Application of m5C methyltransferase NSUN2 in preparation of multiple myeloma diagnosis and treatment product

By leveraging the high expression characteristics of NSUN2, we developed early diagnostic kits and therapeutic drugs for multiple myeloma, solving the challenges of early screening and treatment of multiple myeloma, achieving precise diagnosis and treatment of multiple myeloma, and significantly improving patient survival.

CN121852536APending Publication Date: 2026-04-14THE SECOND AFFILIATED HOSPITAL OF NAVAL MEDICAL UNIVERSITY PLA
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
THE SECOND AFFILIATED HOSPITAL OF NAVAL MEDICAL UNIVERSITY PLA
Filing Date
2025-12-02
Publication Date
2026-04-14

Smart Images

  • Figure CN121852536A_ABST
    Figure CN121852536A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of medical biological detection, and provides novel application of NSUN2, in particular to application in preparation of reagents or kits for diagnosis, staging and prognosis evaluation of multiple myeloma, and diagnosis and prognosis evaluation of liver multiple myeloma are realized by detecting the expression quantity of NSUN2 in a biological sample. The invention further provides application of the reagent for inhibiting or silencing NSUN2 expression in preparation of drugs for treating multiple myeloma, and the reagent can inhibit multiplication capacity of multiple myeloma and promote death of tumor cells through targeted down-regulation of NSUN2 expression so as to finally improve or treat multiple myeloma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology and relates to the application of NSUN2 as a biomarker for multiple myeloma, specifically the application of NSUN2 in the preparation of diagnostic reagents or kits for multiple myeloma and in therapeutic drug compositions. Background Technology

[0002] Multiple myeloma (MM) is a hematologic malignancy characterized by the abnormal clonal proliferation of plasma cells in the bone marrow, accounting for approximately 10% of all hematologic malignancies. In recent years, the clinical application of novel therapies has significantly improved the median survival of MM patients, extending it from less than 3 years to 7-10 years. However, the survival rate of high-risk patients still does not exceed the 3-year threshold, and the early symptoms of the disease are often insidious. Traditional detection technologies are limited by insufficient sensitivity, making early screening for MM difficult using existing methods alone. Against this backdrop, in-depth exploration of the pathogenesis of MM and the identification of precise and efficient early diagnostic and therapeutic targets are of crucial clinical value in delaying disease progression, improving patient survival rates, and optimizing prognostic outcomes.

[0003] The pathogenesis of multiple myeloma (MM) is complex, and RNA methylation modification has made significant progress in the study of MM pathogenesis in recent years, playing a key role in the occurrence, progression, and drug resistance of MM. Among them, m5C, as one of the common forms of RNA methylation modification, plays an important role in regulating the expression of key genes in MM, participating in the remodeling of the immune microenvironment in MM, and mediating drug resistance in MM (LI P et al. NSUN2-mediated RNA methylation: Molecular mechanisms and clinical relevance in cancer. Cellular Signalling, 2024, 123.).

[0004] NOP2 / Sun RNA methyltransferase 2 (NSUN2) is an important m5C RNA methyltransferase in mammals that catalyzes methylation of tRNA, mRNA, and non-coding RNA. It participates in the regulation of RNA stability, translation efficiency, and subcellular localization, thereby playing a key role in cell proliferation, differentiation, and stress response. Recent studies have shown that NSUN2 promotes the proliferation, death, and metastasis of various tumors through an m5C-dependent mechanism (CHEN B et al. Metabolic Recoding of NSUN2‐Mediated m5C Modification Promotes the Progression of Colorectal Cancer via the NSUN2 / YBX1 / m5C‐ENO1 PositiveFeedback Loop. Advanced Science, 2024, 11(28). LING H et al. Diffuse large B-cell lymphoma cell-derived exosomal NSUN2 stabilizes PDL1 to promote tumor immune escape and M2 macrophage polarization in a YBX1-dependent manner. Archives of biochemistry and biophysics, 2025, 766: 110322.). Currently, there is still a significant gap in research on the molecular mechanisms of NSUN2 in the development and progression of multiple myeloma. Key scientific questions that urgently need clarification include: whether there is abnormal regulation of NSUN2 expression in the MM tumor microenvironment; the correlation between its differential expression and MM disease progression; and whether NSUN2, as a key enzyme in RNA methylation modification, can participate in MM disease progression by regulating MM cell proliferation and death. Systematic investigation of these scientific questions will provide important theoretical basis for revealing the epigenetic regulatory network of MM and developing novel therapeutic targets. Summary of the Invention

[0005] This invention is based on the above research and aims to provide a biomarker for the diagnosis of multiple myeloma, as well as to provide a new use for NSUN2, namely, its application in the preparation of early diagnostic kits or therapeutic drug compositions for multiple myeloma.

[0006] This invention first identifies differentially expressed m5C methylation modifying factors in multiple myeloma through expression analysis. Next, it analyzes the expression and survival of NSUN2 in multiple myeloma cell lines and bone marrow tissue to determine independent prognostic factors. The study found that high expression of NSUN2 is associated with poor prognosis in myeloma and is an independent prognostic factor for myeloma patients. Subsequently, by comparing the expression levels of NSUN2 in newly diagnosed, disease-progressing, and complete remission stages, it was found that the NSUN2 expression levels in newly diagnosed and disease-progressing MM patients were significantly higher than those in healthy controls and those in complete remission. The NSUN2 expression level in disease-progressing MM patients was also significantly higher than that in newly diagnosed MM patients. Further examination of peripheral blood NSUN2 expression differences among different disease stages (ISS and R-ISS stages) in newly diagnosed MM patients showed that ISS III and R-ISS III MM patients had significantly higher peripheral blood NSUN2 expression levels compared to ISS I / II and R-ISS I / II patients, which can be used for refined diagnostic staging of multiple myeloma. Then, NSUN2 expression in MM cells was inhibited, and the proliferation and death capacity of MM cells were detected. The value of NSUN2 in the accurate diagnosis and treatment of multiple myeloma was analyzed, thus providing an effective molecular basis for the diagnosis, staging, treatment, and prognostic assessment of MM.

[0007] Specifically, the present invention provides the following technical solution:

[0008] In a first aspect, the invention provides the application of NSUN2 as a diagnostic biomarker. Specifically, it provides the application of reagents for detecting NSUN2 in the preparation of kits for the diagnosis, staging, and prognostic assessment of multiple myeloma.

[0009] Preferably, the reagent for detecting NSUN2 is a reagent for detecting the expression level of NSUN2 in biological samples at the gene level and / or protein level; the kit contains the reagent for detecting the expression level of NSUN2 in biological samples.

[0010] Further optimization can be achieved by using existing technologies to detect the expression level of NSUN2, such as Western blot, qRT-PCR, high-throughput sequencing, and immunohistochemistry.

[0011] Furthermore, the reagents used to detect the expression level of NSUN2 in biological samples were selected from those used to detect the expression level of NSUN2 in biological samples by qRT-PCR.

[0012] Further preferred, the reagent for detecting NSUN2 expression in biological samples includes PCR primers with detection specificity for the NSUN2 gene, or antibodies that specifically bind to the NSUN2 protein. The PCR primers with detection specificity for the NSUN2 gene are shown in SEQ ID NO.1 and SEQ ID NO.2, and the primer sequences for the control GAPDH are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0013] In a second aspect, the present invention provides a kit for the diagnosis, staging or prognostic assessment of multiple myeloma, the kit comprising reagents for detecting the NSUN2 content in biological samples.

[0014] The kit for detection at the gene level consists of a reverse transcription system, a primer system, and an amplification system. The primer system includes PCR primers as shown in SEQ ID NO.1–4.

[0015] NSUN2-F primers: GTTTGACTGTGCTTTCCGGC (SEQ ID NO.1);

[0016] NSUN2-R primers: TCAGCACGATGCTTCCCTTT (SEQ ID NO.2);

[0017] GAPDH-F primer: CTTAGCACCCCTGGCCAAG; (SEQ ID NO.3);

[0018] GAPDH-R primer: TGGTCATGAGTCCTTCCACG (SEQ ID NO. 4).

[0019] Furthermore, the biological sample is selected from either tumor tissue obtained by puncture or blood collected from the patient for testing NSUN2 levels, thereby enabling disease diagnosis and prognostic assessment.

[0020] Furthermore, when conducting staging diagnosis, the expression levels of NSUN2 in different stages can be statistically analyzed based on a large number of samples in the early stages. For the sample to be tested, the expression level of NSUN2 is first used to determine whether it belongs to the initial diagnosis stage, the disease progression stage, or the complete remission stage. If it is determined to be in the initial diagnosis stage, it is further determined whether it belongs to stage I / II or stage III of the ISS or R-ISS staging.

[0021] A third aspect of the invention provides the use of a substance that inhibits or silences NSUN2, namely, its use in the preparation of a medicament for treating multiple myeloma.

[0022] Preferably, the substance that inhibits or silences NSUN2 is an shRNA that inhibits NSUN2 expression, or a recombinant expression vector or transgenic cell line containing the shRNA, and the target sequence of the shRNA is shown below:

[0023] GAGCGATGCCTTAGGATATTA (SEQ ID NO. 5).

[0024] In a fourth aspect, the present invention provides a pharmaceutical composition for treating multiple myeloma, comprising an active component and a pharmaceutically acceptable carrier, said active component comprising an shRNA that inhibits NSUN2 expression or a recombinant expression vector or transgenic cell line containing said shRNA, said shRNA having a target sequence as shown in SEQ ID NO. 5.

[0025] A fifth aspect of the present invention provides a product comprising at least one of the second and third aspects. The product has at least one function of (1)-(3):

[0026] (1) Diagnosis and / or prevention of multiple myeloma;

[0027] (2) Inhibits the proliferation of multiple myeloma cells;

[0028] (3) Promotes cell death in multiple myeloma;

[0029] The multiple myeloma cells were RPMI-8226 and U266 cells.

[0030] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0031] This invention discloses for the first time the application value of NSUN2 as a novel target for the diagnosis and treatment of multiple myeloma. Studies have confirmed that NSUN2 is specifically and highly expressed in multiple myeloma patients, and its expression level is significantly correlated with the clinical stage of MM and negatively correlated with overall survival. This indicates that NSUN2 can serve as a highly specific and sensitive biomarker, providing a novel molecular target for the accurate diagnosis, disease staging, and prognostic prediction of MM.

[0032] This invention discloses for the first time the application of inhibiting NSUN2 in the prevention and treatment of multiple myeloma. By targeting and inhibiting the expression of NSUN2, the proliferation activity of tumor cells can be effectively inhibited and cell death can be activated, thus opening up a new path for targeted therapy of MM.

[0033] The present invention also provides shRNA targeting NSUN2 and recombinant expression vectors or transgenic cell lines containing it, which can inhibit the proliferation of multiple myeloma cells and promote tumor cell death by targeting and downregulating NSUN2 expression, ultimately improving or treating multiple myeloma.

[0034] In terms of detection technology, this invention employs real-time quantitative PCR to detect NSUN2. This method, based on the quantitative analysis of gene expression in blood cells, boasts advantages such as standardized operation procedures, high detection sensitivity, strong specificity, and good repeatability. As a mature technology widely used in clinical testing, its detection results have reliable accuracy and clinical reference value. Research data show that the expression level of NSUN2 in the bone marrow tissue of MM patients is significantly higher than that in normal controls (P<0.05), fully validating its clinical application value as a diagnostic and / or prognostic biomarker. It also confirms the effectiveness and feasibility of targeted regulation of NSUN2 in MM treatment, demonstrating high clinical reference value and reliability. Attached Figure Description

[0035] Figure 1 The expression levels of m5C-related methylation modifiers in normal controls and MM tumor patients are shown in Figure 1: A is a violin plot of m5C methylation modifier expression in normal controls and MM tumor patients; B is a heatmap of differential m5C methylation modifier expression in normal controls and MM tumor patients.

[0036] Figure 2 This invention uses NSUN2 as a diagnostic and / or prognostic biomarker for multiple myeloma: A represents the expression of NSUN2 in normal human plasma cells and multiple myeloma cells; B represents the expression of NSUN2 in 10 normal controls and 10 myeloma patients; C represents the expression level of NSUN2 in the peripheral blood of MM patients and healthy controls at different disease stages; D represents the difference in NSUN2 expression in the peripheral blood of MM patients at different ISS stages; E represents the difference in NSUN2 expression in the peripheral blood of MM patients at different R-ISS stages; and F represents the overall survival analysis of myeloma patients.

[0037] Figure 3 To demonstrate that downregulating NSUN2 can inhibit the proliferation of multiple myeloma cells and promote their death: A shows the efficiency of downregulating NSUN2 after stable transfection of the doxcycline (DOX)-regulated shRNA NSUN2 into multiple myeloma cell lines RPMI-8226 and U266 with DOX; B shows the proliferation of RPMI-8226 and U266 cells after NSUN2 downregulation; and C shows the cell death of RPMI-8226 and U266 cells after NSUN2 downregulation. Detailed Implementation

[0038] The present invention will now be described in detail with reference to the embodiments and accompanying drawings, but the implementation of the present invention is not limited thereto.

[0039] All reagents and raw materials used in this invention are commercially available or can be prepared according to literature methods. Experimental methods in the following examples, unless otherwise specified, are generally performed under conventional conditions as described in Sambrook et al., *Molecular Cloning: A Laboratory Guide* (New York: Cold Spring Harbor Laboratory Press, 1989), or under conventional conditions, or as recommended by the manufacturer.

[0040] Example 1: Expression patterns of different m5C methylation modifiers in MM

[0041] RNA-seq data for multiple myeloma were downloaded from the GEO databases (GSE5900 and GSE4581) to obtain gene expression data from normal and myeloma samples. This study fully followed the relevant guidelines provided by GEO. Subsequently, the expression levels of 17 m5C methylation modifiers were calculated in normal controls and MM tumor patients, and the results are as follows: Figure 1 As shown.

[0042] Example 2: NSUN2 can serve as a diagnostic and / or prognostic biomarker for multiple myeloma.

[0043] To clarify the expression of NSUN2 in multiple myeloma, NSUN2 expression was detected in bone marrow and peripheral blood samples from human multiple myeloma cell lines, normal controls, and multiple myeloma patients using real-time quantitative reverse transcription PCR (qRT-PCR). RPMI-8226 and U266 cell lines were preserved at Shanghai Changzheng Hospital. Patient clinical specimens were confirmed by clinicians to be multiple myeloma. The reverse transcription system and conditions are shown in Table 1 below (using the reverse transcription kit from Aike Rui Company):

[0044] Table 1 Reverse transcription system

[0045]

[0046] The reverse transcription reaction conditions were: 37℃, 15 min; 85℃, 5 s; 4℃, ∞.

[0047] The RT-PCR system and conditions are shown in Table 2 below (RT-PCR kit from Aike Rui Company):

[0048] Table 2 RT-PCR system

[0049]

[0050] The amplification conditions were: 94℃ for 30 seconds; 55–60℃ for 30 seconds; and 72℃ for 1 minute. These three steps were repeated for a total of 40 cycles.

[0051] The primer sequences used in the PCR reaction are shown in Table 3:

[0052] Table 3 qRT-PCR primer sequences

[0053]

[0054] The results showed that NSUN2 was highly expressed in MM cells compared with normal plasma cells. Figure 2 A); the bone marrow tumor tissue examination results of patients with multiple myeloma were consistent with those of cells ( Figure 2 (B) This indicates that NSUN2 is highly likely to be specifically expressed in myeloma. Next, peripheral blood samples were collected from 120 MM patients admitted to Shanghai Changzheng Hospital, including 60 newly diagnosed patients, 30 patients in the disease progression stage, and 30 patients in complete remission, as well as 60 healthy individuals as normal controls. The expression level of NSUN2 in peripheral blood was detected using qRT-PCR. Comparison of NSUN2 expression levels in peripheral blood from MM patients at different disease stages with healthy controls revealed that NSUN2 expression levels were significantly higher in newly diagnosed and disease progression-stage MM patients compared to healthy controls. NSUN2 expression levels were also significantly higher in newly diagnosed and disease progression-stage MM patients compared to those in complete remission. Furthermore, NSUN2 expression levels in disease progression-stage MM patients were significantly higher than those in newly diagnosed MM patients. Figure 2 C). Subsequently, qRT-PCR was used to detect differences in peripheral blood NSUN2 expression among newly diagnosed MM patients at different disease stages (ISS stage and R-ISS stage). The results showed that MM patients with ISS III and R-ISS III had significantly higher peripheral blood NSUN2 expression levels compared to patients with ISS I / II and R-ISS I / II. Figure 2 (D and E).

[0055] Subsequently, survival curve analysis was performed on myeloma patients to assess whether NSUN2 could be used as an independent prognostic factor. The median NSUN2 expression was used as the cutoff value (HTseq-Count) to identify the two groups (low and high expression) of NSUN2 in myeloma samples. Results are as follows... Figure 2 As shown in Figure F, patients with high NSUN2 expression had shorter overall survival compared to those with low NSUN2 expression. This indicates that high NSUN2 expression is associated with poor prognosis in multiple myeloma and is an independent prognostic factor for the disease. These results suggest that NSUN2 can serve as a diagnostic and / or prognostic biomarker for multiple myeloma.

[0056] Example 3: Downregulation of NSUN2 can inhibit the proliferation of multiple myeloma cells and promote their death.

[0057] To further clarify the function and mechanism of NSUN2 in the progression of multiple myeloma, we first constructed a DOX-induced shRNA-NSUN2 plasmid and coated it with lentivirus. The target sequence of shRNA-NSUN2 is: GAGCGGATGCCTTAGGATATTA (SEQ ID NO.5).

[0058] Multiple myeloma cell lines RPMI-8226 and U266 were infected using a lentiviral vector with an MOI of 50. After 72 hours, both the control and virus-infected cell groups were simultaneously screened with 5 μg / ml puromycin, and all uninfected cells were killed. Subsequently, 5 μg / ml DOX was added to the infected cells to induce shRNA-NSUN2 expression, and cell samples were collected after 48 hours of culture. The downregulation efficiency of the NSUN2 gene was detected using RT-PCR and Western blot immunoblotting (Figure 3A). The results showed that the downregulation efficiency of NSUN2 was approximately 60%-75%, indicating successful construction of a DOX-induced stable shRNA-NSUN2 transfectant.

[0059] Subsequently, we used CCK8 and colony formation methods to detect the effect of NSUN2 on the proliferation of MM cells RPMI-8226 and U266.

[0060] The CCK8 testing method is as follows:

[0061] After resuspending RPMI-8226 and U266 cells in logarithmic growth phase, 4000 cells were added to each well of a 96-well plate, and 5 μg / ml DOX was added to induce shRNA-NSUN2 expression. Cells were cultured in 100 μL of complete culture medium at 37°C with 5% CO2 for 24 hours. At 0, 24, 48, 72, and 96 hours, 10 μL of CCK-8 solution was added to the detection wells, and cell proliferation was detected at 450 nm.

[0062] CCK8 assay results showed that after downregulating NSUN2, the proliferation rate of RPMI-8226 and U266 cells was significantly slowed down. Figure 3 B) indicates that high expression of NSUN2 can promote the proliferation of RPMI-8226 and U266 cells.

[0063] Next, we continued to use cell staining and flow cytometry to detect the effect of NSUN2 on the death of MM cells RPMI-8226 and U266. The steps are as follows:

[0064] After downregulating the NSUN2 gene in multiple myeloma cells using the above method, the cells were collected and processed as follows: First, the cells were washed twice with PBS buffer, then the cell suspension was transferred to flow cytometry tubes. 0.5–1 μl of SYTOX™ Green nucleic acid staining agent was added to each tube, and the mixture was briefly vortexed before incubation at room temperature in the dark for 30 minutes. After incubation, 400 μl of PBS buffer was added to each tube for dilution, and finally, the samples were analyzed using a flow cytometer.

[0065] Flow cytometry results showed that, compared with the control group, the group with downregulated NSUN2 experienced more cell death, further indicating that downregulating NSUN2 can promote MM cell death. Figure 3 C).

[0066] The above results indicate that NSUN2 is specifically and highly expressed in multiple myeloma, and its high expression is closely related to the high malignancy of MM patients. Furthermore, peripheral blood sample analysis showed that NSUN2 expression levels were significantly higher in newly diagnosed and disease-progressing patients than in healthy controls and those in complete remission. Simultaneously, NSUN2 expression levels in peripheral blood were significantly higher in ISS stage III and R-ISS stage III patients than in stage I / II patients. Moreover, patients with high NSUN2 expression had shorter overall survival compared to those with low NSUN2 expression. Downregulation of NSUN2 inhibited the proliferation of multiple myeloma cells and promoted cell death. These findings suggest that NSUN2 expression levels are significantly correlated with the occurrence and development of multiple myeloma, indicating its potential as a clinically valuable biomarker for the diagnosis, treatment optimization, and prognostic assessment of multiple myeloma.

[0067] The undescribed parts of this invention are the same as or implemented using existing technology. The applicant declares that this invention is illustrated through the above embodiments, but the invention is not limited to the above detailed methods, i.e., it does not mean that the invention must rely on the above detailed methods to be implemented. Those skilled in the art should understand that any improvements to this invention, equivalent substitutions of raw materials for the product of this invention, additions of auxiliary components, and selection of specific methods all fall within the protection and disclosure scope of this invention.

Claims

1. Application of reagents for detecting NSUN2 expression levels in the preparation of kits for the diagnosis, staging, or prognostic assessment of multiple myeloma.

2. Use according to claim 1, characterized in that, The reagent for detecting NSUN2 is a reagent for detecting the expression level of NSUN2 in biological samples at the gene level and / or protein level; the kit contains reagents for detecting the expression level of NSUN2 in biological samples.

3. Use according to claim 2, characterized in that, The reagents used to detect the expression level of NSUN2 in biological samples are selected from one or more of the following detection techniques or methods: Western blot, qRT-PCR, high-throughput sequencing, and immunohistochemistry.

4. Use according to claim 3, characterized in that, The reagent for detecting NSUN2 expression in biological samples includes PCR primers that are specific to the NSUN2 gene or antibodies that specifically bind to the NSUN2 protein. The PCR primers that are specific to the NSUN2 gene are shown in SEQ ID NO. 1~2.

5. A kit for the diagnosis, staging or prognosis assessment of multiple myeloma, characterized in that, This kit contains reagents for detecting the NSUN2 content in biological samples.

6. The kit of claim 5, wherein The kit consists of a reverse transcription system, a primer system, an amplification system, and an antibody system. The primer system includes PCR primers as shown in SEQ ID NO.1 to 4.

7. The kit of claim 5, wherein When conducting staging diagnosis, the expression level of NSUN2 is first used to determine whether the disease is in the initial diagnosis stage, the disease progression stage, or the complete remission stage. If it is determined to be in the initial diagnosis stage, it is further determined whether it belongs to ISS stage or R-ISS stage I / II or stage III.

8. Application of substances that inhibit or silence NSUN2 in the preparation of drugs for treating multiple myeloma.

9. Use according to claim 8, characterized in that, The substance that inhibits or silences NSUN2 is an shRNA that inhibits NSUN2 expression or a recombinant expression vector or transgenic cell line containing the shRNA, and the target sequence of the shRNA is shown in SEQ ID NO.

5.

10. A pharmaceutical composition for treating multiple myeloma, characterized in that, The invention includes an active ingredient and a pharmaceutically acceptable vector, wherein the active ingredient comprises an shRNA that inhibits NSUN2 expression or a recombinant expression vector or transgenic cell line containing the shRNA, and the target sequence of the shRNA is shown in SEQ ID NO.5.