Primer pair of SNP (Single Nucleotide Polymorphism) molecular marker and application of primer pair in aspect of improving pig performance

By screening for SNP molecular markers at locus 80468065 on chromosome 14 of the pig reference genome, individuals with the GG or GA genotype were detected, solving the problem of detecting IgG concentration in pig colostrum. This significantly improved the concentration of IgG in sow colostrum and the growth performance of offspring, achieving efficient improvement in early breeding.

CN121874358APending Publication Date: 2026-04-17YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
YANGZHOU UNIV
Filing Date
2025-12-30
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

The lack of effective SNP molecular markers in existing technologies for detecting the concentration of immunoglobulin IgG in porcine colostrum makes it difficult to improve the passive immunity and survival rate of piglets in marker-assisted selection breeding.

Method used

A primer pair for an SNP molecular marker is provided, located at locus 80468065 on chromosome 14 of the pig reference genome Sscrofa version 11.1. By detecting the base polymorphism G or A, individuals with the GG or GA genotypes are screened to increase the concentration of IgG in pig colostrum. The genotype is then determined by PCR amplification and Sanger sequencing.

Benefits of technology

It significantly increases the concentration of IgG in sow colostrum, improves the weaning survival rate and litter weight gain of offspring piglets, enables early, rapid, and low-cost molecular marker-assisted breeding, and expands the range of breeding stock.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121874358A_ABST
    Figure CN121874358A_ABST
Patent Text Reader

Abstract

The invention discloses a primer pair of an SNP (Single Nucleotide Polymorphism) molecular marker and an application of the primer pair in the aspect of improving pig performance, progeny tracking verification finds that a dominant genotype (GG type or GA type) of the marker is optimized, not only can the IgG content in colostrum of a sow be remarkably improved, but also progeny piglets show remarkably higher weaning survival rate and litter weight gain; the marker has a good and stable genetic improvement effect, and can be directly used for preparing or developing breeding detection for improving the disease resistance and growth performance of pig herds; the invention finds that the site has a dominant positive effect (GG is approximately equal to GA > AA), which means that heterozygote (GA) and homozygote (GG) are reserved to have the same excellent performance in breeding practice, so that the seed reservation selection range of a core group is expanded, and early, rapid and low-cost molecular marker assisted breeding can be realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted selection technology, specifically relating to a primer pair of an SNP molecular marker and its application in improving pig performance. Background Technology

[0002] Colostrum is the sole source of nutrients and passive immune protection for newborn piglets after birth, crucial for their survival and subsequent growth and development. Due to the unique epithelial-chorionic placental structure of pigs, maternal immunoglobulins cannot be passed to the fetus across the placental barrier, resulting in newborn piglets being in an immunodeficient state. Colostrum is rich in immunoglobulin G (IgG), a core component for establishing the passive immune system in newborn piglets; its concentration directly determines whether piglets can effectively resist invasion by common pathogens such as E. coli and rotavirus. Studies have shown that piglets ingesting high-concentration IgG colostrum have significantly lower rates of diarrhea and mortality during lactation, and significantly higher weaning litter weight and growth rate. Therefore, selecting sow breeds with high colostrum IgG content is an important way to reduce piglet rearing costs and improve the economic benefits of the pig industry.

[0003] Genome-wide association studies (GWAS) have become a powerful tool for elucidating the genetic mechanisms of complex quantitative traits. Single nucleotide polymorphisms (SNPs), as third-generation genetic markers, refer to DNA sequence polymorphisms caused by variations in a single nucleotide in the genome. Due to their abundance, wide distribution, genetic stability, and ease of high-throughput automated detection, SNPs have become the preferred markers for molecular breeding. Combining GWAS technology with screening for SNP markers significantly associated with target traits allows for precise individual assessment at the genomic level, eliminating the interference of environmental factors. Applying marker-assisted selection (MAG) technology allows breeders to predict the genetic potential of gilts early in life, without waiting for sexual maturity or lactation, thus significantly shortening generation intervals, reducing feeding costs, and significantly improving the accuracy and efficiency of breeding. Although research on molecular markers for pig reproductive traits is extensive, there is still a lack of reports on tightly linked and effective SNP markers specifically targeting "colostrum IgG concentration," a key indicator determining the passive immunity of piglets. Therefore, identifying functional SNP markers that regulate IgG concentration in porcine colostrum and applying them to breeding practices is of significant theoretical and practical value for developing new pig breeds with high disease resistance and reproductive performance. The application of these markers will help improve the passive immunity and survival rate of newborn piglets, accelerate the genetic improvement of disease resistance traits in pig herds, and ultimately effectively enhance the economic benefits of pig farming. Summary of the Invention

[0004] Purpose of the invention: In view of the lack of effective molecular markers closely linked to the concentration of immunoglobulin IgG in porcine colostrum in the existing technology, the technical problem to be solved by the present invention is to provide a primer pair of SNP molecular markers that affect the concentration of immunoglobulin IgG in porcine colostrum, so as to provide guidance for the detection of immunoglobulin IgG concentration in porcine colostrum or molecular marker-assisted selection breeding.

[0005] Another technical problem that this invention aims to solve is to provide a detection reagent or a detection kit.

[0006] Another technical problem to be solved by the present invention is to provide the application of the primer pair, the reagent, or the kit in the preparation of products for determining the concentration of immunoglobulin IgG in porcine colostrum.

[0007] The technical problem to be solved by the present invention is to provide the application of the primer pair, the reagent or the kit in predicting the growth performance and survival rate of offspring piglets and / or in selecting or assisting in the selection of sows with high colostrum IgG concentration potential and / or in selecting pigs with faster growth rate and / or higher survival rate.

[0008] Another technical problem to be solved by the present invention is to provide a method for detecting the concentration of porcine colostrum immunoglobulin IgG or assessing the reproductive potential of offspring.

[0009] Another technical problem that this invention aims to solve is to provide a method for genetic improvement of pigs.

[0010] The technical problem that this invention also aims to solve is to provide a method for establishing a pig breed that improves colostrum quality and offspring growth performance.

[0011] Technical solution: To solve the above technical problems, the present invention provides a primer pair for an SNP molecular marker, wherein the SNP molecular marker has a base polymorphism at the base position 80468065 on chromosome 14 of the pig reference genome Sscrofa 11.1, and the SNP molecular marker is G or A. The primer pair sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0012] The SNP molecular marker is located at the 298th base of the nucleotide sequence shown in SEQ ID NO.1. When the SNP markers on the two chromosomes are G and G respectively, it is called the GG genotype; when the SNP markers on the two chromosomes are G and A respectively, it is called the GA genotype; when the SNP markers on the two chromosomes are A and A respectively, it is called the AA genotype. Furthermore, when the 298th nucleotide on the sequence shown in SEQ ID NO.1 is G, it is beneficial to increase the concentration of IgG in porcine colostrum. To facilitate detection and localization, this invention provides a sequence containing this SNP site, as shown below (SEQ ID NO.1).

[0013] TGGTTATTGTCCTGGCTGTATAGGTTCTTACTCACAACCTGGATGTGCGCCTGCTGGCGCATCTCCTCAGCTGACTTCATTCCAAAACAGATGTGGCTTCTAGAAGGGAAAGTGAGAGAACTGTTACATCAAAACTACTTACCAAAAATG GCGATTATGGGAGTTCCTGTCGTGGCTCAGTGGTTAACAAATCAGACTAGGAACCATGAGGTTATGGGTTTGATCCCTGGCCTTGCTCAGTGGGTTAAGGATCCGGCATTGCCATGAGCTGTGGTTGTAGGCTGCAGAGGCGGCTCG (G / A) ATCCCGCGTTGCTGTGGCTCTGGTGTAGACCGGCGGCTACAGCTCTGATTCAACCCCTAGCCTGGGAACCTCCATATGCCGTGGGAATGGCCCTAAAAAGCCAAAAAAAAAAAAGACAAGAACAAAAATGGCGATTATACACATGACT TGCCATAAGCAACCGTGTTCTTCCAACTCCTTACAGTCTCTGCTCCCTCATTATTAAACATCCCTTCGCCCTGCTGAATTGTTCCCACTTTCACTGTCTAATGAATGATGCTCACCACTCGTGTCTACCTGCTTGCTGTTAAATCCAGTA.

[0014] The present invention also provides a detection reagent containing the aforementioned primer pair.

[0015] The present invention also provides a detection kit, wherein the detection kit contains the primer pair or the detection kit described herein.

[0016] The present invention also provides the application of the primer pair, the detection reagent, or the kit described herein in the preparation of products for identifying the concentration of immunoglobulin IgG in porcine colostrum.

[0017] Specifically, when the genotype of the SNP molecular marker is GG or GA, the concentration of immunoglobulin IgG in the porcine colostrum is high; when the genotype of the molecular marker is AA, the concentration of immunoglobulin IgG in the porcine colostrum is low.

[0018] The present invention also provides the application of the primer pairs, reagents, or kits described herein in predicting the growth performance and survival rate of offspring piglets and / or in selecting or assisting in the selection of sows with high colostrum IgG concentration potential and / or in selecting pigs with faster growth rates and / or higher survival rates.

[0019] Statistical analysis and verification of this invention show that:

[0020] (1) Regarding colostrum IgG concentration: The colostrum IgG concentration of individuals with GG and GA genotypes was significantly higher than that of individuals with AA genotype, indicating that the G allele has a dominant positive effect.

[0021] (2) Regarding offspring growth performance: Tracking offspring of sows with different colostrum IgG concentrations revealed that the offspring of sows with high IgG concentrations (corresponding to the phenotypic characteristics of individuals with the dominant genotype) had significantly higher weaning survival rates and litter weight gain than those of sows with low concentrations. Therefore, using this SNP marker to screen individuals with GG and GA genotypes can help breed sows with the potential for high colostrum IgG concentrations, which is beneficial for obtaining offspring with faster growth rates and higher survival rates.

[0022] The present invention also provides a method for detecting the concentration of porcine colostrum immunoglobulin IgG or assessing the reproductive potential of offspring, comprising the following steps: performing PCR amplification and genotyping on the genomic DNA of the pig to be tested using the primers described herein; when the genotype of the SNP molecular marker is GG or GA, the pig is determined to have a high potential for colostrum IgG concentration and offspring reproductive potential; if the genotype of the SNP molecular marker is AA, the pig is determined to have a low potential for colostrum IgG concentration and offspring reproductive potential.

[0023] The method includes:

[0024] (1) Obtain the genomic DNA of the pig to be tested.

[0025] (2) PCR amplification: Using the genomic DNA as a template, PCR amplification is performed using a specific primer pair to obtain an amplification product containing the 298th base of the sequence shown in SEQ ID NO:1; preferably, the nucleotide sequences of the specific primer pair are shown in SEQ ID NO.2 and SEQ ID NO.3:

[0026] Upstream primer: F: 5'-TGGTTATTGTCCTGGCTGTATAGG-3' (SEQ ID NO.2).

[0027] Downstream primer: R: 5'- TACTGGATTTAACAGCAAGCAGGT-3' (SEQ ID NO.3).

[0028] (3) Sanger sequencing: The PCR amplification product is detected (Sanger sequencing) to determine the type of the 298th base of the sequence shown in SEQ ID NO:1, thereby determining the genotype of the SNP marker.

[0029] (4) Genetic assessment: The potential concentration of colostrum IgG in the pigs and the production potential of their offspring are assessed based on their genotypes.

[0030] The evaluation criteria are based on the type of the 298th base in the sequence shown in SEQ ID NO:1:

[0031] A. If the base at this site carries G (i.e., the test result is GG genotype or GA genotype), then the pig is determined to have a high potential for colostrum IgG concentration and offspring production potential.

[0032] B. If the base at this site is homozygous A (i.e., the test result is AA genotype), then the pig is determined to have a low potential for colostrum IgG concentration and offspring production potential.

[0033] This invention also provides a method for genetic improvement of pigs, including identifying the SNP markers of breeding pigs in a core breeding population and making corresponding selections based on the SNP markers. Specifically, it includes the following steps: selecting breeding pig individuals in the core breeding population with the GG or GA genotype at locus 80468065 (5' end) on chromosome 14, and culling breeding pig individuals with the AA genotype at that locus, in order to increase the frequency of the favorable allele G at that locus generation by generation.

[0034] This invention also provides a method for establishing a pig breed that improves colostrum quality and offspring growth performance. For pigs with the SNP marker genotype AA, site-directed mutagenesis is used to mutate the A genotype to G, thereby transforming them into the GA or GG genotype.

[0035] In some preferred embodiments, base mutations are performed using transgenic methods or gene editing methods (such as CRISPR / Cas9 technology).

[0036] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: The present invention is the first to discover, through genome-wide association analysis (GWAS), that the SNP marker located at position 80468065 on chromosome 14 of the pig reference genome is significantly correlated with the concentration of porcine colostrum immunoglobulin IgG, clarifying that the G base is a favorable allelic variant to increase the concentration of colostrum IgG, providing a precise target for early screening of highly immune breeding sows at the molecular level; (2) In the embodiments of the present invention, through offspring tracking verification, it was found that: The preferred dominant genotype of the marker (GG or GA) can not only significantly increase the IgG content in the colostrum of sows, but also the offspring piglets show significantly higher weaning survival rate and litter weight gain; indicating that the marker has a good and stable genetic improvement effect and can be directly used to prepare or develop breeding tests to improve the disease resistance and growth performance of pig herds; (3) The present invention found that the locus has a dominant positive effect (GG≈GA>AA), which means that in breeding practice, retaining heterozygotes (GA) and homozygotes (GG) has the same excellent performance, which expands the selection range of the core group and enables early, rapid and low-cost molecular marker-assisted breeding. Attached Figure Description

[0037] Figure 1 The standard curve equation plotted from the standard sample in this embodiment of the invention is: Y = (16.9068 / [1+(X / 4750.4253)]) -0.8467 ])-0.0049. Where X is the sample concentration, Y is the absorbance (OD) value, and the 8 dots represent the concentration of the serially diluted standard and the corresponding OD value.

[0038] Figure 2 This is a comparison chart of offspring growth performance in an embodiment of the invention to verify the economic value of the colostrum IgG concentration trait. Figure 2 Figure A shows a comparison of weaning survival rates of offspring from sows in high and low colostrum IgG concentration groups; Figure 2 Figure B shows a comparison of litter weight gain in piglets from sows with high and low colostrum IgG concentrations.

[0039] Figure 3 This is a Manhattan plot of genome-wide association analysis (GWAS) of porcine colostrum immunoglobulin IgG concentration traits in an embodiment of the present invention.

[0040] Figure 4 This is a QQ diagram of genome-wide association analysis (GWAS) in an embodiment of the present invention.

[0041] Figure 5 This is a box plot showing the effect of colostrum IgG concentration on different genotypes at the SNP locus (Chr14: 80468065) ​​in an embodiment of the present invention. The vertical axis represents the IgG concentration after ln conversion. *P < 0.05, ** P < 0.01.

[0042] Figure 6 This is the Sanger sequencing result of the Chr14: 80468065 G / A site in this embodiment of the invention. Detailed Implementation

[0043] The concept and technical solution of the present invention will be further described in detail below with reference to the accompanying drawings in the embodiments of the present invention.

[0044] Example 1: Construction of the experimental population, phenotypic determination (IgG concentration determination), and verification of the economic value of offspring.

[0045] 1. Laboratory animals and sample collection

[0046] The experimental group consisted of 471 Large White pigs from Beijing Zhongyu Breeding Pig Co., Ltd., ranging from first to third parity. The group was managed uniformly under consistent feeding and management conditions. Ear tissue samples were collected for DNA extraction. Colostrum was collected from piglets within six hours of birth and immediately frozen at -20°C.

[0047] 2. Colostrum IgG Concentration Determination

[0048] The concentration of IgG in colostrum samples was determined using the porcine immunoglobulin G detection kit (Cat: SEKP-0012) from Beijing Solarbio Science & Technology Co., Ltd. The main steps are as follows: 1) Add 100 μL of serially diluted standards (600, 300, 150, 75, 37.5, 18.75, 9.375 ng / mL) to the standard wells; 2) Add 100 μL of colostrum sample to the sample wells; 3) Incubate at room temperature with shaking for 60 min, discard the liquid, add 300 μL of washing buffer to each well and wash 4 times; 4) Add 100 μL of biotinylated antibody working solution to the reaction wells, incubate at room temperature with shaking for 60 min, then discard the liquid, add 300 μL of washing buffer to each well and wash 4 times; 5) Add 100 μL of enzyme conjugate working solution to the reaction wells, incubate at room temperature with shaking for 20 min, discard the liquid, add 300 μL of washing buffer to each well and wash 5 times; 6) Add 100 μL of enzyme conjugate working solution to each well. 7) Add 50 μL of chromogenic substrate TMB (3,3',5,5'-tetramethylbenzidine) to each well and incubate at room temperature in the dark for 10 min; 8) Add 50 μL of stop solution to each well and measure the absorbance (OD) at 450 nm using a microplate reader within 5 min; 9) Calculate the average OD values ​​of the standard and the test sample, and plot a standard curve using Excel software with the standard concentration as the x-axis and the absorbance OD value as the y-axis. Figure 1), the IgG concentration in the colostrum sample can be converted from the corresponding OD value to the standard curve to obtain the corresponding concentration value; 9) the obtained IgG concentration value is transformed by natural logarithm (ln), and the ln(IgG) value is used for genome-wide association analysis (GWAS).

[0049] 3. Verification of the economic value of future generations

[0050] To confirm whether the colostrum IgG concentration trait affects the growth and survival of offspring piglets, this invention tracked the production performance of the offspring piglets from the aforementioned sows. Production records, including weaning survival rate and litter weight gain, were collected from 344 sows. This data was provided by Beijing Zhongyu Breeding Pig Co., Ltd.

[0051] Grouping strategy: The sows were sorted from high to low concentration of colostrum IgG, and the top 20% of sows (69 sows) were selected as the high concentration group, and the bottom 20% of sows (69 sows) were selected as the low concentration group (Table 1).

[0052] Table 1. Production performance statistics of high-concentration and low-concentration colostrum IgG groups

[0053] The Mann-Whitney U test was performed on the weaning survival rate and litter weight gain of offspring in the high-concentration and low-concentration groups. The results are as follows: Figure 2 As shown, the weaning survival rate of offspring from sows in the high-concentration group was significantly higher than that in the low-concentration group. Figure 2 In the high-concentration group (A, p=0.035), the litter weight gain of piglets from sows in the high-concentration group was significantly higher than that in the low-concentration group (A, p=0.035). Figure 2 (B in the figure, p=0.041). This result fully confirms that the concentration of IgG in sow colostrum can directly affect the growth and survival of piglets. This provides strong practical evidence for the present invention to find SNP markers that control this trait.

[0054] 4. Genotyping and Quality Control

[0055] Genomic DNA was extracted from the collected ear tissue, and its integrity was then assessed using gel electrophoresis. The collected DNA samples were then sequenced, and all samples were analyzed using a 50kJ microarray. Quality control was then performed on the microarray data.

[0056] Marker genotype detection rate > 90%;

[0057] Individual genotype detection rate > 95%;

[0058] Minimum allele frequency > 1%;

[0059] Hardy-Weinberg equilibrium test: P > 10 -6SNP markers;

[0060] Remove SNPs that lack location information and are located on sex chromosomes.

[0061] Example 2: Genome-wide association study (GWAS)

[0062] Genome-wide association analysis was performed using the rMVP package in R. To improve detection power and effectively control false positives, the FarmCPU model was selected in this embodiment. The FarmCPU model addresses the confusion between population structure and test markers by iteratively using fixed-effects and random-effects models. The specific analysis process is as follows:

[0063] 1. Fixed-effects model step: One SNP is detected at a time, and pseudo-quantitative nucleotides (Pseudo-QTNs) screened from the random-effects model are added as covariates to the model for association analysis;

[0064] 2. Random Effects Model Step: The pseudo-QTNs were re-optimized using the significant SNPs obtained from the fixed effects model, and their effects were estimated. In the model, the ln(IgG) value after ln conversion of colostrum IgG concentration was used as the phenotypic value (Y), and the first three principal components (PCA), season, parity, etc., were used as fixed effects (covariates) to correct for population structure.

[0065] 3. Threshold Setting and Visualization: This invention uses the number of independent SNPs and the number of linkage disequilibrium blocks on each chromosome to define thresholds at the genome-wide and suggested levels. The degree of linkage disequilibrium between adjacent SNPs is calculated using PLINK 1.90. After performing linkage disequilibrium analysis on the SNPs, the sum of the number of independent SNPs and the number of blocks, 15102, is ultimately used as the effective test count. Therefore, this study sets two significance threshold levels: 3.3 × 10⁻⁶. -6 (0.05 / 15102) and 6.6×10 -5 (1 / 15102). Drawing a Manhattan plot using the rMVP package ( Figure 3 ) and QQ pictures ( Figure 4 Visualize the results.

[0066] Depend on Figure 4 As shown in the figure, the observed P-value and the expected P-value agree well on the diagonal, with deviations only occurring at the tail, indicating that the FarmCPU model effectively controls population stratification and systematic errors, and the results are true and reliable. Figure 3 It was found that the most significant autosomal locus affecting the concentration of IgG in porcine colostrum was located on chromosome 14, with a P-value of 1.23 × 10⁻⁶. -5This embodiment identifies a significant peak site (Lead SNP) on chromosome 14, physically located at position 80468065 on chromosome 14 of the pig reference genome (Sscrofa version 11.1, https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_000003025.6 / ). This site corresponds to position 298 from the 5' end of the sequence in SEQ ID NO:1, with a base of G or A.

[0067] Example 3: Verification of the effect of SNP Chr14: 80468065 on IgG concentration in Large White pig colostrum

[0068] This embodiment aims to analyze the genotyping effect of the significant SNP locus (Sscrofa 11.1 reference genome Chr14: 80468065) ​​in the Large White pig population based on the significant SNP locus discovered in Example 2, and to verify its breeding application potential.

[0069] The concentration of colostrum IgG in individuals with different genotypes at SNP loci was statistically analyzed using R software (version 4.3.1). First, the population was divided into three genotype groups: GG, GA, and AA, based on the SNP genotyping results. Then, a one-way ANOVA model was used to test the significance of phenotypic differences among the different genotype groups. For groups with significant differences, Duncan's multiple comparisons were further performed, with a significance level set at P < 0.05. Finally, box plots of genotype effects were plotted using the ggplot2 software package. Figure 5 ).

[0070] like Figure 5 The results showed that the colostrum IgG concentration in GG and GA individuals was significantly higher than that in AA individuals, indicating that the G allele at this locus exhibits a dominant effect relative to the A allele. This means that in genetic improvement, heterozygotes (GA) can play the same positive regulatory role as homozygous dominant genotypes (GG) (Table 2).

[0071] Table 2. Association analysis between Chr14: 80468065 locus genotype and mean IgG concentration

[0072] Example 4: PCR amplification detection and application verification of SNP molecular markers

[0073] To enable rapid and convenient detection of the aforementioned SNP molecular marker (Chr14:80468065) ​​in breeding practices, this embodiment established a PCR-Sanger sequencing detection system based on specific primers, and validated its effectiveness by selecting 90 sows from the Large White pig breeding population of Jiangsu Kang Le Agricultural and Animal Husbandry Co., Ltd.

[0074] 1. Primer design and synthesis

[0075] Based on the SNP site sequence shown in SEQ ID NO:1, specific amplification primers were designed using primer design software. The primer sequences are as follows:

[0076] Upstream primer: F: 5'-TGGTTATTGTCCTGGCTGTATAGG-3' (SEQ ID NO:2).

[0077] Downstream primer: R: 5'- TACTGGATTTAACAGCAAGCAGGT-3' (SEQ ID NO:3).

[0078] 2. PCR amplification system and procedure

[0079] Reaction system (25 μL): 2× Taq PCR Master Mix: 12.5 μL, upstream primer (10 μM): 1.0 μL, downstream primer (10 μM): 1.0 μL, genomic DNA template (50 ng / μL): 1.0 μL, ddH2O: 9.5 μL.

[0080] Amplification program: 95℃ pre-denaturation for 3 min; 35 cycles: 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 18 s; 72℃ final extension for 5 min; store at 4℃.

[0081] 3. Amplification specificity and sequencing detection

[0082] Five μL of the PCR product was subjected to 1.5% agarose gel electrophoresis. The results showed a single bright band between 500-750 bp, with no nonspecific amplification, indicating good primer specificity. The PCR product was sent to a sequencing company for Sanger sequencing. The sequencing peak chromatogram was read using SnapGene software, and the peak morphology at position 298 of SEQ ID NO.1 was observed. The sequencing results are as follows. Figure 6 As shown, Figure 6 In this context, A represents the GG genotype. Figure 6 In this context, B represents the AA genotype. Figure 6C in the table represents the GA genotype. The IgG concentrations of individuals with the three genotypes are shown in Table 3. The IgG concentrations of individuals with the GG and GA genotypes are similar, but higher than those of individuals with the AA genotype (Table 3).

[0083] Table 3. Average IgG concentration in colostrum samples from individuals with three different genotypes.

[0084] In summary, this invention confirms that the SNP (Chr14: 80468065, G / A) located on pig chromosome 14 is a key functional molecular marker regulating colostrum IgG concentration. This invention not only develops a specific PCR detection method for this marker (Example 4), but also reveals its significant dominant genetic effect. In breeding practice, by using the method of this invention to retain GG and GA individuals and cull AA individuals, precise selection can be achieved early on, thereby efficiently increasing the colostrum immunoglobulin level in sows and significantly improving weaning survival rate and litter weight gain of offspring through maternal effects.

Claims

1. A primer pair for an SNP molecular marker, characterized in that, The SNP molecular marker exhibits a base polymorphism at position 80468065 on chromosome 14 of the pig reference genome Sscrofa11.

1. The SNP molecular marker is G or A, and the primer pair sequences are shown in SEQ ID NO.2 and SEQ ID NO.

3.

2. The primer pair for the SNP molecular marker according to claim 1, characterized in that, The SNP molecular marker is located at the 298th base of the nucleotide sequence shown in SEQ ID NO.

1. When the SNP markers on the two chromosomes are G and G respectively, it is called the GG genotype; when the SNP markers on the two chromosomes are G and A respectively, it is called the GA genotype; when the SNP markers on the two chromosomes are A and A respectively, it is called the AA genotype; and when the 298th nucleotide on the sequence shown in SEQ ID NO.1 is G, it is beneficial to increase the concentration of IgG in porcine colostrum.

3. A detection reagent, characterized in that, The detection reagent contains the primer pair as described in claim 1 or 2.

4. A test kit, characterized in that, The detection reagent contains the primer pair as described in claim 1 or the detection reagent as described in claim 3.

5. The use of the primer pair of claim 1 or 2, the detection reagent of claim 3, or the kit of claim 4 in the preparation of products for identifying the concentration of immunoglobulin IgG in porcine colostrum.

6. In the application according to claim 5, when the genotype of the SNP molecular marker is GG or GA, the concentration of immunoglobulin IgG in the porcine colostrum is high; when the genotype of the molecular marker is AA, the concentration of immunoglobulin IgG in the porcine colostrum is low.

7. The application of the primer pair of claim 1 or 2, the reagent of claim 3, or the kit of claim 4 in predicting the growth performance and survival rate of offspring piglets and / or in selecting or assisting in the selection of sows with high colostrum IgG concentration potential and / or in selecting pigs with faster growth rate and / or higher survival rate.

8. A method for detecting the concentration of porcine colostrum immunoglobulin IgG or assessing the reproductive potential of offspring, characterized in that, The method includes the following steps: performing PCR amplification and genotyping on the genomic DNA of the pig to be tested using the primers described in claim 1; when the genotype of the SNP molecular marker is GG or GA, the pig is determined to have a high potential for colostrum IgG concentration and offspring production potential; if the genotype of the SNP molecular marker is AA, the pig is determined to have a low potential for colostrum IgG concentration and offspring production potential.

9. A method for genetic improvement of pigs, characterized in that, Includes the following steps: In the core breeding population, individuals with the GG or GA genotype at locus 80468065 on chromosome 14 (starting from the 5' end) are selected, while individuals with the AA genotype at that locus are culled, in order to increase the frequency of the favorable allele G at that locus generation by generation.

10. A method for establishing a pig breed that improves colostrum quality and offspring growth performance, characterized in that, For pigs with the SNP marker having the genotype AA, site-directed mutagenesis is used to mutate the A genotype to G, thus transforming them into the GA or GG genotype.