Genetic engineering strain and construction method thereof

Abstract

The invention provides a genetic engineering strain and a construction method thereof, the strain is a target gene deleted strain obtained by knocking out a target gene in a rod-shaped bacterial strain, and the target gene is one of minC and minD genes or a gene combination thereof. According to the present invention, the minC and / or minD gene deletion strain is obtained by knocking out the minC and / or minD gene in the rod-shaped bacterial strain, such that cell division abnormality can be caused, chromosome-free small cells are generated, and the small cells have characteristics of biological activity, no chromosome DNA, and no growth or division propagation. The small cells can generate smaller body immune response, and meanwhile, the LPS modified by the small cells can generate smaller cytotoxic reaction, so that side effects can be greatly reduced when the small cells are applied to human or animal bodies.

Description

Technical Field

[0001] This application relates to the field of microbial technology, and in particular to a genetically engineered strain and its construction method. Background Technology

[0002] Utilizing bacteria as live therapeutic agents is emerging as an innovative and important approach to treating a wide range of diseases. Living cells can be engineered into novel drugs, dynamically responding to external environmental signals to intervene in and treat diseases. Through molecular biology methods, we can design corresponding gene regulatory modules as needed. To date, various cell types, including stem cells, chimeric antigen receptor-based (CAR-T) cells, yeast, algae, and bacteria, have been developed. With a deepening understanding of microorganisms and the development of molecular biology tools, the potential of bacteria as novel therapeutic agents for treating various diseases, including inflammation, infectious diseases, metabolic disorders, and cancer, has attracted widespread attention.

[0003] The history of bacterial therapy dates back to 1879 when Louis Pasteur first invented the chicken cholera vaccine using attenuated Pasteurella multocida (a live bacterial preparation). As of 2023, the U.S. Food and Drug Administration (FDA) approved Vowst, the first oral fecal microbiota capsule designed to prevent recurrent Clostridium difficile infections, marking the expanding acceptance and application of live microbiome therapy in the medical field.

[0004] However, current bacterial therapies typically use bacteria with complete genetic systems capable of replication. These bacteria may multiply uncontrollably within the host, posing significant safety risks when directly applied to humans and animals. For example, *E. coli* contains lipopolysaccharide (LPS) in its outer membrane, an endotoxin. Once inside the human body, LPS strongly activates numerous immune cells via Toll-like receptor-4 (TLR4), directly inducing endotoxic shock (septic shock) and even death. Removing this toxic component using current technology is complex and expensive. Furthermore, besides its potential problems in medical applications, LPS also impacts other fundamental biological research, as the presence of endotoxins often leads to toxicity and interferes with experimental results. *ClearColi BL21(DE3)* *E. coli* possesses a genetically modified lipopolysaccharide that does not trigger an endotoxin response in human cells. This characteristic is achieved by blocking the transmission of lipid A precursor lipid IV via the deletion of seven genes (ΔgutQ, ΔkdsD, ΔlpxL, ΔlpxM, ΔpagP, ΔlpxP, and ΔeptA). AThis is achieved through the synthesis of LPS. Furthermore, a compensatory mutation (msbA148) enables cells to utilize lipid IV. A It retains its ability to survive even when present. Therefore, ClearColi BL21(DE3) has great value in human applications due to its ability to reduce side effects. However, because ClearColi BL21(DE3) is modified or has eight genes deleted from the wild-type BL21(DE3) bacteria, its growth rate and environmental tolerance are significantly lower than those of the wild-type BL21(DE3) bacteria. For example, the growth rate of ClearColi BL21(DE3) is only 50% of that of the wild-type BL21(DE3) bacteria. Furthermore, ClearColi BL21(DE3) exhibits salt-dependent growth defects in low-osmotic media, indicating that its outer membrane is unstable under low ionic strength conditions. To improve growth and avoid the production of colanicacid exopolysaccharide as a stress response, ClearColi BL21(DE3) requires the addition of 1% NaCl to the culture medium, and the addition of magnesium ions (Mg) should be avoided. 2+ ) and calcium ions (Ca 2+ These defects greatly increase the difficulty of gene editing in ClearColi BL21(DE3).

[0005] This invention, through optimized design of the repair template and sgRNA DNA sequence, combined with homologous recombination and CRISPR / Cas9 gene editing technologies, successfully knocked out the minC and / or minD genes of ClearColi BL21(DE3) bacteria, and obtained small cells produced by the genetically engineered strain. The average diameter of the small cells produced by this genetically engineered bacterium is smaller than that of small cells produced by other bacteria reported to date (average diameter approximately 400 nm), resulting in a smaller immune response. Furthermore, due to the modified LPS, it exhibits less cytotoxicity, significantly reducing side effects when applied to humans or animals. Summary of the Invention

[0006] In view of the above-mentioned problems existing in the prior art, this application proposes a genetically engineered bacterial strain and its construction method. By knocking out the minC and / or minD genes in the genome of baculoblastic bacteria, abnormal cell division is caused, resulting in chromosome-free small cells. These small cells produce a smaller immune response, and the modified LPS produces a smaller cytotoxic response. When applied to humans or animals, this will greatly reduce the occurrence of side effects.

[0007] In a first aspect, this application provides a genetically engineered bacterial strain, which is a target gene deletion strain obtained by knocking out a target gene in a rod-shaped bacterial strain, wherein the target gene is one of the minC and minD genes or a combination thereof.

[0008] Secondly, this application provides a method for constructing the genetically engineered bacterial strain, the method comprising knocking out a target gene in the rod-shaped bacterial strain to obtain a target gene-deleted strain, the knockout being achieved by means of one or a combination of homologous recombination technology and CRISPR technology.

[0009] Thirdly, this application provides a small cell produced by the genetically engineered strain.

[0010] Fourthly, this application provides a method for purifying the small cells, the method comprising: centrifuging and / or filtering the bacterial culture to obtain a filtrate, passing the filtrate through ultra-high speed centrifugation and / or filtering to obtain a precipitate, and resuspending the precipitate in 1×PBS buffer to obtain purified small cells.

[0011] Beneficial effects:

[0012] This application obtains minC and / or minD gene-deficient strains by knocking out the minC and / or minD genes in rod-shaped bacterial strains. This results in abnormal cell division, producing chromosome-free small cells that are biologically active but lack chromosomal DNA and cannot grow or reproduce. The average diameter of these small cells is smaller than that of other reported bacterial small cells, thus eliciting a smaller immune response. Furthermore, the modified LPS produces less cytotoxicity, significantly reducing side effects when applied to humans or animals. Attached Figure Description

[0013] Figure 1a This is a green fluorescence photograph of the ClearColi BL21(DE3)minD gene-deleted strain before purification, as shown in Example 2 of this application.

[0014] Figure 1b This is a bright-field photograph of the ClearColi BL21(DE3)minD gene-deleted strain before purification, as shown in Example 2 of this application.

[0015] Figure 2 This is a schematic diagram of the particle size and concentration distribution of the purified small cells as shown in Example 2 of this application.

[0016] Figure 3a This is a photograph of the green fluorescence of the purified small cells shown in Example 2 of this application.

[0017] Figure 3b for Figure 3a A magnified view of a portion of the image.

[0018] Figure 4 The results are PCR identification results of the ClearColi BL21(DE3)minD gene knockout colonies shown in Example 1 of this application.

[0019] Figure 5 The results are PCR identification of the ClearColi BL21(DE3)minC gene knockout colonies shown in Example 1 of this application. Detailed Implementation

[0020] To make the objectives, technical solutions, and advantages of this application clearer, the technical solutions of this application will be clearly and completely described below in conjunction with embodiments. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. The embodiments described herein are illustrative in nature and are used to provide a basic understanding of this application. The embodiments of this application should not be construed as limiting this application.

[0021] For the sake of brevity, this article only discloses a few specific numerical ranges. However, any lower limit can be combined with any upper limit to form an unspecified range; and any lower limit can be combined with other lower limits to form an unspecified range, just as any upper limit can be combined with any other upper limit to form an unspecified range. Furthermore, each individually disclosed point or single value can itself serve as a lower or upper limit and be combined with any other point or single value or with other lower or upper limits to form an unspecified range.

[0022] In this description, unless otherwise stated, "above" and "below" include the stated number.

[0023] Unless otherwise stated, the terms used in this application have their common meanings as commonly understood by those skilled in the art. Unless otherwise stated, the values ​​of the parameters mentioned in this application can be measured using various measurement methods commonly used in the art (e.g., they can be tested according to the methods given in the embodiments of this application).

[0024] In the detailed description and claims, a list of items connected by the terms "at least one of," "at least one of," "at least one of," or other similar terms may mean any combination of the listed items. For example, if items A and B are listed, then the phrase "at least one of A and B" means only A; only B; or A and B. In another example, if items A, B, and C are listed, then the phrase "at least one of A, B, and C" means only A; or only B; only C; A and B (excluding C); A and C (excluding B); B and C (excluding A); or all of A, B, and C. Item A may contain a single element or multiple elements. Item B may contain a single element or multiple elements. Item C may contain a single element or multiple elements.

[0025] In the detailed description and claims, a list of items connected by the terms "one of," "one of," "one of," or other similar terms may mean any of the listed items. For example, if items A and B are listed, then the phrase "one of A and B" means only A; or only B. In another example, if items A, B, and C are listed, then the phrase "one of A, B, and C" means only A; or only B; or only C.

[0026] In the description of this article, it should also be noted that the terms "first," "second," etc., are used only to distinguish descriptions and should not be interpreted as indicating or implying relative importance.

[0027] In this description, it should also be noted that a minicell is a small, spherical cell produced by the abnormal division of rod-shaped bacteria. This cell is biologically active, does not contain chromosomal DNA, and cannot grow or reproduce by division. However, it contains biologically active substances such as a cell membrane, peptidoglycan, ribosomes, RNA, and proteins, and can continue to perform some cellular activities similar to those of the parent cell, such as ATP synthesis, plasmid DNA replication and transcription, and mRNA translation.

[0028] This application generates chromosome-free minicells by knocking out the minC and / or minD genes in the genome of baculotroph bacteria, thereby causing abnormal cell division. These chromosome-free minicells can be designed using various molecular biology methods to target specific tissues and carry payloads. The minicells also contain cytoplasmic material from the parent bacteria, including plasmids, which can be used to perform functions programmed through genetic pathways. For example, minicells from *E. coli* can be used for small molecule programmable detection. When the minicells are produced and purified to remove their parent bacteria, the presence of the target molecule can induce the minicells to produce green fluorescent protein (GFP) in vitro. These minicells can serve as genetically engineerable "smart bioparticles" with more complex behaviors than nanoparticles constructed using bottom-up methods, without the risks associated with using live bacteria capable of reproduction and replication.

[0029] In a first aspect, this application provides a genetically engineered bacterial strain, which is a target gene deletion strain obtained by knocking out a target gene in a baculoform bacterial strain. The target gene is one of the minC and minD genes or a combination thereof. The nucleotide sequence of the minD gene is shown in SEQ ID NO.1, and the nucleotide sequence of the minC gene is shown in SEQ ID NO.2.

[0030] This application obtains minC and / or minD gene-deficient strains by knocking out the minC and / or minD genes in rod-shaped bacterial strains. This results in abnormal cell division, producing chromosome-free small cells that are biologically active but lack chromosomal DNA and cannot grow or reproduce. The average diameter of these small cells is smaller than that of other reported bacterial small cells, thus eliciting a smaller immune response. Furthermore, the modified LPS produces less cytotoxicity, significantly reducing side effects when applied to humans or animals.

[0031] In some embodiments, the rod-shaped bacteria include one of Escherichia coli, Bacillus subtilis, Salmonella enterica, Pseudomonas aeruginosa, Corynebacterium glutamicum, and Listeria monocytogenes.

[0032] In some embodiments, the genetically engineered strain is preferably the ClearColi BL21(DE3) Escherichia coli strain.

[0033] Secondly, this application provides a method for constructing the genetically engineered bacterial strain, the method comprising knocking out a target gene in the rod-shaped bacterial strain to obtain a target gene-deleted strain, the knockout being achieved by means of one or a combination of homologous recombination technology and CRISPR technology.

[0034] In some embodiments, the target gene in the rod-shaped bacterial strain can be knocked out using λ-Red homologous recombination technology and CRISPR / Cas9 gene editing technology. In some embodiments, the target gene-deleted strain can be obtained by gene editing using the Red / ET system technology based on homologous recombination.

[0035] In some embodiments, the method includes:

[0036] S1. Design the DNA sequence corresponding to the sgRNA targeting the target gene and the repair template DNA sequence, and construct a plasmid containing the DNA sequence corresponding to the sgRNA and the repair template DNA sequence;

[0037] S2. The plasmid obtained in step S1 is transferred into an electrotransformation competent strain containing the pCas plasmid.

[0038] S3. Screen the strains obtained after step S2 to obtain strains with the target gene deletion.

[0039] In some embodiments, step S1 is preferably: designing the DNA sequence corresponding to the sgRNA, as shown in SEQ ID NO.3, for knocking out the minD gene. The DNA sequence corresponding to the sgRNA is then amplified by PCR, and minD-RNA FWD (forward primer, as shown in SEQ ID NO.7) and minD-RNA REV (reverse primer, as shown in SEQ ID NO.8) for knocking out the minD gene are designed.

[0040] In some embodiments, step S1 is preferably: designing the DNA sequence corresponding to the sgRNA, as shown in SEQ ID NO.4, for knocking out the minC gene. The DNA sequence corresponding to the sgRNA is then amplified by PCR, and a minC-RNA FWD (forward primer, as shown in SEQ ID NO.9) and a minC-RNA REV (reverse primer, as shown in SEQ ID NO.10) for knocking out the minC gene are designed.

[0041] In some embodiments, step S1 is preferably: designing the repair template DNA sequence, as shown in SEQ ID NO.5, for knocking out the minD gene; performing PCR amplification on the repair template DNA sequence; and designing minD-RT FWD1, minD-RT REV1, minD-RT FWD2 and minD-RT REV2 to knock out the minD gene, as shown in SEQ ID NO.11 to SEQ ID NO.14.

[0042] In some embodiments, step S1 is preferably: designing the repair template DNA sequence, as shown in SEQ ID NO. 6, for knocking out the minC gene; performing PCR amplification on the repair template DNA sequence; and designing minC-RT FWD1, minC-RT REV1, minC-RT FWD2 and minC-RT REV2 to knock out the minC gene, as shown in SEQ ID NO. 15 to SEQ ID NO. 18.

[0043] In some implementations, step S3 includes:

[0044] S31. The mixed bacterial culture obtained after step S2 is cultured.

[0045] S32. Design primer sequences for PCR amplification and screen for the desired colonies; preferably, the primers for knocking out the minD gene are minD check FWD1, minD check FWD2 and minD check REV, and the primer sequences are shown in SEQ ID NO. 19 to SEQ ID NO. 21; preferably, the primers for knocking out the minC gene are minC check FWD1, minC check REV1 and minC check REV2, and the primer sequences are shown in SEQ ID NO. 22 to SEQ ID NO. 24;

[0046] S33. The colonies obtained after step S32 are cultured to eliminate plasmids containing the DNA sequence corresponding to the sgRNA and the repair template DNA sequence.

[0047] S34. The colonies obtained after step S33 are cultured to eliminate the pCas plasmid.

[0048] In some embodiments, the mixed bacterial culture obtained after step 2 is cultured overnight on LB agar plates containing the relevant antibiotics and inducers. The relevant antibiotics are preferably kanamycin and spectinomycin. The inducer is preferably arabinose.

[0049] In some embodiments, the colonies obtained after step S32 are cultured overnight in a medium containing the relevant antibiotic to eliminate plasmids containing the DNA sequence corresponding to the sgRNA and the repair template DNA sequence. The relevant antibiotic is preferably kanamycin.

[0050] In some embodiments, the colonies obtained after step S33 are cultured overnight on LB agar plates containing an inducer to eliminate the pCas plasmid. The inducer is preferably IPTG.

[0051] Thirdly, this application provides a small cell produced by the aforementioned genetically engineered bacterial strain. The small cell is a small, spherical cell produced by the abnormal division of rod-shaped bacteria. The small cell is biologically active and does not contain chromosomal DNA, and cannot grow or reproduce by division.

[0052] In some embodiments, the diameter of the microcells is 50–800 nm. The smaller the diameter of the microcells, the less likely they are to be detected by the immune system of the human or other animals, resulting in a smaller immune response. In some embodiments, the diameter is 50 nm, 100 nm, 150 nm, 200 nm, 250 nm, 300 nm, 350 nm, 400 nm, 450 nm, 500 nm, 550 nm, 600 nm, 650 nm, 700 nm, 750 nm, 800 nm, or any combination of two of the above values. In some embodiments, the diameter of the microcells is 50–600 nm.

[0053] In some embodiments, the average diameter of the microcells is 100–350 nm. In some embodiments, the average diameter is a range of 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, 210 nm, 220 nm, 230 nm, 240 nm, 250 nm, 260 nm, 270 nm, 280 nm, 290 nm, 300 nm, 310 nm, 320 nm, 330 nm, 340 nm, 350 nm, or any two of the above values. In some embodiments, the average diameter of the microcells is 100–250 nm.

[0054] In some embodiments, based on the number of microcells, 80% of the microcells have a diameter of 100–450 nm. In some embodiments, the diameter is a range of 100 nm, 120 nm, 140 nm, 160 nm, 180 nm, 200 nm, 220 nm, 240 nm, 260 nm, 280 nm, 300 nm, 320 nm, 340 nm, 360 nm, 380 nm, 400 nm, 420 nm, 440 nm, 450 nm, or any two of the above values. In some embodiments, based on the number of microcells, 80% of the microcells have a diameter of 100–350 nm.

[0055] Fourthly, this application provides a method for purifying the small cells, the method comprising: centrifuging and / or filtering the bacterial culture to obtain a filtrate, passing the filtrate through ultra-high speed centrifugation and / or filtering to obtain a precipitate, and resuspending the precipitate in 1×PBS buffer to obtain purified small cells.

[0056] This purification method is simple to operate, and by changing the size of the filter membrane pores, it can be applied to the purification of other nanoparticles of similar size, including but not limited to small cells, liposomes, exosomes, etc. from other sources.

[0057] In some embodiments, the method includes: filtering the bacterial culture through a filter membrane to obtain a filtrate, obtaining a precipitate by ultracentrifugation or filtration through a filter membrane, and resuspending the precipitate in 1×PBS buffer to obtain purified small cells.

[0058] In some embodiments, the concentration of small cells obtained by the above purification method is not less than 10^9 cells / mL.

[0059] Example

[0060] The present application will be further described in detail below with examples and comparative examples, but the present application is not limited to these examples as long as it does not depart from its spirit.

[0061] In the following examples, the LB culture medium is formulated as follows: containing 10 g of tryptone, 5 g of yeast extract, and 10 g of sodium chloride (NaCl), with water added to a volume of 1 liter (L).

[0062] All reagents used in the following examples are commercially available.

[0063] Example 1: Construction of Escherichia coli ClearColi BL21(DE3) minC and / or minD gene deletion strain

[0064] This invention utilizes λ-Red homologous recombination technology and CRISPR / Cas9 gene editing technology to knock out the minC and / or minD genes in the ClearColi BL21(DE3) genome, obtaining ClearColi BL21(DE3) strains lacking the minC and / or minD genes. Alternatively, this invention can also use the Red / ET system technology based on homologous recombination for gene editing to obtain ClearColi BL21(DE3) strains lacking the minC and / or minD genes.

[0065] This embodiment uses the ClearColi BL21(DE3) Escherichia coli strain as an example. Using λ-Red homologous recombination technology and CRISPR / Cas9 gene editing technology, a ClearColi BL21(DE3) strain with the minC or minD gene deletion was constructed. The nucleotide sequence of the minD gene is shown in SEQ ID NO.1; the nucleotide sequence of the minC gene is shown in SEQ ID NO.2. The construction method includes the following steps:

[0066] S1. Design sgRNAs targeting the minC or minD genes, and construct plasmids (pTarget F_minC plasmid or pTarget F_minD plasmid) containing the DNA sequence corresponding to the sgRNA and the repair template DNA sequence.

[0067] sgRNA design: via http: / / chopchop.cbu.uib.no The website design targets the sgRNA of the *E. coli* minD or minC gene. The DNA sequence corresponding to the sgRNA used to knock out the minD gene is shown in SEQ ID NO.3 as: actcgtcggcgtgatcccag; the DNA sequence corresponding to the sgRNA used to knock out the minC gene is shown in SEQ ID NO.4 as: cagccagtattcacctgcga.

[0068] sgRNA amplification: The DNA sequence corresponding to the sgRNA was amplified by PCR (polymerase chain reaction) using Q5 high-fidelity DNA polymerase (provided by New England Biolabs, NEB). For the amplification reaction, the primers used to knock out the minD gene included minD-RNA FWD (forward primer, as shown in SEQ ID NO.7) and minD-RNA REV (reverse primer, as shown in SEQ ID NO.8); for the amplification reaction, the primers used to knock out the minC gene included minC-RNA FWD (forward primer, as shown in SEQ ID NO.9) and minC-RNA REV (reverse primer, as shown in SEQ ID NO.10).

[0069] Design and amplification of repair template DNA sequences: The repair template DNA sequence for knocking out the minD gene is shown in SEQ ID NO. 5; the repair template DNA sequence for knocking out the minC gene is shown in SEQ ID NO. 6. The repair template DNA sequences were amplified by PCR using the same Q5 high-fidelity DNA polymerase and primers (minD-RT FWD1, minD-RT REV1, minD-RT FWD2, and minD-RT REV2 for knocking out the minD gene, as shown in SEQ ID NO. 11 to SEQ ID NO. 14; and minC-RT FWD1, minC-RT REV1, minC-RT FWD2, and minC-RT REV2 for knocking out the minC gene, as shown in SEQ ID NO. 15 to SEQ ID NO. 18). After separation by gel electrophoresis, the PCR products were purified using a gel extraction kit (provided by OMEGA) to remove excess salt, unbound primers, and other impurities.

[0070] DNA fragment assembly: The purified DNA sequence containing the sgRNA and the repair template DNA sequence were assembled using the NEBuilder HiFi DNA Assembly Kit (provided by NEB) to construct a complete CRISPR / Cas9 editing vector. The assembled vector was confirmed using appropriate validation methods (such as electrophoresis, PCR, or sequencing) and then introduced into the pTargetF plasmid to obtain either the pTargetF_minC or pTargetF_minD plasmid.

[0071] S2. Transform the pTarget F_minC plasmid or pTargetF_minD plasmid obtained in step S1 into an electrotransformation competent Escherichia coli strain containing the pCas plasmid.

[0072] The ClearColi BL21(DE3) strain containing the pCas plasmid was cultured overnight. The culture was diluted 1:100 into 150 mL of fresh LB medium containing kanamycin (50 μg / mL) and arabinose (10 mM). The culture was incubated at 30 °C with shaking at 250 rpm until the OD600 was approximately 0.7. The culture was then treated to convert the cells into electrotransformed competent cells.

[0073] Mix 50 μL of electrotransformed competent ClearColi pCas cells with 100 ng of pTarget F_minC or pTarget F_minD plasmid. Transfer the mixture to a 0.2 cm bio-rad electroporation cuvette and pulse electroporate at 2.5 kV using a MicroPulser (Bio-rad). Immediately after electroporation, add 1 mL of fresh LB medium to the cuvette and mix using a pipette. Transfer the mixture to an Eppendorf tube and incubate at 30 °C with shaking at 250 rpm for 2 hours.

[0074] S3. Screen the strains obtained in step S2 to obtain strains with the target gene deletion.

[0075] Spread 400 μL of the mixture onto LB agar plates containing kanamycin (50 μg / mL), spectinomycin (50 μg / mL), and arabinose (10 mM), and incubate overnight at 30°C.

[0076] On the second day, colony PCR was performed using primers minD check FWD1, minD check FWD2, and minD check REV (as shown in SEQ ID NO.19 to SEQ ID NO.21) to verify whether the knockout of the minD gene was successful; colony PCR was performed using primers minC check FWD1, minC check REV1, and minC check REV2 (as shown in SEQ ID NO.22 to SEQ ID NO.24) to verify whether the knockout of the minC gene was successful.

[0077] like Figure 4 The image shows the PCR identification results of the ClearColi BL21(DE3) minD gene knockout colonies in this embodiment. The primers used were minD check FWD1, minD check FWD2, and minD check REV, with primer sequences shown in SEQ ID NO. 19 to SEQ ID NO. 21. WT represents the wild-type ClearColi BL21(DE3) strain, with a theoretical band size of 782 bp, and KO represents the ClearColi BL21(DE3) minD gene-deleted strain constructed in this embodiment, with a theoretical band size of 1090 bp. Figure 4 The results shown are consistent with the theoretical values.

[0078] like Figure 5The image shows the PCR identification results of the ClearColi BL21(DE3) minC gene knockout colonies in this embodiment. The primers used were minC check FWD1, minC check REV1, and minC check REV2, with primer sequences shown in SEQ ID NO. 22 to SEQ ID NO. 24. WT represents the wild-type ClearColi BL21(DE3) strain, with a theoretical band size of 520 bp, and KO represents the ClearColi BL21(DE3) minC gene-deleted strain constructed in this embodiment, with a theoretical band size of 904 bp. Figure 5 The results shown are consistent with the theoretical values.

[0079] Successfully knocked-out colonies were cultured in LB medium containing kanamycin (50 μg / mL) and IPTG (0.5 mM) and incubated overnight at 30°C with shaking at 250 rpm to eliminate pTarget F_minC or pTarget F_minD plasmids.

[0080] The culture was then spread on LB agar plates containing IPTG (0.5 mM) and incubated overnight at 42°C to eliminate the pCas plasmid.

[0081] Colony screening was performed using LB agar medium containing kanamycin (50 μg / mL) and spectinomycin (50 μg / mL). The obtained colonies had successfully lost the minC or minD gene and were used to amplify the ClearColi BL21(DE3) minC or minD gene-deleted strain in LB medium.

[0082] Table 1. Gene and primer sequences for constructing *Escherichia coli* strains with deletions of the minC or minD gene (ClearColi BL21(DE3)).

[0083]

[0084]

[0085]

[0086]

[0087] The present invention can also combine the above construction method to simultaneously knock out the minC and minD genes of the ClearColi BL21(DE3) Escherichia coli strain to obtain the ClearColi BL21(DE3) minC and minD gene deletion strain.

[0088] The ClearColi BL21(DE3)minC and / or minD gene deletion strain constructed in this invention leads to abnormal cell division, producing small cells with an average diameter between 100 and 350 nm. These small cells are biologically active, do not contain chromosomal DNA, and cannot grow or reproduce. The average diameter of these small cells is smaller than that of small cells produced by other bacteria reported to date. Therefore, these small cells will elicit a smaller immune response from the body. Furthermore, the modified LPS produces a lower cytotoxicity, significantly reducing side effects when applied to humans or animals.

[0089] This invention can also knock out the minC and / or minD genes in other types of Escherichia coli strains or other rod-shaped bacterial strains (Bacillus subtilis, Salmonella typhimurium, Pseudomonas aeruginosa, Corynebacterium glutamicum, or Listeria monocytogenes) using the above construction method to obtain corresponding minC and / or minD gene-deficient strains. Based on the modification effect of the ClearColi BL21(DE3) Escherichia coli strain in this invention, the modification effect of other types of Escherichia coli strains or other rod-shaped bacterial strains can be expected.

[0090] Example 2: Purification and GFP expression verification of small cells from ClearColi BL21(DE3)minD gene-deleted strain

[0091] A plasmid containing GFP was introduced into the ClearColi BL21(DE3)minD gene-deleted strain to ensure spontaneous expression of green fluorescent protein under IPTG induction, which facilitates the subsequent identification and purification of small cells.

[0092] Single clones were picked from LB plates of ClearColi BL21(DE3)minD gene deletion strain containing GFP plasmid and placed in 10 mL of medium (final concentration of chloramphenicol 50 μg / mL) and cultured overnight at 37 °C and 250 rpm.

[0093] The overnight culture was inoculated into the culture medium at a ratio of 1:100 (final concentration of chloramphenicol 50 μg / mL), and cultured until the OD600 reached approximately 0.6. IPTG was then added to a final concentration of 0.5 mM, and the culture was incubated overnight to induce GFP expression. The green fluorescence of the ClearColi BL21(DE3)minD gene-deleted strain expressing green fluorescent protein was observed under an OLYMPUS BX53 microscope as shown in the image. Figure 1a As shown, its bright field photograph is as follows: Figure 1b As shown.

[0094] After centrifuging the overnight bacterial culture, the supernatant was collected. The supernatant was then filtered through a membrane, and the filtrate was collected by ultracentrifugation or membrane filtration. The filtrate was resuspended in 1×PBS. The resuspended sample was diluted 6-fold and the particle size and concentration of the purified small cells were detected using a NanoSight NS3000. The NanoSight NS3000 results are shown below. Figure 2 As shown, the concentration of small cells was 8 × 10^9 cells / mL, and the diameter of the small cells ranged from 97.5 nm to 749.5 nm, with an average diameter of 186.4 nm. Approximately 80% of the small cells, based on their number, had a diameter between 115.2 nm and 306.6 nm. The green fluorescence of small cells expressing green fluorescent protein observed under an OLYMPUS X53 microscope is shown in the image below. Figure 3a As shown, its enlarged partial view is as follows: Figure 3b As shown.

[0095] The purification methods of the present invention can be applied to the purification of other nanoparticles of similar size, including but not limited to small cells, liposomes, exosomes, etc. from other sources.

[0096] Test methods

[0097] 1. Methods for testing small cell size and concentration

[0098] Approximately 600 μL of the prepared sample was added to the sample detection chamber of the NanoSight NS3000 via syringe and detected at room temperature, with each sample measured three times. The particle size distribution and concentration of small cells were recorded and analyzed using NanoSight NTA 3.4 software.

[0099] 2. Fluorescence Imaging Test Methods

[0100] An OLYMPUS X53 microscope with a 100W mercury lamp was used. The excitation wavelength for fluorescence detection was between 460 nm and 495 nm, and the absorption wavelength was between 510 nm and 550 nm. 10 μL of bacterial culture was placed on a microscope slide, covered with a coverslip, and observed under a fluorescence microscope to obtain a green fluorescence image of the ClearColi BL21(DE3)minD gene-deleted strain.

[0101] An OLYMPUS X53 microscope with a 100W mercury lamp was used. The excitation wavelength for fluorescence detection was between 460 nm and 495 nm, and the absorption wavelength was between 510 nm and 550 nm. 10 μL of purified and resuspended small cell solution was placed on a microscope slide, covered with a coverslip, and observed under a fluorescence microscope to obtain a green fluorescence image of the small cells.

[0102] 3. Determination of colony PCR identification results

[0103] After passing the colony PCR products through 1% agarose gel electrophoresis (100V, 30 minutes), the agarose gel was then photographed using a Bio-Rad imager.

[0104] Although illustrative embodiments have been demonstrated and described, those skilled in the art should understand that the above embodiments should not be construed as limiting the present application, and that changes, substitutions and modifications can be made to the embodiments without departing from the spirit, principles and scope of the present application.

Claims

1. A genetically engineered bacterial strain, characterized in that, The genetically engineered strain is a target gene deletion strain obtained by knocking out the target gene in a rod-shaped bacterial strain. The target gene is one of the minC and minD genes or a combination thereof.

2. The genetically engineered strain according to claim 1, characterized in that, The rod-shaped bacteria include one of Escherichia coli, Bacillus subtilis, Salmonella typhimurium, Pseudomonas aeruginosa, Corynebacterium glutamicum, and Listeria monocytogenes.

3. The genetically engineered strain according to claim 1, characterized in that, The strain in question is ClearColi BL21(DE3) Escherichia coli.

4. A method for constructing a genetically engineered strain according to any one of claims 1 to 3, characterized in that, The method includes knocking out a target gene in the rod-shaped bacterial strain to obtain a target gene-deleted strain, wherein the knockout is achieved by means of homologous recombination technology and CRISPR technology or a combination thereof.

5. The method according to claim 4, characterized in that, The method includes: S1. Design the DNA sequence corresponding to the sgRNA targeting the target gene and the repair template DNA sequence, and construct a plasmid containing the DNA sequence corresponding to the sgRNA and the repair template DNA sequence; S2. The plasmid obtained in step S1 is transferred into a strain containing the pCas plasmid. S3. Screen the strains obtained in step S2 to obtain strains with the target gene deletion.

6. The method according to claim 5, characterized in that, Step S3 includes: S31. The mixed bacterial solution obtained after step S2 is cultured. S32. Design primer sequences for PCR amplification and screen out the desired colonies; S33. The colonies obtained after step S32 are cultured to eliminate plasmids containing the DNA sequence corresponding to the sgRNA and the repair template DNA sequence. S34. The colonies obtained after step S33 are cultured to eliminate the pCas plasmid.

7. A type of small cell, characterized in that, The small cells are produced by the genetically engineered strain according to any one of claims 1 to 3.

8. The small cell according to claim 7, characterized in that, The small cells meet at least one of the following conditions: (1) The diameter of the small cells is 50-800 nm; (2) The average diameter of the small cells is 100-350 nm; (3) Of the number of the microcells, 80% of the microcells have a diameter of 100-450 nm.

9. The method for purifying small cells according to claim 7 or 8, characterized in that, The method includes: The bacterial culture is centrifuged and / or filtered through a membrane to obtain a filtrate. The filtrate is then subjected to ultra-high-speed centrifugation and / or membrane filtration to obtain a precipitate. The precipitate is resuspended in 1×PBS buffer to obtain purified small cells.

10. The method according to claim 9, characterized in that, The concentration of small cells obtained by the method is not less than 10^9 cells / mL.

Images