Recombinant strain and application thereof in production of pdrn

Abstract

The present application relates to a modified strain and its application in PDRN production, belonging to the field of microbial technology. The technical problem to be solved is that the extraction of PDRN in the prior art is limited by raw materials (fish testes), is high in price, is scarce, and has poor effect in enhancing cell activity and promoting cell synthesis of collagen. The present application provides an Escherichia coli 4-16, which has been preserved in the China General Microbiological Culture Collection Center on October 14, 2025, with a preservation number of CGMCC No. 36169. The recombinant PDRN prepared from the E. coli has a significant effect in promoting cell migration, enhancing cell activity, and promoting cell synthesis of collagen, and has great application potential in the fields of medicine, medical beauty, etc.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a modified strain and its application in PDRN production. Background Technology

[0002] PDRN (Polydeoxyribonucleotides) is a mixture of polynucleotides with a molecular weight between 50 and 1500 kDa. PDRN possesses pharmacological activities such as anti-apoptosis, anti-ischemia, and antioxidant effects. As a biomolecular raw material, PDRN is widely used in medical aesthetics, daily chemical products, skincare products, medical devices, and pharmaceutical research.

[0003] PDRN is primarily extracted from fish reproductive cells, especially sperm cells of trout and salmon, due to their rich nucleic acid content. Current PDRN extraction techniques are limited by the high price and scarcity of raw materials (fish testes), and the difficulty in controlling the molecular weight distribution of the product during degradation. Furthermore, the high-temperature reaction conditions used in some techniques easily lead to Maillard reactions, causing the product to turn yellow and affecting its quality. Therefore, finding a safe, efficient, and inexpensive source of PDRN is a pressing problem in this field.

[0004] Chinese patent application CN119824022A discloses a recombinant Escherichia coli containing a PDRN sequence and its preparation method, but does not disclose the effect of the PDRN prepared by this strain on promoting wound healing and collagen production. Summary of the Invention

[0005] The purpose of this invention is to provide a strain of Escherichia coli 4-16 and its application in PDRN production, in order to solve the technical problems in the prior art, such as the high price and scarcity of raw materials (fish testes) in PDRN extraction, and the poor effect in enhancing cell activity and promoting cell collagen synthesis.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] On the one hand, the present invention provides an Escherichia coli 4-16, which was deposited on October 14, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 36169, deposited in Beijing, China, and classified as Escherichia coli.

[0008] On the other hand, the present invention provides a microbial agent comprising the above-mentioned Escherichia coli 4-16 or a preparation thereof.

[0009] Preferably, the preparation of Escherichia coli 4-16 includes a culture of Escherichia coli 4-16, a culture extract, a lyophilized powder, a fermentation broth, a fermentation broth precipitate, a fermentation broth supernatant, or a fermentation broth extract.

[0010] Preferably, the bacterial agent is a culture extract of Escherichia coli 4-16.

[0011] On the other hand, the present invention provides the application of the above-mentioned Escherichia coli 4-16 in PDRN production.

[0012] On the other hand, the present invention provides a method for producing PDRN, the method comprising culturing the above-mentioned Escherichia coli 4-16 to obtain bacterial cells, and extracting PDRN from the bacterial cells.

[0013] On the other hand, the present invention provides PDRN prepared by the above method.

[0014] On the other hand, the present invention provides products containing the above-mentioned PDRN, including pharmaceuticals or cosmetics.

[0015] On the other hand, the present invention provides the use of the above-mentioned Escherichia coli 4-16, the above-mentioned bacterial agent, the above-mentioned method, the above-mentioned PDRN or the above-mentioned product in the preparation of pharmaceuticals.

[0016] Preferably, the drug has one or more of the following effects: anti-aging, anti-apoptosis, anti-ischemia, anti-oxidation, anti-inflammation, promoting angiogenesis, promoting tissue repair, or promoting wound healing.

[0017] Preferably, the drug further includes pharmaceutically acceptable excipients.

[0018] The present invention has at least the following beneficial effects: The strain provided by this invention can produce PDRN in large quantities through fermentation, which solves the problem of high price of PDRN extraction due to the scarcity of raw materials (fish testes). At the same time, the PDRN prepared by this strain is significantly better than commercially available products and PDRN prepared by other strains in promoting cell migration, enhancing cell activity and promoting cell collagen synthesis. Attached Figure Description

[0019] Figure 1 To examine the local micrographs of different groups at 0h and 24h in the cell migration experiment of Example 1. Detailed Implementation

[0020] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be described in detail below with reference to embodiments. Unless otherwise specified in the embodiments, conditions are performed according to conventional conditions or conditions recommended by the manufacturer. All reagents or instruments without specified manufacturers are commercially available conventional products.

[0021] Data analysis was conducted using professional data processing software, and significance analysis was performed using one-way ANOVA. P<0.05 was considered to indicate a significant difference.

[0022] Example 1: Strain Construction (1) The commercially available powdered PDRN product (Shandong Ruijiming Biotechnology Co., Ltd., polydeoxyribonucleic acid, batch number: 20240327) was dissolved in sterile ultrapure water to obtain a PDRN product dilution solution with a concentration of 200 ng / μL. The PDRN product dilution solution was subjected to gel electrophoresis detection. The results showed that the electrophoretic bands were diffuse, indicating that the sequence fragment lengths of the PDRN raw material product derived from salmon were inconsistent and it was not easy to obtain satisfactory fragment lengths.

[0023] (2) Using the TIANGEN brand pLB zero background rapid cloning kit (VT205), 200 ng / μL of PDRN was first subjected to a blunt end reaction and then ligated into the plasmid using T4 DNA ligase to construct the recombinant pLB plasmid.

[0024] (3) Mix the product from step (2) with competent gene-deficient DH5α Escherichia coli, incubate on ice for 20 min, then heat shock for 30 to 50 s, incubate on ice again for 2 min, and then add sterile LB liquid medium and shake to culture for 1 h. Centrifuge the cultured Escherichia coli at 3000 g for 3-5 min, retain about 100 μL of medium, remove excess medium, and remix the remaining medium with Escherichia coli. Spread the mixture onto a pre-prepared solid LB agar plate containing ampicillin sodium and incubate at 37 °C for 12-16 h (stop incubation before observing the growth of single colonies and before they stick together).

[0025] (4) Select white monoclonal strains on the plate and carry out large-scale culture.

[0026] (5) Using the bacterial culture from step (4) as a template, PCR amplification was performed with primer pair (pLBF (SEQ ID NO.1): CGACTCACTATAGGGAGAGCGGC and pLBR (SEQ ID NO.2): AAGAACATCGATTTTCCATGGCAG). The strains from which the fragments longer than 200 bp originated were recorded, resulting in Escherichia coli 1, Escherichia coli 2, and Escherichia coli 3. The transformant suspension was added to LB medium containing ampicillin and cultured overnight. The cultured bacterial culture was then mixed with 50% glycerol at a 1:1 ratio to prepare a final concentration of 25% bacterial culture, which was stored at -80℃ for later use.

[0027] Example 2: PDRN Preparation (1) Seed culture was prepared by culturing the strain obtained in Example 1 in liquid LB medium containing ampicillin sodium.

[0028] (2) The seed culture prepared in step (1) is mixed with the fermentation medium at a volume ratio of 10:90, and ampicillin sodium is added to prevent strain degeneration. Simultaneously, feed culture medium is added to maintain strain growth. The composition of the culture medium used in this step of this embodiment is as follows: Fermentation medium (g / L): 20 g / L yeast extract, 10 g / L tryptone, 13.5 g / L potassium dihydrogen phosphate, 1 g / L magnesium sulfate, 8 g / L glycerol; Feeding medium (g / L): 80 g / L yeast extract, 40 g / L tryptone, 13.5 g / L potassium dihydrogen phosphate, 4 g / L magnesium sulfate, 400 g / L glycerol.

[0029] When the bacterial cell concentration reaches a relatively high level (determined by measuring the light absorbance at 600 nm using a UV spectrophotometer), fermentation is stopped when the bacterial growth enters the stationary phase (at which point OD600 reaches 1.9).

[0030] (3) The fermentation broth was centrifuged at 10000g-13000g using a centrifuge to collect the bacterial cells. The collected bacterial cells were used to extract recombinant plasmids using a plasmid miniprep kit (purchased from Beijing Novley Biotechnology, catalog number: DNE55). The obtained recombinant plasmids were digested with BamHI and SalI enzymes, and then purified by gel extraction (using a gel extraction kit purchased from Beijing Novley Biotechnology, catalog number: DNE58) to obtain recombinant PDRN, which was used for subsequent experiments.

[0031] The above BamHI and SalI enzyme digestion operation is as follows: prepare the solution according to the reaction system shown in Table 1, mix well, react at 37°C for 1.5h, and then inactivate the enzyme at 65°C for 20min.

[0032] Table 1 Enzyme digestion reaction system

[0033] The Escherichia coli 1, Escherichia coli 2 and Escherichia coli 3 obtained in Example 1 were used to prepare recombinant PDRN, which were named recombinant PDRN-1, recombinant PDRN-2 and recombinant PDRN-3, respectively.

[0034] Comparative Example: PDRN Preparation The PDRN production strain previously constructed by our company, namely Escherichia coli with accession number CGMCC NO.33625 disclosed in Chinese patent application CN119824022A, was used to prepare recombinant PDRN according to the method in Example 2, and named recombinant PDRN-4.

[0035] Example 1: Cell migration assay (1) Cell plating Mouse HSF cells in the logarithmic growth phase were digested, centrifuged, and resuspended in DMEM complete medium at a concentration of 5 × 10⁻⁶ cells / mL. 5 Cell suspension at 1 / mL was seeded in 2000 μL into 6-well plates and incubated at 37°C with 5% CO2 for 24 h. Before seeding the cells, 5 straight parallel lines were drawn in the 6-well plates with a spacing of approximately 0.5 cm.

[0036] (2) Cell scratch Once the cell confluence reaches 98% or higher, use a sterile pipette tip to draw a straight line perpendicular to the bottom of the 6-well plate, with the direction of the line perpendicular to the line drawn with a marker pen. After the line is drawn, discard the original culture medium and wash the cells three times with PBS.

[0037] (3) Cell processing and observation The treatments for each group are shown in Table 2. Different experimental groups were given recombinant PDRN-1, recombinant PDRN-2, recombinant PDRN-3, and recombinant PDRN-4 diluted with 1% FBS to a final concentration of 100 μg / mL, respectively, along with commercially available salmon sperm-derived PDRN (RJMPDRN-M, batch number: 20240918, Regimemin (Shandong) Biotechnology Co., Ltd.). The control group was given the same volume of cell culture medium containing 1% FBS, 3 mL per well. All wells were incubated at 37℃ in a 5% CO2 incubator. Each group was divided into three replicates. After 24 h of incubation, an inverted microscope was used to randomly select fields of view in each well for photographing, ensuring consistent photographic conditions each time. Local micrographs of different groups at 0 h and 24 h are shown in Table 2. Figure 1 .

[0038] (4) Data Analysis The scratch area was analyzed using ImageJ software, and cell migration ability was expressed as migration rate. Cell migration rate (%) = (0h scratch area - 24h photographed scratch area) / 0h scratch area × 100%, the results are shown in Table 2.

[0039] Table 2 Comparison of the effects of different PDRNs on cell migration

[0040] Note: In the same column of data, the same letter indicates that there is no significant difference between the data (P>0.05), and different letters indicate that there is a significant difference between the data (P<0.05).

[0041] Example 2: Cell viability assay (1) Take L929 cells at 2×10 5 Cells / wells were seeded in 96-well plates and incubated overnight.

[0042] (2) The treatments for each group are shown in Table 3. Recombinant PDRN-1, recombinant PDRN-2, recombinant PDRN-3, and recombinant PDRN-4, diluted with cell culture medium containing 1% FBS to a final concentration of 100 μg / mL, and commercially available salmon sperm-derived PDRN (RJMPDRN-M, batch number: 20240918, Ruijiming (Shandong) Biotechnology Co., Ltd.) were added to different experimental groups. The control group was added with the same volume of cell culture medium containing 1% FBS. A blank group without cell inoculation (only culture medium was added) was set up to eliminate the background effect. Each group was in five replicates.

[0043] (3) After incubation for 24 h, the cells were washed with PBS, and the cell viability of different groups was measured using the CCK-8 assay kit (manufacturer: Solarbio, catalog number: CA1210). 10 μl of CCK-8 solution was added to each well (avoiding air bubbles in the wells), and the culture plate was incubated in an incubator for 2 h. The absorbance (OD) at 450 nm was measured using a microplate reader. Cell viability was calculated using the following formula: Cell viability (%) = (OD(PDRN-added) - OD(blank)) / (OD(control) - OD(blank)) × 100%. The results are shown in Table 3.

[0044] Table 3 Comparison of the effects of different PDRNs on cell viability

[0045] Note: In the same column of data, the same letter indicates that there is no significant difference between the data (P>0.05), and different letters indicate that there is a significant difference between the data (P<0.05).

[0046] Example 3: Mouse Cell Collagen Experiment (1) Cell treatment Cell seeding: Mouse HSF cells were seeded at a rate of 2 × 10⁻⁶. 5 Cells / well were seeded in 24-well plates (containing 10% FBS medium) and synchronized after adhesion (1% FBS for 12 h).

[0047] Drug stimulation: In the experimental group, the culture medium was replaced with 1% FBS medium (500 μL / well) containing 100 μg / mL of different PDRNs, and incubated for 48 h; in the control group, the culture medium was replaced with 1% FBS medium without PDRN; each group had five replicates.

[0048] (2) Sample collection Supernatant treatment: Collect the culture medium supernatant, centrifuge at 3000 rpm for 10 min at 4℃ to remove cell debris, aliquot and store at -80℃ (avoid repeated freeze-thaw cycles).

[0049] (3) ELISA detection The results of using a mouse-specific type I / III collagen ELISA kit (purchased from Shanghai Jining Industrial Co., Ltd.) are shown in Table 4.

[0050] Table 4 Comparison of the effects of different PDRNs on collagen content

[0051] Note: In the same column of data, the same letter indicates that there is no significant difference between the data (P>0.05), and different letters indicate that there is a significant difference between the data (P<0.05).

[0052] Example 4: Human Cell Collagen Test (1) Cell treatment Cell seeding: Human HSF cells were seeded at a rate of 2 × 10⁶ cells / year. 5 Cells / well were seeded in 24-well plates (containing 10% FBS medium) and synchronized after adhesion (1% FBS for 12 h).

[0053] Drug stimulation: In the experimental group, the culture medium was replaced with 1% FBS medium (500 μL / well) containing 100 μg / mL of different PDRNs, and incubated for 48 h; in the control group, the culture medium was replaced with 1% FBS medium without PDRN; each group had five replicates.

[0054] (2) Sample collection Supernatant treatment: Collect the culture medium supernatant, centrifuge at 3000 rpm for 10 min at 4℃ to remove cell debris, aliquot and store at -80℃ (avoid repeated freeze-thaw cycles).

[0055] (3) ELISA detection The results of the human-specific type I / III collagen ELISA kit (purchased from Shanghai Jining Industrial Co., Ltd.) are shown in Table 5.

[0056] Table 5 Comparison of the effects of different PDRNs on collagen content

[0057] Note: In the same column of data, the same letter indicates that there is no significant difference between the data (P>0.05), and different letters indicate that there is a significant difference between the data (P<0.05).

[0058] In summary, the recombinant PDRN-1 prepared from *Escherichia coli* 1 is significantly superior to other PDRNs in promoting cell migration, enhancing cell activity, and promoting collagen synthesis. *Escherichia coli* 1 was named *Escherichia coli* 4-16 and deposited on October 14, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 36169, located in Beijing, China. It is classified as *Escherichia coli*.

[0059] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A type of Escherichia coli ( Escherichia coli 4-16, characterized in that, It was deposited on October 14, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 36169, located in Beijing, China, and classified as *Escherichia coli*. Escherichia coli ).

2. A microbial agent, characterized in that, The bacterial agent contains Escherichia coli 4-16 as described in claim 1.

3. The application of Escherichia coli 4-16 as described in claim 1 in PDRN production.

4. A method for producing PDRN, characterized in that, The method includes culturing Escherichia coli 4-16 as described in claim 1 to obtain bacterial cells, and extracting PDRN from the bacterial cells.

5. The PDRN prepared by the method of claim 4.

6. A product comprising the PDRN of claim 5, characterized in that, The products mentioned include pharmaceuticals or cosmetics.

7. The use of the PDRN of claim 5 or the product of claim 6 in the preparation of a drug, characterized in that, The drug has the effect of promoting tissue repair.

8. The application according to claim 7, characterized in that, The drug also includes pharmaceutically acceptable excipients.

Images