Nucleic acid composition, application thereof and Parkinson's disease detection kit

By designing a circular single-stranded DNA structure to bind to the αS aptamer, the problem of selectively capturing and quantitatively measuring αS oligomers was solved, achieving high-precision identification and quantification of αS oligomers, and providing a new method for the early diagnosis of Parkinson's disease.

CN121874337APending Publication Date: 2026-04-17WANNAN MEDICAL COLLEGE
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
WANNAN MEDICAL COLLEGE
Filing Date
2026-01-07
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

Existing technologies struggle to selectively capture and quantify α-synuclein (αS) oligomers, particularly in identifying their heterogeneity and detecting small-sized oligomers. Furthermore, nanopore detection is susceptible to interference from other oligomeric proteins of similar size.

Method used

A circular single-stranded DNA structure was designed and modified with single-stranded oligonucleotides to form an αS aptamer, which serves as a framework for selectively capturing αS oligomers. αS oligomers with different exclusion volumes were identified using a nanopore detection device. The circular DNA framework was used to capture αS oligomers and quantitatively measure them using subpeak current signals.

Benefits of technology

This method enables selective capture and quantitative measurement of αS oligomers, and can identify αS oligomers in different aggregation states, providing a new method for the early diagnosis of Parkinson's disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121874337A_ABST
    Figure CN121874337A_ABST
Patent Text Reader

Abstract

The invention discloses a nucleic acid composition, application thereof and a Parkinson's disease detection kit. The nucleic acid composition comprises: a single-stranded circular nucleic acid comprising a DNA sequence as shown in SEQ ID No.1; and a single-stranded oligonucleotide capable of complementarily hybridizing to the single-stranded cyclic nucleic acid and capable of specifically binding to a monomer or oligomer of alpha-synuclein. The nucleic acid composition can be applied to nanopore detection of the exclusion volume of the alpha-synuclein oligomer. The alpha S oligomers in different aggregation states in a sample can be specifically captured through a designed annular DNA frame structure, and due to the fact that unique via hole signals with sub-peaks are generated through capturing of the annular structure of the frame, quantitative measurement of the volume of the alpha S oligomers can be achieved through statistical analysis of the sub-peak signals. The invention can provide a new thought and strategy for early diagnosis of Parkinson's disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to an electrochemical sensing element and its application, and more particularly to a nucleic acid composition and its application in nanopore detection or Parkinson's disease detection kits. Background Technology

[0002] Alpha-synuclein (αS) is a small protein primarily found in neuronal synapses, where it plays a crucial role. Monomeric αS misfolds to form soluble oligomers, which have been shown to be associated with various neurodegenerative diseases, particularly Parkinson's disease. These αS oligomers are considered neurotoxic, impairing neuronal function. Related studies have shown that structural disturbances in αS occur before the onset of Parkinson's disease symptoms; therefore, αS oligomers could serve as potential biomarkers for early diagnosis of Parkinson's disease. Furthermore, research indicates that smaller, non-fibrous αS oligomers (less than 100 nm) are more cytotoxic than larger, mature fibrous αS and are essential for the development and progression of Parkinson's disease.

[0003] Currently, the detection of αS mainly relies on real-time oscillation-induced transformation (RT-QuIC) technology. However, this technique typically requires adding pre-formed αS oligomers as seeds to biological fluid samples to induce misfolding of native proteins into amyloid aggregates, followed by labeling with fluorescent molecules. Although this technique can quantitatively detect αS with amyloid structures in complex biological fluids, it can only detect larger αS aggregates. Furthermore, the misfolding process of αS generates various coexisting heterogeneous oligomers of different sizes and morphologies, and this technique cannot accurately identify the heterogeneous characteristics of αS aggregates.

[0004] Nanopores, as single-molecule detection devices, can detect small-sized natural proteins and enable high-resolution analysis of conformational changes in single molecules. Solid-state nanopores, in particular, offer advantages such as tunable pore size and ease of functionalization, allowing them to detect αS oligomers or amyloid protein structures of varying sizes. However, in clinical samples, αS can coexist in various sizes and morphologies, making it difficult to achieve high-precision identification of highly heterogeneous monomers or oligomers using only nanopores of a single size. Furthermore, other oligomeric proteins of similar size may also interfere with the detection of αS oligomers. To overcome these limitations, a method for selectively capturing and quantifying αS is needed. Summary of the Invention

[0005] Objectives of this invention: The objective of this invention is to provide a nucleic acid composition that addresses the problem of selectively capturing and quantifying αS. A second objective is to propose the application of this nucleic acid composition in the detection of α-synuclein oligomer exclusion volumes using nanopores, addressing the problem of detecting the exclusion volumes of α-synuclein oligomers in different aggregation states. A third objective is to provide a kit for detecting Parkinson's disease.

[0006] Technical solution: The nucleic acid composition of the present invention comprises: A single-stranded circular nucleic acid containing the DNA sequence shown in SEQ ID No. 1; and Single-stranded oligonucleotides that can hybridize complementaryly with the single-stranded circular nucleic acid and specifically bind to monomers or oligomers of α-synuclein.

[0007] This invention designs and synthesizes a circular single-stranded DNA structure, which is then modified with single-stranded oligonucleotides (αS aptamers) to serve as a framework for selectively capturing αS oligomers. Due to the uniform charge of the DNA backbone and the unique circular DNA structure, the captured αS oligomers can effectively pass through nanopores. Analysis of events generated by the complex passing through the pores allows for the effective identification of αS oligomers with different exclusion volumes in the sample.

[0008] Preferably, the single-stranded oligonucleotide comprises the DNA sequence shown in SEQ ID No. 2.

[0009] The 12 bases at one end of the single-stranded oligonucleotide are used for complementary hybridization with the single-stranded circular nucleic acid, and the remaining 24 bases are selectively linked to αS oligomers.

[0010] A second aspect of the present invention discloses the application of the above-described nucleic acid composition in the detection of the exclusion volume of α-synuclein oligomers using nanopores.

[0011] Specifically, the method for detecting the size exclusion volume of α-synuclein oligomers using nanopores includes the following steps: (1) The single-stranded circular nucleic acid is hybridized and incubated with the single-stranded oligonucleotide to obtain a circular DNA framework; (2) The circular DNA framework is mixed with a solution containing α-synuclein monomers and / or oligomers and incubated to obtain the test complex; (3) The nanopore detection device is used to detect the test complex, the subpeak current signal of the test complex through the pore is measured, the current change amplitude of the subpeak current signal is extracted, and the exclusion volume of α-synuclein oligomer is calculated based on the current change amplitude.

[0012] Preferably, in step (1), the hybridization incubation method is as follows: The single-stranded circular nucleic acid and the single-stranded oligonucleotide were mixed in a buffer solution at a molar ratio of 1:5-15. The mixture was heated and incubated, and then cooled to obtain a circular DNA framework.

[0013] Preferably, the method for cooling after heating and incubation is as follows: heat the mixture to 90-95°C, keep it at that temperature for at least 5 minutes, then cool it down to 70-80°C, keep it at that temperature for at least 5 minutes, and then slowly cool it to room temperature; The concentration of single-stranded circular nucleic acid in the mixture is 0.5-2.5 μmol / L, and the concentration of single-stranded oligonucleotides is 4.5-28 μmol / L.

[0014] Preferably, in step (2), the concentration of α-synuclein in the solution containing α-synuclein monomers and / or oligomers is 0.01-1 mg / mL; The incubation conditions were room temperature shaking incubation for 0.5–2 h. During this incubation, αS monomers aggregated and were simultaneously captured by the circular DNA framework. The circular DNA framework completed the capture by specifically linking its carried single-stranded oligonucleotides (αS aptamers) to the aggregated αS oligomers.

[0015] Preferably, in step (3), the nanopore detection device includes a silicon nitride film containing nanopores and a container filled with an electrolyte solution, wherein the silicon nitride film is immersed in the electrolyte solution, and the nanopores on the silicon nitride film are the only channels through which ions in the electrolyte solution pass. The detection method using a nanopore detection device is as follows: The composite to be tested is added to one side of the silicon nitride film, and a positive voltage is applied to the other side of the silicon nitride film. The through-hole current change signal is recorded.

[0016] In some embodiments, the silicon nitride film has a thickness of 15-30 nm and is deposited on a 200-300 μm thick silicon substrate by low-pressure chemical vapor deposition; the nanopores on the silicon nitride film are obtained by dielectric breakdown or transmission electron microscopy (TEM).

[0017] Preferably, the pore size of the nanopore is 10-20 nm, the electrolyte solution is an aqueous solution of potassium chloride, sodium chloride or lithium chloride, and the positive voltage ranges from 100 to 300 mV.

[0018] In some embodiments, the subpeak signal of the test complex passing through the nanopore is generated by α-synuclein oligomers captured by a circular DNA framework passing through the nanopore. The method for extracting the current change amplitude of this subpeak current signal is as follows: extract the current change amplitude of the subpeak signal present in each current change signal over a period of time (…). I).

[0019] The method for calculating the exclusion volume of the α-synuclein oligomer is as follows: The current change amplitude of all extracted sub-peak signals ( I) Statistical analysis was performed, and the peak values ​​of different current variation distributions were obtained through fitting. The exclusion volume of the αS oligomer was then quantitatively calculated using the following formula. Λ ):

[0020] σ The conductivity of the electrolyte solution; V The applied voltage value; h eff This represents the effective thickness of the silicon nitride thin film.

[0021] A third aspect of the present invention discloses a Parkinson's disease detection kit, comprising the above-described nucleic acid composition, buffer solution, and the above-described nanopore detection device.

[0022] In this invention, the buffer solution can be either phosphate buffer or TE buffer. TE buffer is composed of Tris and EDTA.

[0023] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: This invention proposes a method for the quantitative detection of αS oligomer volume. The invention utilizes a designed circular DNA framework structure to specifically capture αS oligomers in different aggregation states within a sample. The circular structure of the framework generates unique through-pore signals with sub-peaks, and statistical analysis of these sub-peak signals allows for the quantitative measurement of αS oligomer volume. This invention provides a novel approach and strategy for the early diagnosis of Parkinson's disease. Attached Figure Description

[0024] Figure 1 This is a 3% agarose gel electrophoresis diagram of the circular DNA framework of this invention; Figure 2 This is a schematic diagram of the present invention utilizing solid nanopores to assist in the detection of αS oligomers within a circular DNA framework; Figure 3 This is the opening current trajectory of the 10 nm diameter silicon nitride nanopore of the present invention under different voltages; Figure 4 This invention utilizes a 10 nm diameter nanopore to detect the current trajectory of αS oligomers captured by a circular DNA framework after 2 hours of incubation, as well as representative current signals with subpeaks. Figure 5 It is the sub-peak signal current of this invention ( I) Distribution bar chart and fitted curve; Figure 6The present invention uses a 20 nm diameter nanopore to detect the representative sub-peak current signal of αS oligomers captured by a circular DNA framework incubated for 2 h. Figure 7 This invention describes the detection of αS oligomer current trajectory after 0.5 h incubation using a 10 nm diameter nanopore. Figure 8 This invention describes the detection of αS oligomer current trajectory after 2 hours of incubation using a 10 nm diameter nanopore. Figure 9 The present invention uses a 10 nm diameter nanopore to detect the current trajectories of circular DNA frameworks and β-lactoglobulin and Aβ1-42 protein oligomers after 2 h of incubation. Figure 10 This is a comparison of the subpeak signal frequencies after incubation of the circular DNA framework of this invention with different proteins. Detailed Implementation

[0025] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0026] Example 1: A nucleic acid composition comprising: Single-stranded circular nucleic acid, its base sequence is: GCCTGGAGATACATGCACATTACGGCTTTCCCTATTAGAAGGTCTCAGGTGCGCGTTTCGGTAAGTAGACGGGACCAGTTCGCCGGGCGGCGACCTT (SEQ ID No. 1); The DNA aptamer chain of the αS oligomer has the following base sequence: AGGTCGCCGCCCGGTGCGGCGGACTAGTGGGTGTG (SEQ ID No. 2). The method for detecting the exclusion volume of α-synuclein oligomers using the above nucleic acid composition is as follows: (1) Dissolve the single-stranded circular nucleic acid and the DNA aptamer strand in 1×TE buffer to obtain a circular DNA single-stranded solution with a concentration of 10 μmol / L and a DNA aptamer strand solution with a concentration of 10 μmol / L. The circular DNA single-stranded solution and the DNA aptamer strand solution were mixed at a volume ratio of 1:10 and incubated for complementary hybridization according to the following procedure: 95 °C (5 min), 75 °C (5 min), and cooled slowly from 75 °C to 25 °C at a rate of 1 °C / min to obtain the circular DNA framework, which was then stored at 4 °C. The circular DNA framework was characterized by 3% agarose gel electrophoresis, and the results are shown below. Figure 1 As shown. By Figure 1It is evident that the band in lane 2 is produced by complementary hybridization of a mixture of single-stranded circular nucleic acid and DNA aptamer strands. Compared to lane 1, a clear band of hybridization complex (circular DNA framework) appears, indicating that the hybridization of single-stranded circular nucleic acid and DNA aptamer was successful.

[0027] (2) The circular DNA framework synthesized by hybridization (20 μL) was mixed with 1×PBS solution (30 μL) containing 0.1 mg / mL αS monomer and incubated at room temperature for 2 h at 200 rpm to obtain the test complex; (3) The nanopore detection device was used to detect the test complex: like Figure 2 As shown, the nanopore detection device includes a 20 nm thick silicon nitride suspended membrane with a 10 nm diameter nanopore. This membrane is mounted in a fluid cell, and an electrolyte aqueous solution containing 1 M KCl, 10 mM Tris-HCl, and pH 8.5 is added to both chambers of the fluid cell. Two Ag / AgCl electrode wires are inserted into the two chambers of the fluid cell, respectively, with their other ends connected to patch-clamp current amplifiers. Subsequently, positive and negative voltages (200 mV to -200 mV) are applied to the reverse side of the fluid cell, and the negative opening current control is recorded, as shown below. Figure 3 As shown.

[0028] The composite to be tested was added to the compliant side of the fluid pool with a 10 nm diameter silicon nitride nanopore, while a positive voltage was applied to the other side of the silicon nitride film. Figure 4 The image shows the ion current trajectory of the nanopore under an applied voltage of 300 mV, with a large number of subpeak signals appearing.

[0029] (4) Extract the current change amplitude of all the above sub-peak current signals. I ), and perform statistical analysis. Through fitting, four distribution peaks can be obtained, such as Figure 5 As shown, according to the formula:

[0030] σ The conductivity of the electrolyte solution; V The applied voltage value; h eff This represents the effective thickness of the silicon nitride thin film.

[0031] The size exclusion volume of the corresponding αS oligomer can be calculated. The wavelengths are 56.52 nm and 56.52 nm, respectively. 3 98.65 nm 3 165.70nm 3 210.77 nm3 .

[0032] Example 2: Everything else is the same as in Example 1, except that: The nanopores on the silicon nitride film have a diameter of 20 nm.

[0033] Test results are as follows Figure 6 As shown, Figure 6 This represents the subpeak signal under an applied voltage of 300 mV.

[0034] Comparative Example 1: Everything else is the same as in Example 1, except that: Replace the test complex with the following complex sample for nanopore detection: αS monomer at a concentration of 0.1 mg / mL (dissolved in 1×PBS) was incubated at room temperature for 0.5 h on a shaking incubator at 200 rpm.

[0035] Detection signal such as Figure 7 As shown, Figure 7 The nanopore ion current trajectory under a voltage of 300 mV shows no obvious through-pore current signal.

[0036] Comparative Example 2: Everything else is the same as in Example 1, except that: Replace the test complex with the following complex sample for nanopore detection: αS monomer at a concentration of 0.1 mg / mL (dissolved in 1×PBS) was incubated at room temperature for 2 h on a shaking incubator at 200 rpm.

[0037] Detection signal such as Figure 8 As shown, Figure 8 The nanopore ion current trajectory under a voltage of 300 mV shows no obvious through-pore current signal.

[0038] Comparative Example 3: Everything else is the same as in Example 1, except that: Replace the αS monomer with the β-lactoglobulin monomer.

[0039] Comparative Example 4: Everything else is the same as in Example 1, except that: Replace the αS monomer with the Aβ1-42 monomer.

[0040] The detection results of Comparative Examples 3 and 4 are as follows: Figure 9 As shown, almost no subpeak current signals were observed, indicating that the aptamers carried by the circular DNA framework were almost unable to capture the β-lactoglobulin and Aβ1-42 proteins, verifying the framework's selectivity for αS capture. By analyzing the frequency of subpeak signals, such as... Figure 10 As shown, by Figure 10 It is evident that the frequency of subpeak events after incubation of the circular DNA framework with αS is significantly different from the frequency of subpeak events after incubation with the other two proteins, thus verifying the specificity of the circular DNA framework of the present invention in capturing αS.

Claims

1. A nucleic acid composition, characterized in that, include: A single-stranded circular nucleic acid containing the DNA sequence shown in SEQ ID No. 1; and Single-stranded oligonucleotides that can hybridize complementaryly with the single-stranded circular nucleic acid and specifically bind to monomers or oligomers of α-synuclein.

2. The nucleic acid composition of claim 1, wherein The single-stranded oligonucleotide contains the DNA sequence shown in SEQ ID No.

2.

3. The use of the nucleic acid composition according to claim 1 or 2 in detecting the exclusion volume of α-synuclein oligomers using nanopores.

4. Use according to claim 3, characterized in that, Includes the following steps: (1) The single-stranded circular nucleic acid is hybridized and incubated with the single-stranded oligonucleotide to obtain a circular DNA framework; (2) The circular DNA framework is mixed with a solution containing α-synuclein monomers and / or oligomers and incubated to obtain the test complex; (3) The nanopore detection device was used to detect the complex to be tested, the subpeak current signal was measured, the current change amplitude of the subpeak current signal was extracted, and the exclusion volume of α-synuclein oligomer was calculated based on the current change amplitude.

5. Use according to claim 4, characterized in that, In step (1), the hybridization incubation method is as follows: The single-stranded circular nucleic acid and the single-stranded oligonucleotide were mixed in a buffer solution at a molar ratio of 1:5-15. The mixture was heated and incubated, and then cooled to obtain a circular DNA framework.

6. Use according to claim 5, characterized in that, The method for cooling after heating and incubation is as follows: heat the mixture to 90-95°C, keep it at that temperature for at least 5 minutes, then cool it down to 70-80°C, keep it at that temperature for at least 5 minutes, and then slowly cool it to room temperature; The concentration of single-stranded circular nucleic acid in the mixture is 0.5-2.5 μmol / L, and the concentration of single-stranded oligonucleotides is 4.5-28 μmol / L.

7. Use according to claim 4, characterized in that, In step (2), the concentration of α-synuclein in the solution containing α-synuclein monomers and / or oligomers is 0.01-1 mg / mL; The incubation conditions are room temperature incubation for 0.5-2 hours.

8. Use according to claim 4, characterized in that, In step (3), the nanopore detection device includes a silicon nitride film containing nanopores and a container filled with an electrolyte solution. The silicon nitride film is immersed in the electrolyte solution, and the nanopores on the silicon nitride film are the only channels through which ions in the electrolyte solution pass. The detection method using a nanopore detection device is as follows: The composite to be tested is added to one side of the silicon nitride film, and a positive voltage is applied to the other side of the silicon nitride film. The through-hole current change signal is recorded.

9. Use according to claim 8, characterized in that, The nanopores have a pore size of 10-20 nm, the electrolyte solution is an aqueous solution of potassium chloride, sodium chloride, or lithium chloride, and the positive voltage ranges from 100 to 300 mV.

10. A kit for the detection of Parkinson's disease, characterized in that, It includes the nucleic acid composition and buffer solution described in claim 1 and the nanopore detection device described in claim 8.