Medicine for preventing and treating diseases related to abnormal hyperplasia of intestinal tract

By using the IL-10 recombinant adeno-associated virus vector to target and deliver the drug to myeloid cells, the treatment challenges of intestinal dysplasia-related diseases have been solved, resulting in a reduction of intestinal polyps and an improvement in colonic epithelial homeostasis, thus reducing the risk of colorectal cancer and avoiding the side effects of systemic administration.

CN121868458APending Publication Date: 2026-04-17FUDAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
FUDAN UNIVERSITY
Filing Date
2024-10-16
Publication Date
2026-04-17

Smart Images

  • Figure HDA0005087623390000011
    Figure HDA0005087623390000011
  • Figure HDA0005087623390000021
    Figure HDA0005087623390000021
  • Figure HDA0005087623390000022
    Figure HDA0005087623390000022
Patent Text Reader

Abstract

The invention relates to a medicine for preventing and treating diseases related to abnormal hyperplasia of intestinal tracts. Specifically, the research finds that accumulation of myeloid-derived suppressor cells (MDSC) caused by reduction of IL-10 is a main reason for abnormal intestinal epithelial hyperplasia, supplement of IL-10 in myeloid cells of the source is beneficial to recovery of bone marrow microenvironment homeostasis and reduction of generation of pathogenic MDSC, so that diseases related to abnormal intestinal epithelial hyperplasia are treated, and the effect of treating abnormal intestinal epithelial hyperplasia is achieved. For example, inflammatory enteritis, adenomatous polyposis and the like. The recombinant adeno-associated virus vector expressing IL-10 is provided, targeted delivery of IL-10 to myeloid cells is achieved through intramedullary injection, adverse reactions caused by systemic administration are avoided, the recombinant adeno-associated virus vector has high targeting and high safety, and a new scheme is provided for treatment of diseases related to abnormal intestinal hyperplasia.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and more specifically to drugs for the prevention and treatment of diseases related to intestinal dysplasia. Background Technology

[0002] Inflammatory bowel disease (IBD), including Crohn's disease (CD) and ulcerative colitis (UC), is a chronic immune-inflammatory disease affecting the ileum, rectum, colon, and even the entire digestive tract. In Europe and the United States, the incidence of IBD is as high as 0.5%. With modernization, the incidence in newly industrialized countries, including China, is rapidly increasing and showing a trend towards affecting younger people. The mortality rates for UC and CD are 16.4% and 17.8%, respectively, and CD patients face a 70-90% surgical risk, significantly impacting their quality of life and imposing a huge economic burden and high medical costs on society. Currently, treatments for IBD include aminosalicylate, corticosteroids (CS), immunomodulators, and biologics. These drugs are mainly used to control intestinal inflammation; to date, there is still no cure for IBD. Clinically, the incidence of colorectal cancer is significantly increased in patients with long-term ulcerative colitis (UC) or Crohn's disease (CD). The cumulative risk of colorectal cancer in UC patients in Asian countries over 10, 20 and 30 years is 0.02%, 4.8% and 13.9%, respectively, which means that a large number of patients still have to rely on surgical resection to reduce the risk of colorectal cancer.

[0003] Familial adenomatous polyposis (FAP) is a rare autosomal dominant inherited colorectal cancer syndrome, usually caused by a pathogenic germline variant of the adenomatous polyposis (APC) gene. The disease is characterized by the gradual development of hundreds to thousands of adenomatous polyps in the lower digestive tract, particularly the colon and rectum. Without timely treatment, the risk of developing colorectal cancer is almost 100%. Currently, endoscopic monitoring and rectocele are considered the standard treatments for colorectal polyposis. However, effective therapeutic drugs are still lacking. Nonsteroidal anti-inflammatory drugs (NSAIDs) such as sulindac and celecoxib are mainly used to suppress inflammation. Long-term use may help shrink polyps and prevent recurrence of high-grade adenomatous polyps; however, their application is limited due to adverse reactions and other factors.

[0004] Therefore, there is an urgent need in the field to develop novel therapies for diseases characterized by abnormal intestinal proliferation, such as inflammatory bowel disease and / or familial adenomatous polyposis. Summary of the Invention

[0005] The purpose of this invention is to provide novel therapies for the prevention and / or treatment of diseases related to intestinal dysplasia.

[0006] In a first aspect of the invention, there is provided the use of interleukin-10 (IL-10) for preparing a pharmaceutical composition for the prevention and / or treatment of diseases related to intestinal epithelial dysplasia.

[0007] In another preferred embodiment, the intestinal epithelial dysplasia-associated disease is myeloid-derived suppressor cell (MDSC)-mediated intestinal epithelial dysplasia-associated disease.

[0008] In another preferred embodiment, the MDSC-mediated intestinal epithelial dysplasia-related disease is characterized by the accumulation of MDSCs in the lamina propria of the colonic mucosa.

[0009] In another preferred embodiment, the MDSC-mediated intestinal epithelial dysplasia-related diseases include: adenomatous polyposis, inflammatory bowel disease (IBD), colorectal cancer, and intestinal fibrosis.

[0010] In another preferred embodiment, the adenomatous polyposis includes familial adenomatous polyposis (FAP).

[0011] In another preferred embodiment, the inflammatory bowel disease includes Crohn's disease (CD) and ulcerative colitis (UC).

[0012] In another preferred embodiment, the pharmaceutical composition comprises:

[0013] (i) Active ingredient: Expression vector containing the IL-10 coding sequence or recombinant IL-10 protein.

[0014] In another preferred embodiment, the IL-10 includes human IL-10, other mammalian IL-10, such as mouse IL-10.

[0015] In another preferred embodiment, the IL-10 comprises wild-type or mutant IL-10, or its active fragment, or its derivative.

[0016] In another preferred embodiment, the mutant IL-10 has similar or better activity than wild-type IL-10.

[0017] In another preferred embodiment, the expression vector includes a viral vector and a non-viral vector.

[0018] In another preferred embodiment, the viral vector includes, but is not limited to, adeno-associated virus (AAV), lentivirus, adenovirus, retrovirus, etc.

[0019] In another preferred embodiment, the non-viral vector includes, but is not limited to, naked DNA, plasmids, etc.

[0020] In another preferred embodiment, the expression vector is a recombinant adeno-associated virus (AAV) vector.

[0021] In another preferred embodiment, the recombinant adeno-associated virus (AAV) vector comprises:

[0022] (A1)AAV capsid protein; and

[0023] (A2) The viral genome packaged in the AAV capsid protein, the genome containing a foreign gene encoding IL-10.

[0024] In another preferred embodiment, the sequence of the exogenous gene encoding IL-10 is shown in positions 191-724 of SEQ ID NO:1.

[0025] In another preferred embodiment, the adeno-associated virus is selected from the group consisting of: AAV9, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV2-AAV3, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAVHSC15, AAV-HSC17, AAVhu.37, AAVrh.8, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6 (Y445F / Y731F), AAV2.5T, AAV-HAE1 / 2, and AAV clone. 32 / 83, AAVShH10, AAV2(Y->F), AAV8(Y733F), AAV2.15, AAV2.4, AAVM41, AAVr3.45, AAV2 or AAV5.

[0026] In another preferred embodiment, the adeno-associated virus is AAV9.

[0027] In another preferred embodiment, the viral genome also includes regulatory elements, including a promoter, an enhancer, a polyA, a replication origin, a selection marker, and two ITRs located at both ends.

[0028] In another preferred embodiment, the promoter includes, but is not limited to: CMV promoter, CB promoter, CAG promoter, UBC promoter, tetracycline promoter TRE, Synapsin I promoter, CamKIIa promoter, c-fos promoter, Mecp2 promoter, NSE promoter, SST promoter, TH promoter, GFAP promoter, GFAP104 promoter, GfaABC1D promoter, ALDH1L1 promoter, MBP promoter, Rpe65 promoter, and VMD2 promoter.

[0029] In another preferred embodiment, the promoter is a CMV promoter.

[0030] In another preferred embodiment, the pharmaceutical composition further comprises:

[0031] (ii) Pharmaceutically acceptable carriers, excipients or diluents.

[0032] In another preferred embodiment, the pharmaceutically acceptable carrier includes, but is not limited to, solvents, dispersion media, coatings, antibacterial or antifungal agents, isotonic agents, and absorption delay agents.

[0033] In another preferred embodiment, the pharmaceutically acceptable carrier is an injectable carrier. Preferably, the pharmaceutically acceptable carrier includes saline solutions, including but not limited to: buffered saline, physiological saline, phosphate buffer, citrate buffer, acetate buffer, bicarbonate buffer, sucrose solution, salt solution, polysorbate solution, or combinations thereof.

[0034] In another preferred embodiment, the pharmaceutically acceptable carrier may further comprise additives, including but not limited to: stabilizers, preservatives, transfection promoters that facilitate cell uptake, or combinations thereof.

[0035] In another preferred embodiment, the pharmaceutically acceptable carrier is a delivery carrier, including but not limited to liposomes, nanoparticles, etc.

[0036] In another preferred embodiment, the dosage form of the pharmaceutical composition is an injection.

[0037] In another preferred embodiment, the pharmaceutical composition is administered via intraosseous injection.

[0038] In another preferred embodiment, the pharmaceutical composition has one or more functions selected from the group consisting of:

[0039] (Z1) Improves abnormal proliferation and differentiation of colonic epithelium;

[0040] (Z2) Maintains homeostasis of the intestinal epithelium;

[0041] (Z3) Reduce the number and size of intestinal polyps.

[0042] In a second aspect of the invention, a recombinant adeno-associated virus (AAV) particle is provided, the AAV particle comprising:

[0043] (A1)AAV capsid protein; and

[0044] (A2) The viral genome packaged in the AAV capsid protein, the genome containing a foreign gene encoding IL-10.

[0045] In a third aspect of the invention, a pharmaceutical composition is provided, the pharmaceutical composition comprising:

[0046] (i) Active ingredient: an expression vector containing the IL-10 coding sequence or recombinant IL-10 protein;

[0047] (ii) Pharmaceutically acceptable carriers, excipients or diluents.

[0048] In another preferred embodiment, the expression vector containing the IL-10 coding sequence is a recombinant AAV vector.

[0049] In a fourth aspect of the invention, a method for treating diseases related to intestinal epithelial dysplasia is provided, comprising administering to a subject in need an expression vector containing an IL-10 coding sequence or a pharmaceutical composition of recombinant IL-10 protein.

[0050] In another preferred embodiment, the intestinal epithelial dysplasia-associated disease is myeloid-derived suppressor cell (MDSC)-mediated intestinal epithelial dysplasia-associated disease.

[0051] In another preferred embodiment, the MDSC-mediated intestinal epithelial dysplasia-related disease is characterized by the accumulation of MDSCs in the lamina propria of the colonic mucosa.

[0052] In another preferred embodiment, the MDSC-mediated intestinal epithelial dysplasia-related diseases include: adenomatous polyposis, inflammatory bowel disease, colorectal cancer, and intestinal fibrosis.

[0053] In another preferred embodiment, the adenomatous polyposis includes familial adenomatous polyposis (FAP).

[0054] In another preferred embodiment, the inflammatory bowel disease includes Crohn's disease (CD) and ulcerative colitis (UC).

[0055] In another preferred embodiment, the pharmaceutical composition comprises a recombinant AAV vector containing an IL-10 coding sequence.

[0056] In another preferred embodiment, the subject includes humans, other mammals, such as mice.

[0057] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0058] Figure 1 The results show that IL-10 was detected by immunofluorescence staining (A), Western blot (B), and RT-quantitative PCR (C). - / -In IBD mice, IL-10 deficiency in the colon promotes abnormal colonic epithelial proliferation, with significant upregulation of the proliferation marker Ki67; significant downregulation of secretion lineage markers MUC2 and ChgA protein levels (A, B), while gene levels show feedback upregulation (C); at the same time, the absorption lineage marker CAⅡ is significantly elevated; and the expression of intestinal stem cell markers Lgr5 and Axin2 genes is upregulated (C), indicating that IL-10 deficiency leads to abnormal intestinal stem cell differentiation and active intestinal epithelial proliferation.

[0059] Figure 2 The flow cytometry assay showed the detection of wild-type (WT) and IL-10. - / - G-MDSCs (CD11b) in the spleen (Spleen), mesenteric lymph nodes (MLN), and lamina propria (cLP) of mice in both uninfected and infection-induced colitis. + LyG high Ly6C low ) and M-MDSCs (CD11b + LyC high Ly6G low Cell count. The bar chart represents the percentage of G-MDSCs and M-MDSCs in the mouse spleen, MLN, and cLP.

[0060] Figure 3 The effects of MDSCs on colonic organoids are shown. In particular, A shows the effects of bone marrow-derived wild-type (WT) MDSCs or IL-10. - / - Colonic organoids co-cultured with MDSCs were observed for proliferation at 0, 1, and 2 days under bright field; B shows the use of bone marrow-derived wild-type (WT) MDSCs or IL-10. - / - Colonic organoids processed from MDSC culture supernatant were observed for proliferation at 0, 1, and 2 days under bright field. The numbers on the ordinate of the line graph represent the diameter of the colonic organoid spheres. The scale bar is 50 micrometers.

[0061] Figure 4 APC was displayed Min / + In adenomatous mice, intestinal epithelial proliferation was significantly enhanced at weeks 15 and 20, with a significant increase in the proliferation marker Ki67, while IL-10 expression was significantly reduced. The mRNA levels of secretion lineage markers MUC2 and Lyz, and the absorption lineage marker CAII, were also increased.

[0062] Figure 5 A schematic diagram of the AAV9-GV613-mIL-10 vector is shown.

[0063] Figure 6 This demonstrates flow cytometry detection of IL-10 in intramedullary injection of AAV-mIL-10 or control virus AAV-neg.- / - CD11b in the spleen, mesenteric lymph nodes (MLN), and lamina propria (cLP) of colitis mice + Gr-1 + MDSCs (microscopic subcutaneous cells). The bar chart represents the percentage of MDSCs in the mouse spleen, MLN, and cLP. The results indicate that IL-10... - / - In colitis mice, MDSCs accumulate in large quantities in the spleen, MLN, and cLP, while intramedullary injection of AAV-mIL-10 can significantly reduce the number of MDSCs in the spleen, MLN, and cLP.

[0064] Figure 7 The results show IL-10 levels in control mice and mice injected intramedullarily with AAV-mIL-10 or AAV-neg. - / - Representative images of H&E staining (A) and albedocyanine blue staining (B) of the colon in colitis mice, and the expression of secretion lineage marker ChgA and absorption lineage marker CAⅡ proteins detected by Western blot (C). β-actin was used as a control. Scale bar, 100 μm. *P<0.05; **P<0.01; ***P<0.001.

[0065] Figure 8 This demonstrates flow cytometry detection of APCs after intramedullary injection of AAV-mIL-10 or AAV-neg. Min / + CD11b in the spleen, mesenteric lymph nodes (MLN), and lamina propria (cLP) of adenomatous mice + Gr-1 + MDSCs (microscopic cellular cells). The bar chart represents the percentage of MDSCs in the mouse spleen, MLN, and cLP. The results indicate that APC... Min / + MDSCs accumulate in the spleen, MLN, and cLP of adenomas, while intramedullary injection of AAV-mIL-10 can significantly reduce the number of MDSCs in the spleen, MLN, and cLP.

[0066] Figure 9 The image shows APCs in control mice and mice injected intramedullarily with AAV-mIL-10 or control AAV-neg virus. Min / + Representative image of whole colon H&E staining in adenomatous mice (A), and Western blot analysis (B) of ChgA, CAⅡ, NF-κB, p-NF-κB, active β-catenin, and p-GSK3β protein expression. β-actin was used as a control. Scale bar, 500 μm or 100 μm. *P<0.05; **P<0.01; ***P<0.001. Detailed Implementation

[0067] Through extensive and in-depth research, the inventors discovered that the accumulation of myeloid-derived suppressor cells (MDSCs) due to decreased IL-10 levels is the main cause of intestinal epithelial dysplasia. Supplementing myeloid cells at the source helps restore bone marrow microenvironment homeostasis, reduces the production of pathogenic MDSCs, and thus treats intestinal epithelial dysplasia-related diseases, such as inflammatory bowel disease and adenomatous polyposis. Based on the above findings, this invention provides a recombinant adeno-associated virus vector expressing IL-10, which delivers IL-10 to myeloid cells via intramedullary injection, avoiding the adverse reactions associated with systemic administration. Experimental verification shows that the IL-10 recombinant adeno-associated virus vector of this invention can reduce the accumulation of MDSCs, significantly reduce the number and size of intestinal polyps, and demonstrates excellent in vivo efficacy.

[0068] Based on this, the present invention was completed.

[0069] Terms and abbreviations

[0070] As used in this article, the term "inflammatory bowel disease (IBD)" is a chronic, immune-inflammatory disease involving the ileum, rectum, colon, and even the entire digestive tract, characterized by the abnormal proliferation of intestinal epithelial cells. Chronic inflammation of the intestinal mucosa enables intestinal epithelial cells to acquire new pro-survival capabilities, becoming tumorigenic cells, and progressing in the sequence of dysplasia, low-grade dysplasia, high-grade dysplasia, and dysplasia-carcinoma. Inflammatory bowel diseases include Crohn's disease (CD) and ulcerative colitis (UC), among others.

[0071] As used in this article, the term "familial adenomatous polyposis (FAP)" is a hereditary disease characterized by the presence of numerous adenomatous polyps in the colon and rectum, typically beginning in adolescence or early adulthood. Without treatment, almost all patients will develop colorectal cancer. FAP is an autosomal dominant hereditary colorectal cancer syndrome caused by a pathogenic germline variant of the adenomatous polyposis (APC) gene, characterized by abnormal proliferation of intestinal epithelial cells, typically manifested as the gradual development of hundreds to thousands of adenomatous polyps in the lower digestive tract, particularly the colon and rectum.

[0072] As used in this article, the term "adenoma" is a benign tumor that originates from the epithelial tissue of a gland. Adenomas typically form in glands and endocrine glands and produce various secretions. Depending on the gland, adenomas can be classified into several types, such as breast adenomas, thyroid adenomas, and adrenal adenomas.

[0073] As used in this article, the term "colorectal cancer (CRC)" refers to a cancer that originates in the colon or rectum. Colorectal cancer is a common type of cancer that usually develops from adenomatous polyps, and early detection and treatment can significantly improve survival rates.

[0074] As used in this article, the term "intestinal stem cells" refers to adult stem cells that reside at the base of the intestinal crypts and possess the ability to self-renew and differentiate into various intestinal cell types. These cells are essential for the normal regeneration and repair of the intestine.

[0075] As used in this article, the term "crypts" refers to small, recessed structures formed in the intestinal epithelium, located at the base of the intestinal villi. Cryptopsies are the primary sites for the renewal and differentiation of intestinal stem cells and other cells. Abnormal changes in intestinal crypts are a prerequisite for abnormal proliferation and differentiation of intestinal epithelial cells, and are also among the earliest neoplastic lesions discovered in the colon.

[0076] As used in this article, the term "myeloid-derived suppressor cells (MDSCs)" refers to a class of cells with immunosuppressive functions, which typically increase in number under tumor or inflammatory conditions. They help tumor growth or maintain an inflammatory state by suppressing the function of other immune cells. They are generally divided into two main categories: monocyte-derived suppressor cells (Mo-MDSCs) and granulocyte-derived suppressor cells (Granulocytic MDSCs).

[0077] As used in this article, the term "mesenteric lymph nodes" refers to lymph nodes located in the mesenteric region, distributed throughout the mesentery of the small and large intestines, particularly the mesenteric portions of the ileum and colon. They typically exist in clusters, forming part of the intestinal lymphatic system. Mesenteric lymph nodes play a vital role in immune function, primarily responsible for monitoring pathogens, toxins, and other foreign substances within the gut. They help maintain intestinal immune homeostasis by filtering lymph fluid and identifying and clearing invading microorganisms. Mesenteric lymph nodes are an important component of the intestinal immune system and are essential for maintaining intestinal health and defending against infection.

[0078] As used in this article, the term "lamina propria" refers to the layer of connective tissue located between the intestinal epithelium and the muscular layer. It is a thin, cellular layer of connective tissue with a variety of important physiological functions. The lamina propria is composed of connective tissue, blood vessels, lymphatic vessels, and nerve fibers, and contains a variety of cells, including fibroblasts, immune cells (such as lymphocytes, macrophages, and plasma cells), and other supporting cells. These cells play a role in the defense system and tissue repair.

[0079] As used in this article, "Ki67" is a cell proliferation-related protein widely used as a marker for assessing cell proliferation activity. High expression of Ki67 characterizes abnormal proliferation of intestinal epithelial cells.

[0080] As used in this article, "MUC2" is a mucolytic glycoprotein belonging to the family of mucosal surfactants. It is mainly produced by intestinal epithelial cells (especially goblet cells of intestinal glands) and is used as a marker molecule for goblet cells in the secretory lineage. "ChgA" is an important endocrine and neurotransmitter regulatory protein belonging to the pigment granule protein family. It is mainly secreted by neuroendocrine cells in the intestinal epithelium and is used as a marker molecule for these cells.

[0081] As used in this article, "CA II" refers to carbonic anhydrase II, which is mainly expressed in absorptive intestinal epithelial cells and is often used as a marker for absorptive lineage cells.

[0082] Interleukin-10 (IL-10)

[0083] IL-10 is a cytokine secreted by various immune cells, such as macrophages, dendritic cells, and Treg cells. It is generally considered a key anti-inflammatory factor, preventing excessive inflammatory responses and protecting tissues from damage. Currently, increasing research reveals that IL-10 plays a complex and diverse role in the development of autoimmune diseases and cancer. However, the association between IL-10 and diseases such as familial adenomatous polyposis remains unexplored.

[0084] In this invention, the term "IL-10" is intended to include human IL-10 and other mammalian IL-10, such as mouse IL-10. Furthermore, the IL-10 described in this invention includes wild-type or mutant IL-10, or its active fragment, or its derivative, provided that the mutant IL-10, active fragment, or derivative retains the activity or function of wild-type IL-10.

[0085] In this invention, it was discovered for the first time that the deficiency of IL-10 leads to the accumulation of MDSCs, thereby causing abnormal proliferation of the intestinal epithelium. Low expression of IL-10 was also observed in adenomatous mouse models, and IL-10 supplementation could inhibit specific proliferation of the intestinal epithelium. Therefore, this invention provides the use of IL-10 for the treatment of diseases related to abnormal intestinal epithelial proliferation, including inflammatory bowel disease and familial adenomatous polyposis.

[0086] The study of this invention found that IL-10 can effectively inhibit MDSCs located in the bone marrow, improve the abnormal proliferation and differentiation of colonic epithelium, maintain the homeostasis of intestinal epithelium, and reduce the number and size of intestinal polyps after administration to patients with inflammatory bowel disease or familial adenomatous polyposis, thereby playing a role in the prevention and / or treatment of inflammatory bowel disease or familial adenomatous polyposis.

[0087] In this invention, IL-10 for treating intestinal epithelial dysplasia-related diseases can be administered to subjects in the form of a recombinant protein, preferably recombinant human IL-10. To reduce adverse reactions caused by systemic administration, recombinant human IL-10 is preferably administered via targeted delivery to the bone marrow.

[0088] In a preferred embodiment of the present invention, IL-10 for treating intestinal epithelial dysplasia-related diseases is administered via gene therapy, i.e., a vector carrying the IL-10 coding sequence is applied to the subject, resulting in a therapeutically effective amount of IL-10 in the subject's body. The vector includes viral vectors and non-viral vectors. Viral vectors include, but are not limited to, adeno-associated virus (AAV), lentivirus, adenovirus, retrovirus, etc.; non-viral vectors include, but are not limited to, naked DNA, liposomes, nanocarriers, etc.

[0089] In a preferred embodiment of the present invention, the vector is recombinant adeno-associated virus (AAV).

[0090] Adeno-associated virus

[0091] Adeno-associated virus (AAV), also known as adeno-associated virus, belongs to the genus *Dependent Virus* of the family Parvoviridae. It is currently the simplest single-stranded DNA-deficient virus discovered, requiring a helper virus (usually adenovirus) to participate in replication. It encodes the cap and rep genes in two terminal inverted repeat sequences (ITRs). ITRs play a crucial role in viral replication and packaging. The cap gene encodes the viral capsid protein, and the rep gene is involved in viral replication and integration. AAV can infect a variety of cell types. Due to its smaller size compared to other viral vectors, non-pathogenicity, and ability to transfect both dividing and non-dividing cells, AAV-based gene therapy has attracted widespread attention.

[0092] Recombinant adeno-associated virus (rAAV) vectors, derived from non-pathogenic wild-type adeno-associated virus (AAV), are considered one of the most promising gene transfer vectors due to their good safety profile, broad host cell range (dividing and non-dividing cells), low immunogenicity, and long in vivo expression time of exogenous genes. They are widely used in gene therapy and vaccine research worldwide. After more than 10 years of research, the biological characteristics of recombinant AAV have been thoroughly understood, especially regarding their effectiveness in various cell, tissue, and in vivo experiments, for which a wealth of data has been accumulated. In medical research, rAAV is used for gene therapy research on various diseases (including in vivo and in vitro experiments); simultaneously, as a distinctive gene transfer vector, it is also widely used in gene function research, disease model construction, and gene knockout mouse development.

[0093] This invention utilizes adeno-associated virus (AAV) vectors for gene therapy, offering the following advantages: AAVs can achieve persistent gene expression in host cells because they typically do not integrate into the host cell's genome but remain in the cell's non-coding regions. This characteristic helps avoid immune rejection by the host cell. Furthermore, AAVs elicit less of an immune response from the host's immune system, thus reducing the risk of immune rejection during treatment. AAVs have broad target cell infectivity, including both dividing and non-dividing cells, making them a promising candidate for treating genetic diseases in various tissues and organs. Simultaneously, AAVs demonstrate high safety in clinical applications because they do not integrate into the host genome or induce oncogenic mutations. Finally, the production and application of recombinant adeno-associated virus vector therapy are relatively mature; existing technologies can efficiently produce large quantities of recombinant proteins, and this therapeutic approach has been validated in numerous clinical trials and treatments.

[0094] In a preferred embodiment of the present invention, a therapeutic recombinant AAV particle is provided, comprising an AAV capsid protein and a viral genome packaged within the AAV capsid protein, the genome containing a foreign gene encoding IL-10.

[0095] The AAV virus of this invention can be prepared using standard methods in the art, such as triple plasmid transfection (also known as triple transfection technique). During viral packaging, the packaging plasmid encodes the target gene and two terminal inverted repeat sequences (ITRs, which play a crucial role in viral replication and packaging). The helper plasmid contains the cap (encoding viral capsid proteins) and rep (involved in viral replication) genes required for AAV packaging, as well as an adenovirus helper plasmid. After co-transfection of cells with the three plasmids, the AAV virus begins to replicate and package.

[0096] In some embodiments, the recombinant vector carrying the IL-10 gene is capsidated into viral particles (e.g., AAV viral particles including, but not limited to, AAV9, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16). Preferably, the AAV used in this invention is AAV9. AAV9 can efficiently deliver genetic material into host cells and can be persistently expressed in myeloid cells.

[0097] Pharmaceutical Composition

[0098] In this invention, a pharmaceutical composition for treating diseases related to intestinal epithelial dysplasia is provided, comprising: (i) an expression vector carrying an IL-10 coding sequence or a recombinant IL-10 protein as an active ingredient; and (ii) a pharmaceutically acceptable carrier, excipient, or diluent.

[0099] In a preferred embodiment, the expression vector carrying the IL-10 coding sequence in the pharmaceutical composition is a recombinant AAV particle.

[0100] The preferred dosage form of the pharmaceutical composition of the present invention is an injection, and the preferred route of administration is intraosseous injection. Intraosseous injection of AAV particles can precisely target myeloid cell development, thereby avoiding the adverse reactions associated with systemic administration.

[0101] In this invention, the use of the pharmaceutical composition of the invention is also provided for administration to subjects in need of treating diseases related to intestinal epithelial dysplasia, including inflammatory bowel disease, familial adenomatous polyposis, etc.

[0102] As used in this article, the term "treatment" refers to both therapeutic and preventative measures. Those requiring treatment may include individuals who already have a skin condition and those who may eventually develop it.

[0103] As used herein, the terms “subject” and “object” are used interchangeably and include any human or non-human mammal, such as non-human primates, sheep, dogs, cats, horses, cattle, chickens, rats, mice, etc.

[0104] As used herein, the term "effective amount" or "effective dose" refers to an amount that is functional or active in humans and / or animals and is acceptable to them. It refers to the amount of a therapeutic agent that treats, alleviates, or prevents a target disease or condition, or that exhibits a detectable therapeutic or preventative effect. Therapeutic effects also include a reduction in physiological symptoms. The precise effective amount for a given subject depends on the subject's body size and health status, the nature and severity of the condition, and the choice of the therapeutic agent and / or combination of therapeutic agents administered. For a given condition, the effective amount can be determined using routine laboratory methods.

[0105] The effective amount of a pharmaceutical composition can vary depending on the mode of administration and the severity of the disease to be treated. A preferred effective amount can be determined by those skilled in the art based on various factors (e.g., through clinical trials). These factors include, but are not limited to: pharmacokinetic parameters of the drug, such as tissue distribution, bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, and the route of administration.

[0106] The main advantages of this invention include:

[0107] (1) This invention provides for the first time the use of IL-10 in the treatment of diseases related to MDSC-mediated intestinal epithelial dysplasia, providing an effective treatment option for diseases such as inflammatory bowel disease and familial adenomatous polyposis.

[0108] (2) The present invention provides a pharmaceutical composition containing a recombinant AAV carrier of IL-10 for in vivo supplementation of IL-10, reducing the accumulation of MDSCs, significantly reducing the number and size of intestinal polyps, and showing good efficacy.

[0109] (3) The IL-10 recombinant AAV vector used in this invention has high targeting and low side effects, avoiding adverse reactions caused by systemic administration and has high safety.

[0110] (4) The IL-10 recombinant AAV9 vector constructed in this invention has high stability in vivo, which is beneficial to maintain long-term stable IL-10 levels and long-term therapeutic effect.

[0111] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and fractions are weight percentages and weight fractions.

[0112] Materials and Methods

[0113] 1. Laboratory animals

[0114] APC Min / + Mice (C57BL / 6 background) were purchased from GEM Pharmaceuticals. Eight-week-old IL-10 knockout mice were administered 1×10⁻⁶ mice by gavage. 9 CFU-induced colitis (IL-10) - / - Mice were randomly assigned to experimental groups. All mice were allowed free access to sterilized food and water at 25±1℃ and maintained a 12-hour light / dark cycle. All experiments were conducted in accordance with the National Institutes of Health's Guidelines for the Care and Use of Laboratory Animals (NIH Publication, 2011 Revised Edition) and were approved by the Bioethics Committee of the Shanghai Institute of Materia Medica (SIMM, Shanghai, China) and the Experimental Research Ethics Committee of Fudan University Shanghai Medical College.

[0115] 2. High-fat diet-induced adenomas

[0116] 5-week-old APC Min / + Mice were divided into a normal diet group and a high-fat diet group, with 10 mice in each group. The normal diet group was fed a normal diet, while the high-fat diet group was fed a customized high-fat diet. The customized high-fat diet HF-45 (Dye Company, Bethlehem) contained 20% protein, 35% carbohydrates, and 45% fat. Mice were sacrificed at 10, 15, and 20 weeks of age, and their small intestines were collected for subsequent experiments.

[0117] 3. Generation of AAV9-GV613-mIL-10 and infection in adult mice

[0118] The mouse IL-10 coding sequence was cloned into the BamHI restriction site of the pAAV9-GV613 receptor vector to construct recombinant adeno-associated virus (AAV9), and the viral titer was determined using real-time PCR (quantitative PCR). AAV9-GV613-mIL-10 and empty virus were prepared using triple transfection technology, and AAV9 was purified. - / - Mice or APC Min / + Mice were injected intraosseously with 3×10 11 The adeno-associated virus vector (AAV9-GV613-mIL-10) and the non-coding empty vector (AAV9-vector) of the viral genome were used as controls.

[0119] 4. Hematoxylin and eosin (H&E) staining of colon tissue

[0120] Mouse colon tissue was collected, and the intestinal contents were continuously rinsed with PBS using a 10ml syringe. Approximately 1cm of proximal and distal colon tissue was taken and fixed with 4% paraformaldehyde fixative for more than 24 hours. The tissue was then sent to Wuhan Saiweier Biotechnology Co., Ltd. for tissue sectioning and subsequent staining.

[0121] 5. Preparation of single-cell suspensions of spleen, mesenteric lymph nodes, and lamina propria of the intestine.

[0122] The colonic tissue was flushed with sterile PBS using a 10 mL syringe. The colon was longitudinally incised and thoroughly cleaned to remove intestinal contents. The colon was then cut into 0.3 cm pieces and washed twice for 20 minutes each time in HBSS containing 10 mM HEPES, 0.035% NaHCO3, 5 mM EDTA, 1.25% BSA, and 1 mM DTT. After washing, the tissue was digested in HBSS medium containing 10 mM HEPES, 1 mg / mL collagenase IV, 20 mg / mL DNase I (8 U / mL), and 1 mM DTT, and incubated at 37°C for 30 minutes. The resulting cell suspension was filtered through a 70 μm sieve and centrifuged at 200 g for 5 minutes to collect colonic lamina propria cells. The cells were resuspended in PBS for flow cytometry analysis.

[0123] Mouse spleens and mesenteric lymph nodes were collected and washed with PBS. A sterile 70μm sieve was placed on a 50ml centrifuge tube. The prepared tissue was transferred onto the sieve and crushed using a 20ml syringe stopper. Simultaneously, the tissue was rinsed with PBS to allow the dispersed cells to filter through the sieve into the centrifuge tube. Centrifuge at 200g for 5 min at 4°C. The supernatant was discarded, and 5ml of red blood cells were added for lysis. Lysis was performed at room temperature for 5 min, followed immediately by stopping the lysis with PBS. Centrifuge at 200g for 5 min at 4°C. The supernatant was discarded, and the cells were washed 2-3 times with 5ml of PBS. The resulting cells were resuspended in PBS for flow cytometry analysis.

[0124] 6. Flow cytometry and flow cytometry-assisted chemometry (FACS)

[0125] Flow cytometry was performed using a CytoFlex S (Beckman) instrument, and data analysis was conducted using Cytoexpert software. Single-cell suspensions isolated from bone marrow, spleen, mesenteric lymph nodes (MLN), and lamina propria (cLP) were blocked with the corresponding anti-FcR for 15 minutes, then stained with antibodies against surface molecules at 4°C for 30 minutes. After washing twice and resuspending in PBS, they were used for further flow cytometry analysis. For intracellular cytokine staining, staining was first performed with antibodies against cell surface proteins, followed by fixation and membrane permeabilization, and then staining with antibodies against intracellular antigens. MDSCs were defined as CD45... + Gr-1 + Among them, granulocyte-derived suppressor cells (G-MDSCs) and monocyte-derived suppressor cells (M-MDSCs) are defined as CD11b. + LyG high ly6cl low Cells and CD11b + LyC high Ly6G low cell.

[0126] 7. Western blotting assay

[0127] Colon tissue samples of approximately 2 cm were minced and transferred to 1.5 ml EP tubes. Approximately 500 μl of RIPA lysis buffer was added, and the mixture was homogenized thoroughly using a homogenizer. The mixture was incubated on ice for 30 min. Vortexing was performed every 5 minutes to improve lysis efficiency. The mixture was centrifuged at 14000 g for 15 min at 4 °C. The supernatant was collected into new EP tubes, and protein concentration was quantified using a BCA kit. The concentration was calculated based on the standard curve, and PBS buffer was added to adjust the concentration to ensure consistency across all groups. One-fifth of the total volume of 5× Loading Buffer was added, and the mixture was incubated in a boiling water bath for 10 min to fully denature the protein. The protein was stored at -20 °C or subjected to electrophoresis directly. Western blotting was performed using a Biorad electrophoresis apparatus to detect the expression level of the target protein in each group.

[0128] 8. Quantitative reverse transcription PCR (RT-qPCR)

[0129] Mince colon tissue (approximately 2 cm) and transfer it to a 1.5 ml EP tube. Add 1 ml of Trizol and homogenize thoroughly using a homogenizer. After complete lysis of the colon tissue in Trizol, add 200 μl (1 / 5 the volume of Trizol) of chloroform, shake vigorously, and let stand for 5 min. After complete extraction, centrifuge at 12000 g, 4 °C for 15 min. Carefully aspirate the uppermost aqueous phase (approximately 500 μl) and transfer it to a newly prepared EP tube. Add an equal volume (approximately 500 μl) of isopropanol, gently invert, and let stand on ice for 5 min. White flocculent matter will be visible (if RNA content is high). Centrifuge at 12000 g, 4 °C for 15 min, remove the supernatant, being careful not to let the RNA precipitate at the bottom of the EP tube slip. Add freshly prepared 75% ethanol, use a pipette to lift the RNA, wash the precipitate, centrifuge at 7500 g for 5 min, remove the supernatant, and invert the EP tube onto filter paper to remove any remaining liquid. Dry the precipitate at room temperature in a fume hood, and add an appropriate amount of DEPC water to dissolve the RNA, depending on the precipitate volume.

[0130] RNA concentration was measured using a Thermo NanoDrop 2000 instrument. The optimal RNA concentration range was 100-300 ng / μl. If the concentration was too high, it needed to be diluted with DEPC water to the appropriate range. OD 260 / OD 280 A value of 1.8-2.0 is most suitable, indicating high RNA purity; otherwise, impurities may be present.

[0131] Following the instructions of Yeasen Biosciences' reverse transcription kit, cDNA was synthesized through transcription. The obtained cDNA was then subjected to real-time quantitative PCR in a qPCR system. The target fragment of the cDNA was amplified using a Bio-Rad CFX100 real-time PCR instrument. Instrument data were collected, and 2... -ΔΔCt Methods for analyzing data.

[0132] 9. Immunofluorescence staining

[0133] Paraffin sections of intestinal tissue were baked at 65°C for 45 min. They were then dewaxed by immersion in xylene for 15 min, twice. Afterwards, they were subjected to a gradient hydration with alcohol, at concentrations of 100% → 90% → 80% → 70%, immersing for 4 min at each concentration (avoid drying the sections). The sections were rinsed under running tap water twice, 5 min each time, followed by a 5 min immersion in PBS (on a shaker). To remove the influence of paraformaldehyde on antigen binding sites, the sections were first transferred to a slide holder and placed in a glass beaker containing EDTA antigen retrieval solution. The solution was preheated, brought to a boil, then simmered for 8 min, cooled for 30 min, and the above steps were repeated. The sections were cooled to room temperature for 1 h. They were rinsed twice with running tap water for 5 min each time, followed by a 5 min immersion in PBS (on a shaker). Then, they were washed with TBS for 3 min. Saponin permeabilization solution was used for permeabilization (permeabilization was performed with the antibody bound to the cell), followed by a 5 min immersion in PBS (on a shaker). The sections were then shaken dry, and a circular motion was drawn near the tissue using a histochemical pen (approximately 3 mm away from the tissue). Add 10% goat serum for blocking, ensuring the entire tissue is covered. Place the tissue in a humidified chamber and incubate at 37°C with a shaker for 30 minutes. Dilute the primary antibody with blocking buffer according to the specific antibody instructions and mix well. Discard the blocking buffer and blot the liquid around the tissue with filter paper (do not touch the tissue). Add the diluted primary antibody and incubate at 4°C overnight (12-18 hours). The next day, wash with TBST, moving the slide up and down 10 times by hand. Under light-protected conditions, dilute the secondary antibody with blocking buffer (1:1000), i.e., add 2 μl of secondary antibody stock solution to 2 ml of blocking buffer and mix well. Add the diluted secondary antibody to the tissue. Incubate at 37°C for 1 hour, then wash with TBST, moving the slide up and down 10 times by hand by hand. Wash 4 times with PBS, 5 minutes each time. Add 10 μl of anti-fluorescence quencher containing DAPI to each tissue, ensuring no air bubbles are present. Mount the slide horizontally with a coverslip and secure the edges with nail polish. Store in a dark box in a 4°C refrigerator and image using a fluorescence microscope.

[0134] 10. Alixin blue staining

[0135] Paraffin sections of intestinal tissue were soaked in xylene to remove the paraffin. Then, the sections were sequentially soaked in ethanol of varying concentrations (100%, 95%, 70%) for dehydration, and finally rinsed with physiological saline or buffer. The sections were then immersed in an alexandrite blue dye solution for 30 minutes to 1 hour (depending on experimental requirements). The sections were gently rinsed with buffer or physiological saline to remove excess dye. The sections were then soaked again in ethanol of increased concentrations (70%, 95%, 100%) for further dehydration.

[0136] Next, immerse the slide in xylene to clear it. Add a drop of neutral resin or mounting adhesive to the slide, gently cover it with a coverslip, ensuring no air bubbles are trapped between the slide and the coverslip. Observe the slide under a microscope to check the results of the alexandrite blue staining.

[0137] 11. In vitro 3D culture of colon organoids

[0138] Sacrifice 8-10 week old mice, longitudinally cut open the colon tissue, and repeatedly rinse it in four culture dishes. Then, place the colon into a 50 ml centrifuge tube (containing 25 ml PBS) and place it on ice. Transfer the centrifuge tube to a biosafety cabinet, wash three times with PBS containing antibiotics, and transfer the colon to digestion solution. Incubate at 37°C for 30 min. Transfer the digested colon to a 50 ml centrifuge tube, add 25 ml of PBS containing antibiotics, shake gently for 50 seconds, and filter the suspension through a 70 μm cell sieve into a 50 ml centrifuge tube rinsed with 1% BSA. Repeat three times. Centrifuge the filtered cell suspension at 200 g for 5 minutes at room temperature. Count the cells and resuspend in ADMEM. Resuspend the pellet in pre-chilled 4°C matrix gel (final matrix gel concentration 50%), mixing the matrix gel and culture medium 1:1. Preheat a 24-well plate in an incubator, then seed each well with 50 μl of the resuspended solution, ensuring no air bubbles are present. Place the inoculated plates in an incubator for 10-15 minutes. After removing the plates, add 500 μl of pre-prepared Aadvanced DMEM / F12 (WENR medium) containing 2 mM Glutamax, 10 mM HEPES, 100 μg / ml Primocin, 1 mM N-acetylcysteine, B27, N2, 20 ng / ml EGF, 100 ng / ml Noggin, 500 ng / ml R-spondin-1, and Wnt3a to each well. Change the medium every 2-3 days.

[0139] 12. Statistical Analysis

[0140] Statistical analysis was performed using GraphPad Prism software. Unless otherwise stated, numerical data are expressed as mean ± standard error and represent at least three replicates. Two-tailed unpaired t-tests were used for comparisons between groups, and one-way ANOVA and Bonferroni post-hoc tests were used for pairwise comparisons between groups. A p-value less than 0.05 was considered statistically significant.

[0141] Example 1: Correlation between IL-10, MDSCs and inflammatory bowel disease and adenomatous polyps

[0142] In this embodiment, a comparative study was conducted on wild-type (WT) and IL-10. - / - In mice with uninfected and infection-induced colitis, the proliferation and differentiation of intestinal epithelium were studied. IL-10 deficiency was found to promote abnormal colonic epithelial proliferation, with significant upregulation of the proliferation marker Ki67; and significant downregulation of the secretory lineage markers MUC2 and ChgA protein levels. Figure 1 A, 1B), while at the gene level, there is a feedback upregulation ( Figure 1 C); simultaneously, the uptake lineage marker CAII was significantly elevated; and the expression of intestinal stem cell markers Lgr5 and Axin2 genes was upregulated. Figure 1 C) indicates that IL-10 deficiency leads to abnormal differentiation of intestinal stem cells and active proliferation of intestinal epithelium.

[0143] G-MDSCs (CD11b) in the spleen, mesenteric lymph nodes (MLN), and lamina propria (cLP) of mice in each group were analyzed by flow cytometry. + LyG high Ly6C low ) and M-MDSCs (CD11b + LyC high Ly6G low Changes in cell number revealed that IL-10 deficiency, particularly in colitis mice, led to a significant accumulation of G-MDSCs and M-MDSCs in the spleen, MLN, and cLP. Figure 2 ).

[0144] To investigate whether these increased MDSCs lead to intestinal epithelial dysplasia, wild-type MDSCs derived from bone marrow or IL-10 were used. - / - Co-culture of MDSCs with colon organoids ( Figure 3 A) and the use of bone marrow-derived wild-type MDSCs or IL-10 - / - Processing colonic organoids from MDSC culture supernatant ( Figure 3 B) Observe the proliferation of colonic organoids. Results showed that IL-10 - / -Both MDSCs and their culture supernatant significantly promoted the expansion of colonic organoids. This indicates that the abnormal proliferation of intestinal epithelium in IBD is mainly due to IL-10 deficiency leading to the accumulation of MDSCs in the lamina propria of the colonic mucosa, which promotes the abnormal proliferation of intestinal stem cells.

[0145] In APC Min / + In adenomatous mice, at 15 and 20 weeks of high-fat diet modeling, the proliferation marker Ki67 was significantly elevated, indicating high-level intestinal epithelial hyperplasia, while IL-10 expression was significantly reduced. Figure 4 ). with IL-10 - / - Unlike colitis mice, APC Min / + Adenomatous mice did not show significant changes in intestinal epithelial differentiation, but the mRNA levels of secretory lineage markers MUC2 and Lyz and the absorptive lineage marker CA II were slightly increased. This was mainly due to APC. Min / + In mice, the proliferation is not a general increase in intestinal epithelium, but rather the formation of adenomas due to localized hyperplasia. However, APC... Min / + Both adenomatous mice and inflammatory bowel disease mice exhibited IL-10 deficiency, and similarly, large accumulations of G-MDSCs and M-MDSCs were observed in the spleen, MLN, and cLP. Figure 8 (adenoma+AAV-neg group).

[0146] The above results indicate that the abnormal proliferation of intestinal epithelium in adenomatous polyposis shares common characteristics with inflammatory bowel disease, namely, IL-10 deficiency leads to the accumulation of large amounts of MDSCs, which promotes the abnormal proliferation of intestinal epithelium in both inflammatory bowel disease and adenomatous polyposis.

[0147] Example 2: Construction of recombinant AAV vector and viral packaging

[0148] The mouse IL-10 coding sequence was cloned into the BamHI restriction site of the pAAV9-GV613 receptor vector to construct recombinant adeno-associated virus AAV9. The vector element sequence is CMV bGlobin-MCS-firefly_Luciferase-hGH polyA, as shown in the schematic diagram below. Figure 5 As shown. Viral titers were determined using Real-Time PCR (quantitative PCR). AAV9-GV613-mIL-10 (hereinafter referred to as AAV-mIL-10) and empty virus (hereinafter referred to as AAV-neg) were prepared using triple transfection technology, and AAV was purified.

[0149] The sequence of the positive clones was determined, and the result showed that the sequence of the recombinant AAV vector is as shown in SEQ ID NO:1:

[0150] TTCTGAGTCCAAGCTAGGCCCTTTTGCTAATGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTGGGATTCGAACATCGATTGAATTCGGTACCGGAATTCGGAACTGGAGGTGGAGGTAGTGGAAAGGATCCGCCACC ATGCCTGGCTCAGCACTGCTATGCTGCCTG CTCTTACTGACTGGCATGAGGATCAGCAGGGGCCAGTACAGCCGGGAAGACAATAACTGACCCACTTCCCAGTCG GCCAGAGCCACATGCTCCTAGAGCTGCGGACTGCCTTCAGCCAGGTGAAGACTTTCTTTCAAACAAAGGACCAGCT GGACAACATACTGCTAACCGACTCCTTAATGCAGGACTTTAAGGGTTACTTGGGTTGCCAAGCCTTATCGGAAATG ATCCAGTTTTACCTGGTAGAAGTGATGCCCCAGGCAGAGAAGCATGGCCCAGAAATCAAGGAGCATTTGAATTCCC TGGGTGAGAAGCTGAAGACCCTCAGGATGCGGCTGAGGCGCTGTCATCGATTTCTCCCCTGTGAAAATAAGAGCAA GGCAGTGGAGCAGGTGAAGAGTGATTTTAATAAGCTCCAAGACCAAGGTGTCTACAAGGCCATGAATGAATTTGAC ATCTTCATCAACTGCATAGAAGCATACATGATGATCAAAATGAAAAGC GGATCCATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCAACTGCATAA(SEQ ID NO:1)

[0151] Note: The underlined part is the full-length coding region of mouse IL-10 mRNA, the bolded part is the restriction enzyme site, and the rest is the AAV vector partial sequence.

[0152] Example 3: Recombinant AAV virus against IL-10 - / - Effects of colitis on mice

[0153] IL-10 - / - Intramedullary injection of 3×10 11 Mice were injected with an adeno-associated virus vector (AAV-mIL-10) containing the viral genome, and mice injected with an equal amount of the non-coding empty vector (AAV-neg) served as controls. At week 8 post-injection, the percentage of MDSCs in bone marrow, spleen, mesenteric lymph nodes (MLN), and lamina propria of the colon (cLP) was determined by flow cytometry.

[0154] The results are as follows Figure 6 As shown, this indicates that AAV-mIL-10 significantly reduces IL-10. - / - Accumulation of pathogenic MDSCs in the spleen, lymph nodes (MLN), and lamina propria (cLP) of colitis mice.

[0155] The results are as follows Figure 7 As shown, control mice and mice injected intramedullary with AAV-mIL-10 or AAV-neg IL-10 showed improvement. - / -The expression of secretion lineage marker molecule ChgA and absorption lineage marker molecule CAII proteins in the colon of colitis mice was detected by H&E staining (A), albedocyanine blue staining (B), and Western blot (C). The results showed that IL-10... - / - In mice with colitis, there was significant intestinal epithelial hyperplasia and a marked reduction in endocrine lineage cells. Figure 7 A and 7B). Intraosseous injection of AAV-mIL-10 significantly inhibited intestinal epithelial hyperplasia (A and 7B). Figure 7 A) Restore the number of endocrine cells ( Figure 7 B) Increases the level of the secretory lineage marker molecule ChgA protein and decreases the level of the absorption lineage marker molecule CAII protein. Figure 7 C).

[0156] The above results indicate that injection of AAV-mIL-10 significantly inhibited the abnormal proliferation and differentiation of intestinal epithelium.

[0157] Example 4: Recombinant AAV virus against APC Min / + Effects on adenomatous mice

[0158] APC Min / + Intramedullary injection of 3×10 11 The adeno-associated virus vector (AAV-mIL-10) containing the viral genome was used as a control, and mice injected with an equal amount of the non-coding empty vector (AAV9-neg) were used as controls. C57BL / 6 mice were used as normal controls.

[0159] APC during a 15-week high-fat diet Min / + AAV-mIL-10 virus was injected into the bone marrow cavity of adenoma mice, and its therapeutic effect was observed. The results are as follows: Figure 8 and Figure 9 As shown in the figure. The results show that AAV-mIL-10 can also significantly reduce APC. Min / + Accumulation of pathogenic MDSCs in the spleen, lymph nodes (MLN), and lamina propria (cLP) of adenomatous mice. Figure 8 Furthermore, it significantly reduced the number and size of colonic polyps, indicating a marked improvement in abnormal proliferation of intestinal epithelium and crypt dilation. Figure 9 A). Western blot results showed that AAV-mIL-10 could increase the secretion lineage marker ChgA and decrease the uptake lineage marker CA II, thereby improving abnormal intestinal epithelial differentiation; more importantly, it could also inhibit APC. Min / + The resulting overactivation of β-catenin and phosphorylated GSK3β activity, while the activity of the inflammatory signaling pathway NF-κB is inhibited. Figure 9 B).

[0160] The above results indicate that intraosseous injection of AAV9-GV613-mIL-10 virus can effectively reverse APC. Min / + Inhibit the activity of key pathogenic signaling pathways in adenoma mice, thereby effectively treating adenoma.

[0161] discuss

[0162] Currently, treatments for IBD include aminosalicylate, corticosteroids (CS), immunomodulators, and biologics. These drugs are mainly used to control intestinal inflammation. However, there are no effective drugs to prevent or treat dysplasia of the intestinal epithelium caused by chronic inflammation, which means that many patients still have to undergo surgical resection to reduce the risk of colorectal cancer.

[0163] This invention reveals that abnormal intestinal epithelial proliferation in IBD is primarily due to the accumulation of large amounts of MDSCs in the lamina propria of the colonic mucosa, which promotes abnormal differentiation of intestinal stem cell lineages by producing excessive dll4. Therefore, intramedullary injection of the AAV9-IL-10 plasmid can replenish the MDSC accumulation caused by IL-10 deficiency in IBD, thereby inhibiting specific intestinal epithelial proliferation. Intramedullary injection of the AAV9-IL-10 plasmid provides continuous IL-10 replenishment, avoids the adverse reactions associated with systemic administration, and its safety has been widely recognized.

[0164] Familial adenomatous polyposis (FAP) is a hereditary disease caused by APC mutations, characterized by abnormal proliferation of the intestinal epithelium. Currently, nonsteroidal anti-inflammatory drugs (NSAIDs) such as sulindac are commonly used, showing some effectiveness in promoting polyp regression; however, long-term use may cause gastrointestinal adverse reactions. Selective COX-2 inhibitors such as celecoxib, while helping to reduce the risk of cancer, may increase the incidence of cardiovascular events and are not yet recommended for patients with sporadic adenomatous polyposis. These limitations indicate that there are currently no drugs with good therapeutic effects.

[0165] The APC used in this invention Min / + Adenomatous mice are a classic FAP (fibrillary adenomatous polyps) model. Our research found that these mice exhibit IL-10 deficiency at the peak of intestinal epithelial dysplasia. Intramedullary injection of the AAV9-IL-10 plasmid replenishes the MDSC accumulation caused by IL-10 deficiency, significantly reducing the number and size of intestinal polyps and demonstrating excellent therapeutic efficacy.

[0166] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A use of interleukin-10 (IL-10), characterized in that, This is used to prepare a pharmaceutical composition for the prevention and / or treatment of diseases related to intestinal epithelial dysplasia.

2. The use as described in claim 1, characterized in that, The intestinal epithelial dysplasia-associated disease is a myeloid-derived suppressor cell (MDSC) mediated intestinal epithelial dysplasia-associated disease.

3. The use as described in claim 2, characterized in that, The MDSC-mediated intestinal epithelial dysplasia-related diseases include: adenomatous polyposis, inflammatory bowel disease (IBD), colorectal cancer, and intestinal fibrosis.

4. The use as described in claim 1, characterized in that, The pharmaceutical composition comprises: (i) Active ingredient: Expression vector containing the IL-10 coding sequence or recombinant IL-10 protein.

5. The use as described in claim 4, characterized in that, The expression vector is a recombinant adeno-associated virus (AAV) vector.

6. The use as described in claim 5, characterized in that, The recombinant adeno-associated virus (AAV) vector comprises: (A1)AAV capsid protein; and (A2) The viral genome packaged in the AAV capsid protein, the genome containing a foreign gene encoding IL-10.

7. The use as described in claim 5 or 6, characterized in that, The adeno-associated virus is AAV9.

8. The use as described in claim 4, characterized in that, The pharmaceutical composition further comprises: (ii) Pharmaceutically acceptable carriers, excipients or diluents.

9. The use as described in claim 1, characterized in that, The drug composition is administered via intramedullary injection.

10. The use as described in claim 1, characterized in that, The pharmaceutical composition has one or more functions selected from the group consisting of: (Z1) Improves abnormal proliferation and differentiation of colonic epithelium; (Z2) Maintains homeostasis of the intestinal epithelium; (Z3) Reduce the number and size of intestinal polyps.