTGCCCCATACTGATGGAGAAGCTGAACAGAAATTCAAGGAGAGGCATAACGTACAACTATGTGATTAGCTCTCGGCTTGGAAGAAACACATATAAAGAACAATATGCCTTTCTCTACAAGGAAAAGCTGGTGTCTGTGAAGAGGAGTTATCACTACCATGACTATCAGGATGGAGACGCAGATGTGTTTTCCAGGGAGCCCTTTGTGGTCTGGTTCCAATCTCCCCACACTGCTGTCAAAGACTTCGTGATTATCCCCCTGCACACCACCCCAGAGACATCCGTTAAGGAGATCGATGAGTTGGTTGAGGTCTACACGGACGTGAAACACCGCTGGAAGGCGGAGAATTTCATTTTCATGGGTGACTTCAATGCCGGCTGCAGCTACGTCCCCAAGAAGGCCTGGAAGAACATCCGCTTGAGGACTGACCCCAGGTTTGTTTGGCTGATCGGGGACCAAGAGGACACCACGGTGAAGAAGAGCACCAACTGTGCATATGACAGGATTGTGCTTAGAGGACAAGAAATCGTCAGTTCTGTTGTTCCCAAGTCAAACAGTGTTTTTGACTTCCAGAAAGCTTACAAGCTGACTGAAGAGGAGGCCCTGGATGTCAGCGACCACTTTCCAGTTGAATTTAAACTACAGTCTTCAAGGGCCTTCACCAACAGCAAAAAATCTGTCACTCTAAGGAAGAAAACAAAGAGCAAACGCTCCTAG。

[0034] CDS sequence of CYP4B1 (SEQ ID NO.10):

[0035] CDS sequence of FAM65B (SEQ ID NO.11):

[0036] 2. Cell Culture and Transfection Human nasopharyngeal carcinoma cell lines NPC / HK1, HNE1, and HNE3 were purchased from iCell Bioscience (Shanghai, China). Cells were cultured in RPMI 1640 medium containing 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin-streptomycin in a humidified incubator at 37°C and 5% CO2. Cells in the logarithmic growth phase were harvested and cultured at 1 × 10⁶ cells per well. 5 Cells were seeded in 6-well plates. When the cell confluence reached 70%-80%, 2.5 μg of pcDNA3.1-DNASE1L3, pcDNA3.1-CYP4B1, pcDNA3.1-FAM65B, and the control empty vector plasmid were transfected into the cells using Lipofectamine 3000 transfection reagent (Invitrogen, USA). Forty-eight hours after transfection, a portion of the cells were collected, and the overexpression efficiency of each gene was verified by qRT-PCR.

[0037] 3. CCK-8 cell viability assay Cells from each group (NC, DNASE1L3, CYP4B1, FAM65B) were digested with trypsin 48 hours after transfection, at a concentration of 1 × 10⁶ cells per well. 3 Cells were seeded at a density of 10 μL in 96-well plates, with 5 replicates per group. 10 μL of CCK-8 reagent (Dojindo, Japan) was added to each well, gently mixed, and incubated for 2 hours. The absorbance (OD) value of each well was measured at 450 nm using a microplate reader. A cell viability curve was plotted with time on the x-axis and OD value on the y-axis.

[0038] The results are as follows Figure 2 As shown, compared with the NC group transfected with the empty vector, in the NPC / HK1, HNE1, and HNE3 cell lines, cells overexpressing DNASE1L3, CYP4B1, or FAM65B, respectively, had significantly lower OD values. 450 The values ​​were all significantly reduced (P<0.05), indicating that overexpression of any one of these three genes can significantly inhibit the in vitro proliferation of nasopharyngeal carcinoma cells.

[0039] Example 3: Detection of the effect of overexpression of DNASE1L3, CYP4B1, and FAM65B on the cisplatin sensitivity of nasopharyngeal carcinoma cells. This embodiment aims to verify whether DNASE1L3, CYP4B1, and FAM65B can enhance the sensitivity of nasopharyngeal carcinoma cells to cisplatin.

[0040] 1. Cell transfection and drug treatment After digesting NPC / HK1 cells in the logarithmic growth phase, they were stored at 8 × 10⁸ cells per well. 3 Cells were seeded at a density of 1000 g / well in 96-well plates and incubated overnight at 37°C. After cell attachment, pcDNA3.1-DNASE1L3, pcDNA3.1-CYP4B1, pcDNA3.1-FAM65B, and the control empty vector were transfected into the cells using Lipofectamine 3000 (6 replicates per group). 24 hours after transfection, the old culture medium was discarded, and fresh culture medium containing different concentrations of cisplatin (0, 0.5, 1, 2, 4, 8, 16 μM, purchased from Sigma-Aldrich, USA) was added, and the cells were incubated for another 48 hours.

[0041] 2. Cell viability detection and data analysis After drug treatment, 10 μL of CCK-8 reagent was added to each well, and after incubation for 2 hours, the absorbance at 450 nm was measured using a microplate reader. Using the control wells without cisplatin treatment as 100% cell viability, the cell survival rate (%) under each cisplatin concentration was calculated. A dose-response curve was fitted using GraphPad Prism software, with the logarithm of cisplatin concentration on the x-axis and cell survival rate on the y-axis, and the half-maximal inhibitory concentration (IC50) was calculated. 50 ).

[0042] The dose-response curve is as follows: Figure 3 As shown, compared with the control group transfected with the empty vector, overexpression of DNASE1L3, CYP4B1, or FAM65B significantly shifted the cell survival curves to the left. The calculated IC50 values... 50 The values ​​were also significantly lower than those of the control group (P<0.01). This indicates that overexpression of DNASE1L3, CYP4B1, or FAM65B can significantly enhance the sensitivity of NPC / HK1 cells to cisplatin.

[0043] Example 4: Validation of the effects of DNASE1L3, CYP4B1, and FAM65B on enhancing cisplatin sensitivity and preliminary safety assessment using an in vivo xenograft model. This embodiment utilizes a nude mouse subcutaneous xenograft model to verify the cisplatin-sensitizing effect of three genes in vivo and to preliminarily assess the safety of their combined use.

[0044] 1. Construction of stable overexpression cell lines Lentivirals carrying the DNASE1L3, CYP4B1, FAM65B genes and negative control sequences (LV-DNASE1L3, LV-CYP4B1, LV-FAM65B, LV-NC) were constructed and packaged by Gene Pharma (Shanghai). Logarithmically growing NPC / HK1 cells were seeded in 6-well plates. The following day, lentiviruses were added at a multiplicity of infection (MOI) of 30, along with 5 μg / mL polybrene to enhance infection efficiency. After 72 hours of infection, puromycin was added to a final concentration of 2 μg / mL for selection until all uninfected control cells died, yielding cell lines stably overexpressing the target genes and control cells.

[0045] 2. Animal model establishment and grouping treatment Male BALB / c nude mice aged 4-6 weeks and weighing 18-20g were purchased from Hunan Slack Jingda Experimental Animal Co., Ltd., and were acclimatized in an SPF-grade environment for 1 week. Stable infected cell lines in the logarithmic growth phase (LV-NC, LV-DNASE1L3, LV-CYP4B1, LV-FAM65B) were resuspended in PBS to a density of 5×10⁻⁶ mcg. 7 200 μL (containing 1×10⁶ cells / mL) was subcutaneously injected into the right axilla of each nude mouse. 7 Cell suspensions were prepared. Nude mice were randomly divided into 5 groups (n=6): (1) vec-NC + Vehicle group; (2) vec-NC + DDP group; (3) DNASE1L3 + DDP group; (4) CYP4B1 + DDP group; (5) FAM65B + DDP group. Treatment began on day 7 after tumor inoculation. Mice in the DDP group were injected intraperitoneally with cisplatin (3 mg / kg, diluted with physiological saline), and mice in the Vehicle group were injected intraperitoneally with an equal volume of physiological saline. The administration frequency was once every other day.

[0046] 3. Tumor monitoring and sample collection During drug administration, the long axis (L) and short axis (W) of the tumor were measured every 2-3 days using a digital caliper, and the tumor volume was calculated using the following formula: V = (L × W) 2 ) / 2. Mouse weight was recorded simultaneously. Monitoring continued until day 25 post-inoculation. Subsequently, mice were euthanized by intraperitoneal injection of an excessive amount of sodium pentobarbital (50 mg / kg). Subcutaneous tumor tissue was dissected, weighed, and photographed. Simultaneously, the liver and kidney tissues were carefully separated, rinsed with pre-cooled PBS, blotted dry with filter paper, and weighed and recorded.

[0047] The results are as follows Figure 4As shown, in vivo experimental results indicated that, compared with the vec-NC+Vehicle group, the tumor volume and weight of the vec-NC+DDP group were inhibited to a certain extent, and the tumor volume and weight of the DNASE1L3+DDP, CYP4B1+DDP, and FAM65B+DDP groups were further significantly reduced (P<0.05), indicating that overexpression of these three genes can significantly enhance the anti-tumor effect of cisplatin in vivo. Analysis of the liver and kidney weights of mice in each group showed that, compared with the vec-NC+DDP group, there were no significant differences in liver and kidney weights in the other treatment groups (P>0.05), preliminarily suggesting that the combined use of cisplatin with overexpression of DNASE1L3, CYP4B1, or FAM65B did not increase significant hepatotoxicity or nephrotoxicity, demonstrating good in vivo safety.

[0048] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The use of a reagent for enhancing the expression or activity of the DNASE1L3 gene, CYP4B1 gene, and / or FAM65B gene in the preparation of drugs for treating nasopharyngeal carcinoma and / or inhibiting the activity of nasopharyngeal carcinoma cells, characterized in that, The coding sequence of the DNASE1L3 gene is shown in SEQ ID NO.9; the coding sequence of the CYP4B1 gene is shown in SEQ ID NO.10; and the coding sequence of the FAM65B gene is shown in SEQ ID NO.

11.

2. The application according to claim 1, characterized in that, The reagents for enhancing the expression or activity of the DNASE1L3 gene, CYP4B1 gene, and / or FAM65B gene include overexpression vectors containing the DNASE1L3 gene, CYP4B1 gene, and / or FAM65B gene.

3. The application according to claim 2, characterized in that, The overexpression vectors include plasmid vectors, lentiviral vectors, adenovirus vectors, adenovirus-associated vectors, and CRISPR overexpression systems.

4. The application according to claim 3, characterized in that, The overexpression vector is a lentiviral vector.

5. The application according to claim 1, characterized in that, The nasopharyngeal carcinoma cells include NPC / HK1, HNE1, and HNE3 cell lines.

6. A pharmaceutical composition, characterized in that, The active ingredients include a reagent for enhancing the expression or activity of the DNASE1L3 gene, the CYP4B1 gene, and / or the FAM65B gene, and cisplatin; the coding sequence of the DNASE1L3 gene is shown in SEQ ID NO.9; the coding sequence of the CYP4B1 gene is shown in SEQ ID NO.10; and the coding sequence of the FAM65B gene is shown in SEQ ID NO.

11.

7. The pharmaceutical composition according to claim 6, characterized in that, The reagents for enhancing the expression or activity of the DNASE1L3 gene, CYP4B1 gene, and / or FAM65B gene include overexpression vectors containing the DNASE1L3 gene, CYP4B1 gene, and / or FAM65B gene.

8. The pharmaceutical composition according to claim 7, characterized in that, The overexpression vector includes a lentiviral vector.

9. Use of the pharmaceutical composition according to any one of claims 6-8 in the preparation of a medicament for enhancing the sensitivity of nasopharyngeal carcinoma cells to the cisplatin drug for nasopharyngeal carcinoma.

10. Use of the pharmaceutical composition according to any one of claims 6-8 in the preparation of a medicament for treating nasopharyngeal carcinoma.

Images