Application of SINAT4 gene as negative regulatory factor in improvement of cadmium stress resistance of plants

By regulating the rice SINAT4 gene through genetic engineering, loss-of-function mutants or overexpression lines were constructed, solving the problem of unclear regulatory mechanisms of rice's response to cadmium stress, enhancing rice's tolerance to cadmium, and improving growth performance and health indicators.

CN121896254APending Publication Date: 2026-04-21SOUTH CHINA AGRICULTURAL UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610195864.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-11
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

The regulatory mechanism of the SINAT4 gene in plant cadmium stress response is unclear in the current technology, and rice has insufficient tolerance to cadmium stress, which affects food security and human health.

Method used

By using genetic engineering techniques, the SINAT4 gene in rice can be knocked out or overexpressed using the CRISPR/Cas9 system to construct loss-of-function mutants or overexpression lines, thereby regulating the plant's tolerance to cadmium stress.

Benefits of technology

It significantly enhanced rice's tolerance to cadmium, provided new molecular mechanism analysis and genetic resources, offered an important means to improve crop cadmium resistance, and improved plant growth performance and health indicators.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121896254A_ABST
    Figure CN121896254A_ABST
Patent Text Reader

Abstract

The invention provides an application of an SINAT4 gene as a negative regulatory factor in improvement of cadmium stress resistance of plants. A nucleotide sequence of the SINAT4 gene is shown as SEQ ID NO.1. The invention also provides an application of the SINAT4 gene as a negative regulatory factor in improvement of cadmium stress resistance of the plants. According to the application, a rice SINAT4 gene is adopted as a negative regulation factor to participate in a new function of responding to cadmium stress of a plant, a vector targeting the rice SINAT4 gene and an SINAT4 gene overexpression vector are constructed and are transformed into wild type rice by utilizing a genetic engineering technology, and a homozygous strain of SINAT4 gene mutation and overexpression is obtained through screening. Experiments prove that the cadmium stress resistance of rice can be improved by knocking out the SINAT4 gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant breeding and biological gene technology, specifically involving SINAT4 Application of genes as negative regulators in improving plant resistance to cadmium stress. Background Technology

[0002] Cadmium is a toxic and carcinogenic heavy metal pollutant. With accelerated industrialization and the long-term application of cadmium-containing fertilizers, global cadmium pollution in agricultural soils is becoming increasingly severe. Cadmium in soil has a wide range of sources, mainly attributed to multiple pathways including atmospheric deposition, water input, agricultural inputs, and solid waste. Cadmium is a non-essential but highly toxic heavy metal element for both plants and humans. It is difficult to degrade and highly mobile in the environment, directly inhibiting plant growth and being absorbed and accumulated in edible parts of crops, ultimately entering the human body through the food chain and posing a serious threat to human health. Rice is a staple food crop for more than half of the world's population. Compared to other crops such as wheat and corn, rice has a strong ability to absorb and accumulate cadmium from the soil and is also one of the main dietary sources of cadmium ingested by humans. Faced with the dual challenges of agricultural production safety and human health, in-depth research into crop cadmium tolerance mechanisms and the development of new cadmium-tolerant varieties have become important issues for ensuring food security and achieving sustainable agricultural development.

[0003] SINA (seven in absentia) proteins are a type of RING (really interesting new gene) E3 ubiquitin ligase. The N-terminus of the protein contains a RING domain that binds to E2 enzymes, while the C-terminus is a typical SINA domain responsible for protein dimerization and substrate binding. SINAT4 Genes as rice SINAT Key members of this family have been shown to participate in regulating plant responses to drought stress. However, current understanding of... SINAT4 No studies have been reported on its involvement in plant cadmium stress responses, and its specific regulatory mechanisms remain unclear. Summary of the Invention

[0004] To address the above problems, the purpose of this invention is to provide... SINAT4 The application of genes as negative regulatory factors in improving plant resistance to cadmium stress, the technical solution adopted in this invention is as follows: SINAT4 The nucleotide sequence of the gene is shown in SEQ ID NO.1. SINAT4 The CDS sequence of the gene is shown in SEQ ID NO.2; SINAT4 Genes are used to negatively regulate cadmium stress tolerance in plants.

[0005] Furthermore, SINAT4The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.3.

[0006] Furthermore, overexpression SINAT4 Genetically, plants have reduced tolerance to cadmium stress.

[0007] Furthermore, knock out the aforementioned SINAT4 Genes that enhance the plant's tolerance to cadmium stress.

[0008] Furthermore, overexpression SINAT4 Genes, obtained SINAT4 The overexpression lines, the SINAT4 The overexpression lines had lower plant height, aboveground fresh weight, aboveground dry weight, and chlorophyll content than the wild-type lines under cadmium treatment.

[0009] Furthermore, knock out the aforementioned SINAT4 Genes, obtained SINAT4 The gene mutant strain, as described SINAT4 The mutant strains treated with cadmium had higher plant height, aboveground fresh weight, aboveground dry weight, and chlorophyll content than the wild-type strains.

[0010] Furthermore, the plant in question is rice.

[0011] A plant breeding method for improving cadmium resistance includes: using genetic engineering to knock out a gene in rice. SINAT4 Creating using gene editing technology SINAT4 Mutants in genes, thus in rice SINAT4 Introduce loss-of-function mutations into genes.

[0012] Preferably, the method includes: using genes SINAT4 To target the gene, a CRISPR / Cas9-based sgRNA sequence was designed. A DNA fragment containing the sgRNA sequence was ligated into a CRISPR / Cas vector (such as the commercially available CRISPR / Cas vector BGK03) and transformed into rice to obtain transgenic rice with the gene function lost.

[0013] More preferably, the nucleotide sequences of the sgRNA action site are 5'-CTAATGCAGTGCTCTAATGG-3' and 5'-GATTCGACTTGACATAGCGATGG-3'.

[0014] Compared with existing technologies, the beneficial effects of this invention include: constructing targeted rice through genetic engineering technology. SINAT4 A CRISPR / Cas9 gene knockout vector was created, and this vector was transformed into wild-type rice. After resistance selection and molecular identification, the desired results were obtained. SINAT4Homozygous lines with gene mutations. Experimental results show... SINAT4 The mutant lines showed significantly enhanced resistance to cadmium stress, thus confirming that rice... SINAT4 The negative regulatory role of genes in cadmium stress response was investigated, and their functional characteristics as negative regulatory factors were clarified. SINAT4 The successful construction of mutant lines not only provides new theoretical basis for elucidating the molecular mechanisms of plant response to heavy metal stress, but also provides important target gene resources for improving crop cadmium resistance using genetic engineering technology. Given... SINAT4 The gene plays an important role in regulating cadmium resistance in plants, and it is believed that knocking out SINAT4 Genes have broad application prospects for improving cadmium resistance in plants. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0016] Figure 1 For the present invention SINAT4 A schematic diagram of the gene map and mutation sites; Figure 2 For the present invention SINAT4 A diagram showing the protein coding results of the mutant plant; Figure 3 For the identification of this invention SINAT4 Sequencing peak diagram of mutant plants; Figure 4 PCR identification for the present invention SINAT4 Results of overexpression in plants; Figure 5 For the RT-qPCR identification of the present invention SINAT4 overexpression plant bar chart; Figure 6 The wild-type ZH11 of this invention, SINAT4 Mutant strains sinat4-1, sinat4-3 as well as SINAT4 Overexpression lines SINAT4#18 , SINAT4#19 Phenotypic changes before and after cadmium treatment; Figure 7 The wild-type ZH11 of this invention, SINAT4 Mutant strains sinat4-1, sinat4-3 as well as SINAT4 Overexpression lines SINAT4#18 , SINAT4#19 Plant height data under cadmium treatment; Figure 8 The wild-type ZH11 of this invention, SINAT4 Mutant strains sinat4-1, sinat4-3 as well asSINAT4 Overexpression lines SINAT4#18 , SINAT4#19 Fresh weight data of aboveground parts under cadmium treatment; Figure 9 The wild-type ZH11 of this invention, SINAT4 Mutant strains sinat4-1, sinat4-3 as well as SINAT4 Overexpression lines SINAT4#18 , SINAT4#19 Dry weight data of aboveground parts under cadmium treatment; Figure 10 The wild-type ZH11 of this invention, SINAT4 Mutant strains sinat4-1, sinat4-3 as well as SINAT4 Overexpression lines SINAT4#18 , SINAT4#19 Chlorophyll content data under cadmium treatment. Detailed Implementation

[0017] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of protection of the present invention. Unless otherwise specified, the experimental materials, reagents, instruments, etc., used in the embodiments of the present invention are commercially available; unless otherwise specified, all technical means in the embodiments of the present invention are conventional means well known to those skilled in the art.

[0018] Example 1 Rice SINAT4 Obtaining gene mutant lines With genes SINAT4 Using this as a target, a CRISPR / Cas9-based sgRNA sequence was designed. A DNA fragment containing the encoding the sgRNA sequence was ligated into a vector carrying CRISPR / Cas, and rice was transformed to obtain transgenic rice with the gene lacking function. Figure 1 For the present invention SINAT4 A schematic diagram of the gene map and mutation sites. Figure 2 For the present invention SINAT4 A diagram showing the protein coding results of the mutant plant. Figure 3 For the identification of this invention SINAT4 Sequencing peak diagram of mutant plants. Figure 4 PCR identification for the present invention SINAT4 Image showing the results of overexpression in plants.

[0019] The specific method is as follows: (1) Design of sgRNA The nucleotide sequence of the sgRNA1 action site is 5'-CTAATGCAGTGCTCTAATGG-3', and the nucleotide sequence of the sgRNA2 action site is 5'-GATTCGACTTGACATAGCGATGG-3'.

[0020] (2) Construction of the target carrier DNA fragments containing sequences encoding sgRNA1 and sgRNA2 were constructed into the same CRISPR / Cas vector BGK03 to obtain a targeting vector named SK-gRNA-pC1300cas9.

[0021] (3) Preparation of transgenic rice Agrobacterium-mediated transformation was used to transform the targeting vector SK-gRNA-pC1300cas9 into wild-type rice ZH11. Based on the sequencing results of the T0 generation plants, two homozygous mutants with different mutation types were obtained and named... sinat4-1 (Missing 1bp) and sinat4-3 (Insert 1bp) Both of these lead to premature termination of protein expression.

[0022] Example 2 Rice SINAT4 Screening and detection of gene mutant lines DNA was extracted from transplanted transgenic plants, and specific primers were designed targeting DNA fragments within 500 bp containing the target site. sinat4 -F and sinat4 -R, amplify the DNA fragment containing the target site, the amplified PCR product is purified and sent to the company for sequencing, the sequencing results are compared with the wild-type plant sequence, and mutant plants are screened out.

[0023] sinat4 -F:5'-GCTAAGATAGTATGTACAATATGCACAT-3'; sinat4 -R:5'-GTGATATACTTCACAATAACTAACATGGT-3'.

[0024] The mutant plants were propagated, and seeds were harvested from individual plants in the T1 generation transgenic segregating population that did not contain transgenic elements such as hygromycin and Cas9. These were used to obtain loss-of-function mutants without transgenic components, which were named... sinat4-1 and sinat4-3 , SINAT4 The mutant strains showed stronger resistance to cadmium stress than the wild-type strains.

[0025] Example 3 Rice SINAT4 Obtaining gene overexpression lines SINAT4The gene is a single gene from rice, first obtained from a rice database. SINAT4 The CDS sequence of the gene is 906 bp in length and encodes a protein containing 300 amino acids. The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0026] Then construct the constitutive expression promoter driven by 35S. SINAT4 Gene overexpression vectors, based on rice SINAT4 Based on the CDS sequence of the gene, gene-specific primers were designed, and their sequences are as follows (5'-3'): SINAT4-F: gagctcggtacccggggatccATGGCCTCAGTTACTTATATTGATGAC; SINAT4-R: gcccttgctcaccatggatccCTGTTCCTTCCAAATTCTCCCA.

[0027] Then, amplification was performed using PCR technology. SINAT4 The gene was extracted, and its amplification product was recovered and purified. The pCAMBIA1300-35S-GFP-HA plasmid was digested with the restriction endonuclease BamHI. SINAT4 The gene was cloned into the pCAMBIA1300-35S-GFP-HA vector to obtain the pCAMBIA1300-35S-SINAT4-GFP-HA recombinant plasmid, which was then confirmed by PCR sequencing. Finally, the overexpression vector pCAMBIA1300-35S-SINAT4-GFP-HA was transformed into Agrobacterium EHA105 competent cells, and then obtained through rice genetic transformation technology. SINAT4 overexpression of genes, i.e. SINAT4 Overexpression lines. These were prepared using the method described in this embodiment. SINAT4 Gene overexpression lines include SINAT4#18 and SINAT4#19, such as Figure 5 As shown, SINAT4#18 and SINAT4#19 SINAT4 Gene expression levels were all above 40. SINAT4 The overexpressing gene strains showed weaker resistance to cadmium stress than the wild-type strains.

[0028] Example 4 SINAT4 Screening and detection of transgenic positive homozygous lines First, the genetically transformed... SINAT4Seeds from the overexpression lines were used as T0 generation seeds. These T0 seeds were then cultured on a medium containing a herbicide (0.001% glufosinate). Green seedlings were selected and planted in rice soil substrate; seeds collected from each plant were designated as T1 generation seeds. Next, the T1 generation seeds were cultured on a medium containing 0.001% glufosinate. Green seedlings from lines with a 3:1 ratio of green to yellow seedlings were selected and planted in rice soil substrate; seeds collected from each plant were designated as T2 generation seeds. Finally, the T2 generation seeds were cultured on a medium containing 0.001% glufosinate. Lines with all offspring producing green seedlings were selected and planted in rice soil substrate; seeds collected from each plant were designated as T2 generation seeds. SINAT4 Seeds of overexpressing homozygous transgenic lines were selected. SINAT4 Two of the gene overexpression lines were named... SINAT4 #18 and SINAT4 #19 .

[0029] right SINAT4 Seeds of the gene-positive homozygous line were subjected to RT-qPCR experiments, and the primers used in the RT-qPCR experiments were (5'-3'): SINAT4-qRT-F: CTGGCCGCAAAATGATCTGG; SINAT4-qRT-R: AAGGCCATGTTCCGTTGGAT.

[0030] The internal reference primer for ACTIN is: ACTIN-qRT-F: AGGACATTCAGCCCCTTGTC; ACTIN -qRT-R: TACTCGGGAAAACAGCACGG.

[0031] Example 5 Rice SINAT4 Biological functional analysis of gene responses to cadmium stress (1) Cadmium treatment phenotype Wild-type rice ZH11 and the rice obtained in Example 2 were used. SINAT4 mutant lines sinat4-1 and sinat4-3, Rice obtained in Example 4 SINAT4 Overexpression lines SINAT4 #18 and SINAT4 #19 Rice plants were grown in rice culture incubators and cultured in 1 / 2KB nutrient solution for two weeks. Then, cadmium was added for treatment (0µM and 2µM), and the plants were cultured for another two weeks to observe phenotypes. Each line consisted of 12 plants, and the experiment was repeated four times. The average value of the results was taken.

[0032] (2) Experimental results like Figure 6 As shown, under conditions without cadmium treatment, wild-type ZH11 and SINAT4Gene mutant lines and SINAT4 The growth of the overexpression lines showed no significant difference. Figure 7 As shown, under cadmium treatment conditions, SINAT4 The mutant lines were significantly taller than the wild-type lines, and SINAT4 The overexpression lines were significantly shorter than the wild type. Experimental results indicate that knockout... SINAT4 Genes enhance rice's tolerance to cadmium; conversely, SINAT4 Overexpression of the gene leads to reduced tolerance to cadmium in rice, i.e. SINAT4 Genes negatively regulate cadmium tolerance in rice. Rice plant height is a core agronomic trait that determines lodging resistance, light energy utilization efficiency, and yield potential, and its suitable range is closely related to variety, growth stage, and management practices.

[0033] like Figure 8 and Figure 9 As shown, under cadmium treatment conditions, SINAT4 Mutant strains sinat4-1 and sinat4-3 The aboveground biomass of the strain is greater than that of the wild-type strain; and SINAT4 Overexpression lines SINAT4#18 and SINAT4#19 The aboveground biomass of the wild-type lines is lower than that of the wild-type lines. Aboveground biomass includes aboveground fresh weight and aboveground dry weight. Aboveground fresh weight refers to the weight of the rice plant under natural moisture conditions (weighed immediately after harvest), reflecting the immediate biomass and moisture content of the plant, and is a direct indicator for quickly assessing growth status in the field. Aboveground dry weight refers to the weight of the plant after blanching at 105℃ for 30 minutes and drying at a constant temperature of 70℃ to constant weight, representing the amount of organic matter accumulated, and is the gold standard for measuring photosynthetic efficiency and nutrient conversion efficiency.

[0034] like Figure 10 As shown, under cadmium treatment conditions, SINAT4 Mutant strains sinat4-1 and sinat4-3 The chlorophyll content of the strains is higher than that of the wild-type strains; and SINAT4 Overexpression lines SINAT4 #18 and SINAT4 #19 The chlorophyll content of the rice is lower than that of the wild-type strain. The chlorophyll content of rice is a key indicator for measuring the photosynthetic capacity of leaves.

[0035] It is understood that the above embodiments only illustrate preferred embodiments of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can freely combine the above technical features without departing from the concept of the present invention, and can also make several modifications and improvements, all of which fall within the protection scope of the present invention. Therefore, all equivalent transformations and modifications made with respect to the scope of the claims of the present invention should fall within the scope of the claims of the present invention.

Claims

1. SINAT4 The application of genes as negative regulators in improving plant resistance to cadmium stress is characterized by, SINAT4 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. SINAT4 The CDS sequence of the gene is shown in SEQ ID NO.2; SINAT4 Negative regulation of cadmium stress tolerance in plants by genes.

2. The application according to claim 1, characterized in that, SINAT4 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

3. The application according to claim 1, characterized in that, Overexpression SINAT4 Genes that reduce the plant's tolerance to cadmium stress.

4. The application according to claim 1, characterized in that, Knock out the SINAT4 Genes that enhance the plant's tolerance to cadmium stress.

5. The application according to claim 3, characterized in that, Overexpression SINAT4 Genes, obtained SINAT4 The overexpression lines, the SINAT4 The overexpression lines had lower plant height, aboveground fresh weight, aboveground dry weight, and chlorophyll content than the wild-type lines under cadmium treatment.

6. The application according to claim 4, characterized in that, Knock out the SINAT4 Genes, obtained SINAT4 The gene mutant strain, as described SINAT4 The mutant strains treated with cadmium had higher plant height, aboveground fresh weight, aboveground dry weight, and chlorophyll content than the wild-type strains.

7. The application according to any one of claims 1-6, characterized in that, The plant in question is rice.

8. A carrier, characterized in that, The carrier contains SINAT4 Gene.

9. A breeding method for cadmium-resistant plants, characterized in that, include: With genes SINAT4 To target the target, a CRISPR / Cas9-based sgRNA sequence was designed. A DNA fragment encoding the sgRNA sequence was ligated into a CRISPR / Cas vector, and rice was transformed to obtain... SINAT4 Mutant plants with missing gene function.

10. The method according to claim 9, characterized in that, The nucleotide sequence of the sgRNA action site is as follows: 5'-CTAATGCAGTGCTCTAATGG-3'; 5'-GATTCGACTTGACATAGCGATGG-3'.